Cell, Vol. 64, 475--478, February8, 1991,Copyright© 1991 by Cell Press
Regulation of Transcription and Cell Identity by POU Domain Proteins Gary Ruvkun and Michael Finney Department of Molecular Biology Massachusetts General Hospital and Department of Genetics Harvard Medical School Boston, Massachusetts 02114
The POU domain is a 150-160 amino acid region consisting of a 75-82 amino acid POU-specific domain, a short variable linker region, and a 60 amino acid POU homeodomain (Figure 1). Originally found in three mammalian transcription factors and a Caenorhabditis elegans developmental control gene (Herr et al., 1988), this domain has been identified in a growing number of genes (Figure 1A). Research on the POU proteins has focused on their regulatory roles during development and the dissection of their functional domains to establish how they bind particular DNA sequences and activate transcription of distinct sets of genes. The pituitary-specific transcription factor Pit-I/GHF-1, the ubiquitous transcription factor Oct-l, and the predominantly B cell transcription factor Oct-2 have been the major subjects of biochemical dissection, while the developmental roles of Pit-IlGHF-1 and the C. elegans cell lineage control gene unc-86 have been established by a combination of expression studies and genetic analysis. POU Domains Bind DNA Physiologically relevant binding sites are known for those POU proteins originally defined as transcription factors. The Pit-I/GHF-1 and octamer-binding proteins recognize distinct high affinity sites (Figure 2). The Pit-I/GHF-1 protein binds to sites upstream of the growth hormone and prolactin genes. Oct-1 and Oct-2 bind to the octamer sequence (Figure 2), which has been found adjacent to a variety of genes. While POU domain proteins are capable of binding to single sites, two molecules of both Oct-2 and Pit-I/GHF-1 bind cooperatively to natural binding sites containing two minimal sites (Kemler et al., 1989; LeBowitz et al., 1989; Ingraham et al., 1990; and references therein). The entire POU domain is involved in DNA binding. Mutations in conserved regions of either the POU-specific domain or the POLl homeodomain strongly affect binding of Oct-1 and Pit-I/GHF-1 to their sites (Ingraham et al., 1990, and references therein). Deletion of the homeodomain or disruption of homeodomain helix 3 completely abolishes binding, while deletion of the POU-specific domain of Pit-I/GHF-1 decreases DNA binding affinities by 1000-fold (Figure 1B). The POU-specific domain and POU homeodomain of Oct-1 both contribute specific DNA contacts to an octamer binding site (Verrijzer et al., 1990). The POU-specific domain carries much of the binding site specificity: transfer of the Oct-1 POU-specific domain to Pit-I/GHF-1 increases the affinity of this hybrid POU domain for the octamer site, whereas transfer of the Oct-1 homeodomain does not increase binding to the octamer site (Ingraham et al., 1990). This is in contrast to other
Minireview
homeodomain proteins, in which specificity has been reported to be largely determined by residue 9 in homeodomain helix 3 (Hanes and Brent, 1989; Treisman et al., 1989). In fact, all POU proteins have the same amino acid (Cys) at this position, and the binding specificity of Pit-I/GHF-1 is not changed to that of the Antp class by mutating this residue to the glutamine present in Antp at that position (Ingraham et al., 1990). Octamer sequences and Pit-I/GHF-1 natural binding sites are related and nonpalindromic, with an overall consensus of (A/T)4TNCAT. We find that Pit-I/GHF-1 binding sites defined by DNAase I protection contain two imperfect direct repeats with 10 + 2 bp between corresponding nucleotides of the repeat. Similarly, sites that cooperatively bind two Oct-2 molecules can be interpreted to have two copies of an imperfect direct repeat spaced by 6-8 bp (Figure 2). Cooperative binding of purified POU proteins has been shown for only a few natural sites, but many of these sites could potentially bind two (identical or different) POU proteins. Activation of Transcription POU domain proteins are important factors in the regulation of some defined genes. Expression of Pit-I/GHF-1 or Oct-2 in HeLa cells, where these factors are not normally expressed, is sufficient to activate expression of, respectively, growth hormone and prolactin promoters, or promoters containing an octamer binding site (e.g., Ingraham et al., 1988; M~iller et al., 1988). The appearance of Oct-1 protein in many cell types correlates with the transcription of many generally expressed genes that contain the octamer motif (reviewed in Schaffner, 1989). As with other transcription factors, the DNA-binding and transcriptional activation functions are separable in the Oct-l, Oct-2, and Pit-I/GHF-1 proteins (Figure 1A). Both Oct-1 and Oct-2 have a glutamine-rich transcriptional activation domain, and Oct-2 and Pit-I/GHF-1 have a Ser/Thr-rich activation domain adjacent to the POU domain (Gerster et al., 1990; M011er-lmmergluck et al., 1990; Tanaka and Herr, 1990; Ingraham et al., 1990; and references therein). Even though Oct-1 and Oct-2 bind the same sites and bear POU domains that are 87% identical, they activate distinct sets of genes: Oct-1 activates the transcription of the ubiquitously expressed histone and snRNA genes, and Oct-2 activates transcription of the B cell-specific immunoglobulin genes. Oct-1 does not activate transcription from a model mRNA transcription unit bearing a distal octamer enhancer element; however, replacement of its C-terminal transcriptional activation domain with that of Oct-2 allows the hybrid protein to activate transcription from this promoter (Tanaka and Herr, 1990). Thus, distinct activation domains may be necessary to activate transcription from mRNA and snRNA promoter-enhancers. Oct-1 can activate transcription of a model mRNA gene bearing an octamer enhancer element by forming a complex with the herpes simplex virus VP16 gene product. VP16 contains a strong acidic transcriptional activation domain but has no intrinsic DNA binding activity. Upon in-
Cell 476
A
Gene
Source
I
Pit-1
Rat
II
oct-1
Human
oct-2
Human
ceh-6
Caenorhabditis
III
POUs
Act-ST
Act-O
POUHD
~
-
-
-
~
.
.
-
Tst-1/SCIP/oct-6 Rat/Mouse Cfl a
Drosophila
Brn-1, Brn-2
Human
I V unc-86
V
Caenorhabditis
Brn-3
Rat
oct-3/4
Mouse
- - - ~ - - -
B conserved
POUs LEF A
affect DNA binding preserve DNA binding
RIKLC'rQ
K
~
VG
POUHD
SQ
TI R F E
L LS
S
L
i
W
~ P
VP16 interaction
Figure 1. Features of POU Domains and POU Domain Genes (A) Scale drawings of functional domains of POU genes, POU domains are indicated as a pair of boxes divided into subregions as in (B). Also shown are regions important in transcriptional activation, rich in either Ser and Thr (ST) or Gin (Q). Genes are grouped by sequence similarity. (B) Subregions of the POU domain: X, an acidic region of 8-14 amino acids with extended but weaker similarity among POU domains; A, a basic region of 31 amino acids; I, the insert region, has 6 amino acids in class IV genes and 3 amino acids in other classes; B, a 34 amino acid region; L, a linker region of 15-27 amino acids that is similar within a class but has very little similarity between classes; POUHD, the POU homeodomain, within which a helices are marked by H1, H2, and H3/4. Amino acids marked "conserved" are identical in all POU domains. Mutations indicated to preserve DNA binding affect DNA binding by less than about 10-fold. "VP16 interaction" shows the seven positions that differ between Oct-1 and Oct-2 in the region that allows VP16 to discriminate between them. Mutations made together in the same construct are indicated by boxes; a thick bar indicates that these residues were scrambled in order. Alanine substitution mutations were made in Oct-1 (Sturm and Herr, 1988); proline substitution mutations, scrambling mutations, and point mutations in homeodomain helix 3 were made in Pit-I/GHF-1 (Ingraham et al., 1990); VP16 interaction mutations were made in Oct-1 (Stern et al., 1989).
fection of a cell by herpes simplex virus, VP16 released from the virion recruits Oct-1 and at least one other host protein into a c o m p l e x to activate transcription of immediate early viral g e n e s (O'Hare and Goding, 1988; Preston et al., 1988). Because the Oct-l-VP16 c o m p l e x protects a larger DNA s e q u e n c e from chemical modification than Oct-1 alone, other proteins in the c o m p l e x may contribute to DNA binding as well as transcriptional activation (Gerster et al., 1989). The Oct-l-VP16 interaction site maps to the POU h o m e o d o m a i n . The seven positions at which the Oct-1 and Oct-2 h o m e o d o m a i n s differ allow VP16 to discriminate between them. Three of these (on a face of helix 2) have been shown to be necessary for the interaction: c h a n g i n g these positions from the Oct-1 s e q u e n c e to that of Oct-2 decreases VP16 binding by 9 0 % (Stern et al., t989).
Thus, transcriptional activation by Oct-1 at particular promoters d e p e n d s on another transcript~ion factor, VP16, which both modifies its DNA binding and its ability to activate transcription. Such a m e c h a n i s m allows a possible solution for a paradox of g e n e control by h o m e o d o m a i n proteins: some Drosophila h o m e o d o m a i n proteins that specify distinct cell or segment identities bind to the s a m e DNA sequences. Like Oct-1 and Oct-2, these h o m e o d o main proteins may differ in their ability to interact with other transcriptional activator proteins and thus may activate distinct sets of genes.
POU Genes in Development unc-86: In several distinct neuroblast lineages of C. elegans, the POU g e n e unc-86 is required for daughter cells to b e c o m e different from their mothers. For example, in unc-86 null mutants, the lineage of a neuroblast Q is al-
Minireview 477
Source
Site
Pit- I / G H F - I binding consensus Pit-I PitBl PitB2 Growth pGH hormone d G H Prolactin P i P Pal promoter P3D and PIP e n h a n c e r PID P3P ~D ~P P4P P4D PRL-I
Sequence
Spacing S t r e n g t h
sites tANTNCAT NNWTATNCAT AAATCCAT TTATACAT TATTGCAT ATATACAT GTGTACAT TTATGCAT GCTTCTAA ATTATCCAT GATTACAT GAATATTCAT AACTTCAT TATTATTCAC GATTATAT ATATATTCAT GAGTGCATTAAAAAATGCAT TATTTTAT TTCTTATTCAT TAGGAAAT CTCTAAAACAT TTAAACAT CAAATGGTAT ATTTTGAT TAATTACAG TCATTCAT CTGAAGCAG TCATCTAT TTCCGTCAT
Octamer sites octamer ]gG oct-hept A T T T G C A T 2XOA ATTTGCAT
TNATTTGCAT ATTCAT GTATGCAA
I0 8 8
+++ +++
8 9
+++ ++
10 10 10 12 11 11 I0 9 9 9
+++++ ++++ ++++ +++ ++ ++ + + + +/-
6 8
tered such that one of its daughters, Q.p, acts as if it were Q. Does unc-86 act in the mother cell or the daughter cell? unc-86 protein is not present in Q but appears in the nucleus of Q.p within a few minutes after cell division (Finney and Ruvkun, 1990). Thus the appearance of unc-86 protein must be sensitive to an asymmetric feature of the cell division, and unc-86 protein must alter the expression of specific genes in the daughter cells to make them different from their mothers. It is not yet known whether it is unc86 transcription or translation that responds to the cell division asymmetry. Besides its role in cell lineage, unc-86 is also required for the specification of particular neural identities, unc-86 protein is found in the nuclei of 57 neurons of 27 types and is required for aspects of the differentiated phenotypes of some or all of these neurons (Finney and Ruvkun, 1990). Interestingly, these 27 neuron types share no known common features, suggesting that unc-86 does not direct any particular cellular phenotype but carries some other form of information, such as distinguishing these neurons from their close lineal relatives. This, in turn, suggests that unc86 protein may control different genes in different cells. A good candidate for control by unc-86 is the homeodomain-encoding gene mec-3, whose expression depends on unc-86 function (Way and Chalfie, 1990). However, mec-3 is normally expressed in only 5 of the 27 unc-86expressing cell types, mec-3 may be repressed in the other 22 cell types. Alternatively, other gene products may act combinatorially with the uric-86 protein to activate mec-3 in these cell types; such candidate genes have been genetically identified. Modification of Oct-1 transcriptional activation by VP16 is a possible model for such combinatorial interactions. Pit-I/GHF-I: Although Pit-I/GHF-1 mRNA and protein appear just before the growth hormone and prolactin genes are expressed in the developing pituitary, the presence of Pit-I/GHF-1 protein is not sufficient for expression of growth hormone and prolactin. A much smaller subset of cells express growth hormone or prolactin than express
B 2 weaker
synthetic
repeat 2 weakly protected
Oct-2 b i n d s cooperatively synthetic
Figure 2. Common Featuresof POU Protein Binding Sites Pit-1 sites are based on data from DNAase I footprints (Castrilloet al., 1989; Chen et al., 1990; and referencestherein);a marginof ".,5 bp was assumedto be protectedon eachside of the actualbindingsite. In all cases, afterthe best match to the bindingsite consensushad been found, a second relatedconsensussequencewas foundwithinthe boundariesof the protectedregion.Exceptfor the P2P site,the 3' repeatis the bettermatchto the consensussequence; P2P seemsto be unusualin that the 3' repeatis poorlyprotectedat low proteinconcentrations. Strength of binding is based on competition experiments(Chen et al., 1990, and referencestherein). For reference,P1P is bound with a Kd of 0.4 nM (Ingraham et al., 1990). In the most stronglybound sites, both repeats match the consensus well, and the spacing between the repeats (distance betweencorrespondingnucleotides)is10 bases.
Pit-I/GHF-1 protein (Simmons et al., 1990; Doll(~ et al., 1990). Similar regulation of Pit-I/GHF-1 activity is also observed in pituitary-derived cell lines. Expression of Pit-l/ GHF-1 in HeLa cells activates both the prolactin and growth hormone promoters, but only prolactin is activated in a lactotroph cell line (which normally expresses prolactin but not growth hormone) transfected with a Pit-I/GHF-1 expression clone and prolactin and growth hormone reporter constructs (Ingraham et al., 1990). These data argue that the lactotroph cell line either expresses an activity that represses the growth hormone gene or lacks an activity necessary for Pit-I/GHF-1 activation of growth hormone but not prolactin. The Pit-I/GHF-1 gene is necessary for growth of pituitary blast cells as well as differentiation of three pituitary cell types. Two dwarf mutations in mice have been shown to be null mutations in the Pit-I/GHF-1 gene. These mutations cause a decrease in pituitary gland size, lead to complete loss of expression of growth hormone, prolactin, and thyroid-stimulating hormone, and cause a large decrease in Pit-I/GHF-1 mRNA level (Li et al., 1990). This decrease in mRNA levels occurs even in a Pit-I/GHF-1 point mutant, suggesting that autoregulation is necessary for high levels of Pit-I/GHF-1 mRNA. in fact, the Pit-I/GHF-1 gene contains binding sites for the Pit-I/GHF-1 protein and is activated by the protein (McCormick et al., 1990). Another dwarf mutation that does not map to Pit-I/GHF-1 is necessary for Pit-I/GHF-1 expression (Li et al., 1990). This gene may regulate Pit-I/GHF-1 expression or activity. Other POU domain proteins: Oct-3 and Oct-4 are the same protein (Okamoto et al., 1990; Rosner et al., 1990; Sch61er et al., 1990). The Oct-3/4 DNA binding protein is expressed in cell lines derived from the inner cell mass of mouse embryos; expression of the gene is limited to large regions of the early embryo and the adult germline. Expression of Oct-3/4 is markedly decreased when embryonic cell lines differentiate upon exposure to retinoic acid, suggesting that the gene is expressed only in early proliferating cells (Okamoto et al., 1990; Rosner et al.,
Cell 478
1990). The protein appears to activate transcription from an enhancer bearing an octamer sequence only in germ and early embryonic cells (Sch(31er et al., 1989). Four other POU genes, identified by sequence similarity, have been shown to be transcribed in complicated and partially overlapping patterns of various regions of the rat brain (He et al., 1989). For example, Brn-3, the closest mammalian homolog of uric-86, is expressed in regions of the brain that become sensory neurons. The complex patterns of expression of the other genes do not correlate with any anatomical or cell-type features, but they may point out previously unknown c o m m o n features of the cells or regions that express the gene. While the expression patterns of POU genes are suggestive, further genetic and biochemical analyses are necessary to prove any function during development. For example, the Pit-I/GHF-1 mRNA also appears transiently in the neural tube at day 10 of mouse development; however, the viable Pit-I/GHF-1 dwarf mutant mouse probably does not have neural tube defects, suggesting that neural tube expression has no essential function.
Conclusions POU proteins have been studied in complementary ways, often generating information that may be applicable to the whole group. For instance, in the cases for which genetic data are available (unc-86 and Pit-I/GHF-1), POU genes are required for normal development of blast cells and are necessary for specifying multiple types of differentiated cells. Those POU proteins for which biochemical data are available all bind DNA with a specificity determined by the POU domains. From studies of Oct-1 and Oct-2, the transcriptional activation function of POU proteins can be promoter specific and can be modified by association with other transcription factors. We can expect that the protein-DNA interactions between the POU-specific domain and DNA, and between the homeodomain and DNA, will be mapped in the near future. It will be interesting to see if the POU-specific domain modifies the recognition of specific binding sites by the homeodomain. The search for cellular homologs of VP16 may reveal proteins that interact with the homeodomains of POU proteins to alter their activities in different cell types. Similarly, the enhancer-specific Oct-2 activation domain will be more finely m a p p e d and used to search for interacting proteins that bind or modify the region. Such interacting proteins may also be revealed when the genes that genetically interact with unc-86 or Pit-I/GHF-1 are analyzed. References
Castrillo, J.-L., Bodner, M., and Karin, M. (1989).Science 243, 814-817. Chen, R., Ingraham, H. A., Treacy,M. N., Albert, V. R., Wilson, L., and Rosenfeld, M. G. (1990). Nature 346, 583-586. Doll~, P., Castrillo, J.-L., Theill, L. E., Deerinck, T., Ellisman, M., and Karin, M. (1990). Cell 60, 809-820. Finney, M., and Ruvkun, G. (1990). Cell 63, 895-905. Gerster, T., Balmaceda, C., and Roeder, R. G. (1990). EMBO J. 9, 1635-1643. Hanes, S., and Brent, R. (1990). Cell 57, 1275-1283.
He, X., Treacy, M. M., Simmons, D. M., Ingraham, H. A., Swanson, L. W., and Rosenfeld, M. G. (1989). Nature 340, 35-42. Herr, W., Sturm, R. A., Clem, R. G., Corcoran, L. M., Baltimore, D., Ingraham, H. A., Rosenfeld, M. G., Finney, M., Ruvkun, G., and Horvitz, H. R. (1988). Genes Dev. 2, 1513-1516. Ingraham, H. A., Chen, R., Mangalam, H. J., Elsholtz, H. P., Flynn, S. E., Lin, C. R., Simmons, D. M., Swanson, L., and Rosenfeld, M. G. (1988). Cell 55, 519-529. tngraham, H. A., Flynn, S. E., Voss, J. W., Albert, V. R., Kapiloff, M. S., Wilson, L, and Rosenfeld, M. G. (1990). Cell 61, 1021-1033. Kemler, I., Schreiber, E., M011er,M. M., Matthias, R, and Schaffner, W. (1989). EMBO J. 8, 2001-2008. LeBowitz, J. H., Clerc, R. G., Brenowitz, M., and Sharp, P. A. (1989). Genes Dev. 3, 1625-1638. Li, S., Crenshaw, E. B., Rawson, E.J., Simmons, D. M., Swanson, L. W., and Rosenfeld, M. G. (1990). Nature 347, 528-533. McCormick, A., Brady, H., Theill, L. E., and Karin, M. (1990). Nature 345, 829-832. MOiler, M. M., Ruppert, S., Schaffner, W., and Matthias, P. (1988). Nature 336, 544-551. M~iller-lmmergluck, M., Schaffner, W., and Matthias, P. (1990). EMBO J. 9, 1625-1634. Okamoto, K., Okazawa, H., Okuda, A., Sakai, M., Muramatsu, M., and Hamada, H. (1990). Cell 60, 461-472. O'Hare, P., and Goding, C. R. (1988). Cell 52, 435-445. Preston, C. M., Frame, M. C., and Campbell, M. E. M. (1988). Cell 52 425-434. Rosner, M. H., Vigano, M. A., Ozata, K., Timmons, P. M., Poirier, E, Rigby, R W. J., and Staudt, L. M. (1990). Nature 345, 686-691. Schaffner, W. (1989). Trends Genet. 5, 37-39. Sch~)ler, H. R., Ruppert, S., Suzuki, N., Chowdhury, K., and Gruss, P. (1990). Nature 344, 435-439. Simmons, D. M., Voss, J. W., Ingraham, H. A., Holloway,J. M., Broide, R. S., Rosenfeld, M. G., and Swanson, L. W. (1990). Genes Dev. 4, 695-711. Stern, S., Tanaka, M., and Herr, W. (1989). Nature 341, 624-630. Sturm, R. A., and Herr, W. (1988). Nature 336, 601-604. Tanaka, M., and Herr, W. (1990). Cell 60, 375-386. Treisman, J., G6nczy, R, Vishishtha~ M., Harris, E., and Desplan, C. (1989). Cell 59, 553-562. Verrijzer, C. R, Kal, A. J., and van der Vliet, P. C. (1990). Genes Dev. 4, 1964-1974. Way, J. C., and Chalfie, M. (1989). Genes Dev. 3, 1823-1833.
Regulation of Transcription and Cell Identity by POU Domain Proteins Gary Ruvkun and Michael Finney Department of Molecular Biology Massachusetts General Hospital and Department of Genetics Harvard Medical School Boston, Massachusetts 02114
The POU domain is a 150-160 amino acid region consisting of a 75-82 amino acid POU-specific domain, a short variable linker region, and a 60 amino acid POU homeodomain (Figure 1). Originally found in three mammalian transcription factors and a Caenorhabditis elegans developmental control gene (Herr et al., 1988), this domain has been identified in a growing number of genes (Figure 1A). Research on the POU proteins has focused on their regulatory roles during development and the dissection of their functional domains to establish how they bind particular DNA sequences and activate transcription of distinct sets of genes. The pituitary-specific transcription factor Pit-I/GHF-1, the ubiquitous transcription factor Oct-l, and the predominantly B cell transcription factor Oct-2 have been the major subjects of biochemical dissection, while the developmental roles of Pit-IlGHF-1 and the C. elegans cell lineage control gene unc-86 have been established by a combination of expression studies and genetic analysis. POU Domains Bind DNA Physiologically relevant binding sites are known for those POU proteins originally defined as transcription factors. The Pit-I/GHF-1 and octamer-binding proteins recognize distinct high affinity sites (Figure 2). The Pit-I/GHF-1 protein binds to sites upstream of the growth hormone and prolactin genes. Oct-1 and Oct-2 bind to the octamer sequence (Figure 2), which has been found adjacent to a variety of genes. While POU domain proteins are capable of binding to single sites, two molecules of both Oct-2 and Pit-I/GHF-1 bind cooperatively to natural binding sites containing two minimal sites (Kemler et al., 1989; LeBowitz et al., 1989; Ingraham et al., 1990; and references therein). The entire POU domain is involved in DNA binding. Mutations in conserved regions of either the POU-specific domain or the POLl homeodomain strongly affect binding of Oct-1 and Pit-I/GHF-1 to their sites (Ingraham et al., 1990, and references therein). Deletion of the homeodomain or disruption of homeodomain helix 3 completely abolishes binding, while deletion of the POU-specific domain of Pit-I/GHF-1 decreases DNA binding affinities by 1000-fold (Figure 1B). The POU-specific domain and POU homeodomain of Oct-1 both contribute specific DNA contacts to an octamer binding site (Verrijzer et al., 1990). The POU-specific domain carries much of the binding site specificity: transfer of the Oct-1 POU-specific domain to Pit-I/GHF-1 increases the affinity of this hybrid POU domain for the octamer site, whereas transfer of the Oct-1 homeodomain does not increase binding to the octamer site (Ingraham et al., 1990). This is in contrast to other
Minireview
homeodomain proteins, in which specificity has been reported to be largely determined by residue 9 in homeodomain helix 3 (Hanes and Brent, 1989; Treisman et al., 1989). In fact, all POU proteins have the same amino acid (Cys) at this position, and the binding specificity of Pit-I/GHF-1 is not changed to that of the Antp class by mutating this residue to the glutamine present in Antp at that position (Ingraham et al., 1990). Octamer sequences and Pit-I/GHF-1 natural binding sites are related and nonpalindromic, with an overall consensus of (A/T)4TNCAT. We find that Pit-I/GHF-1 binding sites defined by DNAase I protection contain two imperfect direct repeats with 10 + 2 bp between corresponding nucleotides of the repeat. Similarly, sites that cooperatively bind two Oct-2 molecules can be interpreted to have two copies of an imperfect direct repeat spaced by 6-8 bp (Figure 2). Cooperative binding of purified POU proteins has been shown for only a few natural sites, but many of these sites could potentially bind two (identical or different) POU proteins. Activation of Transcription POU domain proteins are important factors in the regulation of some defined genes. Expression of Pit-I/GHF-1 or Oct-2 in HeLa cells, where these factors are not normally expressed, is sufficient to activate expression of, respectively, growth hormone and prolactin promoters, or promoters containing an octamer binding site (e.g., Ingraham et al., 1988; M~iller et al., 1988). The appearance of Oct-1 protein in many cell types correlates with the transcription of many generally expressed genes that contain the octamer motif (reviewed in Schaffner, 1989). As with other transcription factors, the DNA-binding and transcriptional activation functions are separable in the Oct-l, Oct-2, and Pit-I/GHF-1 proteins (Figure 1A). Both Oct-1 and Oct-2 have a glutamine-rich transcriptional activation domain, and Oct-2 and Pit-I/GHF-1 have a Ser/Thr-rich activation domain adjacent to the POU domain (Gerster et al., 1990; M011er-lmmergluck et al., 1990; Tanaka and Herr, 1990; Ingraham et al., 1990; and references therein). Even though Oct-1 and Oct-2 bind the same sites and bear POU domains that are 87% identical, they activate distinct sets of genes: Oct-1 activates the transcription of the ubiquitously expressed histone and snRNA genes, and Oct-2 activates transcription of the B cell-specific immunoglobulin genes. Oct-1 does not activate transcription from a model mRNA transcription unit bearing a distal octamer enhancer element; however, replacement of its C-terminal transcriptional activation domain with that of Oct-2 allows the hybrid protein to activate transcription from this promoter (Tanaka and Herr, 1990). Thus, distinct activation domains may be necessary to activate transcription from mRNA and snRNA promoter-enhancers. Oct-1 can activate transcription of a model mRNA gene bearing an octamer enhancer element by forming a complex with the herpes simplex virus VP16 gene product. VP16 contains a strong acidic transcriptional activation domain but has no intrinsic DNA binding activity. Upon in-
Cell 476
A
Gene
Source
I
Pit-1
Rat
II
oct-1
Human
oct-2
Human
ceh-6
Caenorhabditis
III
POUs
Act-ST
Act-O
POUHD
~
-
-
-
~
.
.
-
Tst-1/SCIP/oct-6 Rat/Mouse Cfl a
Drosophila
Brn-1, Brn-2
Human
I V unc-86
V
Caenorhabditis
Brn-3
Rat
oct-3/4
Mouse
- - - ~ - - -
B conserved
POUs LEF A
affect DNA binding preserve DNA binding
RIKLC'rQ
K
~
VG
POUHD
SQ
TI R F E
L LS
S
L
i
W
~ P
VP16 interaction
Figure 1. Features of POU Domains and POU Domain Genes (A) Scale drawings of functional domains of POU genes, POU domains are indicated as a pair of boxes divided into subregions as in (B). Also shown are regions important in transcriptional activation, rich in either Ser and Thr (ST) or Gin (Q). Genes are grouped by sequence similarity. (B) Subregions of the POU domain: X, an acidic region of 8-14 amino acids with extended but weaker similarity among POU domains; A, a basic region of 31 amino acids; I, the insert region, has 6 amino acids in class IV genes and 3 amino acids in other classes; B, a 34 amino acid region; L, a linker region of 15-27 amino acids that is similar within a class but has very little similarity between classes; POUHD, the POU homeodomain, within which a helices are marked by H1, H2, and H3/4. Amino acids marked "conserved" are identical in all POU domains. Mutations indicated to preserve DNA binding affect DNA binding by less than about 10-fold. "VP16 interaction" shows the seven positions that differ between Oct-1 and Oct-2 in the region that allows VP16 to discriminate between them. Mutations made together in the same construct are indicated by boxes; a thick bar indicates that these residues were scrambled in order. Alanine substitution mutations were made in Oct-1 (Sturm and Herr, 1988); proline substitution mutations, scrambling mutations, and point mutations in homeodomain helix 3 were made in Pit-I/GHF-1 (Ingraham et al., 1990); VP16 interaction mutations were made in Oct-1 (Stern et al., 1989).
fection of a cell by herpes simplex virus, VP16 released from the virion recruits Oct-1 and at least one other host protein into a c o m p l e x to activate transcription of immediate early viral g e n e s (O'Hare and Goding, 1988; Preston et al., 1988). Because the Oct-l-VP16 c o m p l e x protects a larger DNA s e q u e n c e from chemical modification than Oct-1 alone, other proteins in the c o m p l e x may contribute to DNA binding as well as transcriptional activation (Gerster et al., 1989). The Oct-l-VP16 interaction site maps to the POU h o m e o d o m a i n . The seven positions at which the Oct-1 and Oct-2 h o m e o d o m a i n s differ allow VP16 to discriminate between them. Three of these (on a face of helix 2) have been shown to be necessary for the interaction: c h a n g i n g these positions from the Oct-1 s e q u e n c e to that of Oct-2 decreases VP16 binding by 9 0 % (Stern et al., t989).
Thus, transcriptional activation by Oct-1 at particular promoters d e p e n d s on another transcript~ion factor, VP16, which both modifies its DNA binding and its ability to activate transcription. Such a m e c h a n i s m allows a possible solution for a paradox of g e n e control by h o m e o d o m a i n proteins: some Drosophila h o m e o d o m a i n proteins that specify distinct cell or segment identities bind to the s a m e DNA sequences. Like Oct-1 and Oct-2, these h o m e o d o main proteins may differ in their ability to interact with other transcriptional activator proteins and thus may activate distinct sets of genes.
POU Genes in Development unc-86: In several distinct neuroblast lineages of C. elegans, the POU g e n e unc-86 is required for daughter cells to b e c o m e different from their mothers. For example, in unc-86 null mutants, the lineage of a neuroblast Q is al-
Minireview 477
Source
Site
Pit- I / G H F - I binding consensus Pit-I PitBl PitB2 Growth pGH hormone d G H Prolactin P i P Pal promoter P3D and PIP e n h a n c e r PID P3P ~D ~P P4P P4D PRL-I
Sequence
Spacing S t r e n g t h
sites tANTNCAT NNWTATNCAT AAATCCAT TTATACAT TATTGCAT ATATACAT GTGTACAT TTATGCAT GCTTCTAA ATTATCCAT GATTACAT GAATATTCAT AACTTCAT TATTATTCAC GATTATAT ATATATTCAT GAGTGCATTAAAAAATGCAT TATTTTAT TTCTTATTCAT TAGGAAAT CTCTAAAACAT TTAAACAT CAAATGGTAT ATTTTGAT TAATTACAG TCATTCAT CTGAAGCAG TCATCTAT TTCCGTCAT
Octamer sites octamer ]gG oct-hept A T T T G C A T 2XOA ATTTGCAT
TNATTTGCAT ATTCAT GTATGCAA
I0 8 8
+++ +++
8 9
+++ ++
10 10 10 12 11 11 I0 9 9 9
+++++ ++++ ++++ +++ ++ ++ + + + +/-
6 8
tered such that one of its daughters, Q.p, acts as if it were Q. Does unc-86 act in the mother cell or the daughter cell? unc-86 protein is not present in Q but appears in the nucleus of Q.p within a few minutes after cell division (Finney and Ruvkun, 1990). Thus the appearance of unc-86 protein must be sensitive to an asymmetric feature of the cell division, and unc-86 protein must alter the expression of specific genes in the daughter cells to make them different from their mothers. It is not yet known whether it is unc86 transcription or translation that responds to the cell division asymmetry. Besides its role in cell lineage, unc-86 is also required for the specification of particular neural identities, unc-86 protein is found in the nuclei of 57 neurons of 27 types and is required for aspects of the differentiated phenotypes of some or all of these neurons (Finney and Ruvkun, 1990). Interestingly, these 27 neuron types share no known common features, suggesting that unc-86 does not direct any particular cellular phenotype but carries some other form of information, such as distinguishing these neurons from their close lineal relatives. This, in turn, suggests that unc86 protein may control different genes in different cells. A good candidate for control by unc-86 is the homeodomain-encoding gene mec-3, whose expression depends on unc-86 function (Way and Chalfie, 1990). However, mec-3 is normally expressed in only 5 of the 27 unc-86expressing cell types, mec-3 may be repressed in the other 22 cell types. Alternatively, other gene products may act combinatorially with the uric-86 protein to activate mec-3 in these cell types; such candidate genes have been genetically identified. Modification of Oct-1 transcriptional activation by VP16 is a possible model for such combinatorial interactions. Pit-I/GHF-I: Although Pit-I/GHF-1 mRNA and protein appear just before the growth hormone and prolactin genes are expressed in the developing pituitary, the presence of Pit-I/GHF-1 protein is not sufficient for expression of growth hormone and prolactin. A much smaller subset of cells express growth hormone or prolactin than express
B 2 weaker
synthetic
repeat 2 weakly protected
Oct-2 b i n d s cooperatively synthetic
Figure 2. Common Featuresof POU Protein Binding Sites Pit-1 sites are based on data from DNAase I footprints (Castrilloet al., 1989; Chen et al., 1990; and referencestherein);a marginof ".,5 bp was assumedto be protectedon eachside of the actualbindingsite. In all cases, afterthe best match to the bindingsite consensushad been found, a second relatedconsensussequencewas foundwithinthe boundariesof the protectedregion.Exceptfor the P2P site,the 3' repeatis the bettermatchto the consensussequence; P2P seemsto be unusualin that the 3' repeatis poorlyprotectedat low proteinconcentrations. Strength of binding is based on competition experiments(Chen et al., 1990, and referencestherein). For reference,P1P is bound with a Kd of 0.4 nM (Ingraham et al., 1990). In the most stronglybound sites, both repeats match the consensus well, and the spacing between the repeats (distance betweencorrespondingnucleotides)is10 bases.
Pit-I/GHF-1 protein (Simmons et al., 1990; Doll(~ et al., 1990). Similar regulation of Pit-I/GHF-1 activity is also observed in pituitary-derived cell lines. Expression of Pit-l/ GHF-1 in HeLa cells activates both the prolactin and growth hormone promoters, but only prolactin is activated in a lactotroph cell line (which normally expresses prolactin but not growth hormone) transfected with a Pit-I/GHF-1 expression clone and prolactin and growth hormone reporter constructs (Ingraham et al., 1990). These data argue that the lactotroph cell line either expresses an activity that represses the growth hormone gene or lacks an activity necessary for Pit-I/GHF-1 activation of growth hormone but not prolactin. The Pit-I/GHF-1 gene is necessary for growth of pituitary blast cells as well as differentiation of three pituitary cell types. Two dwarf mutations in mice have been shown to be null mutations in the Pit-I/GHF-1 gene. These mutations cause a decrease in pituitary gland size, lead to complete loss of expression of growth hormone, prolactin, and thyroid-stimulating hormone, and cause a large decrease in Pit-I/GHF-1 mRNA level (Li et al., 1990). This decrease in mRNA levels occurs even in a Pit-I/GHF-1 point mutant, suggesting that autoregulation is necessary for high levels of Pit-I/GHF-1 mRNA. in fact, the Pit-I/GHF-1 gene contains binding sites for the Pit-I/GHF-1 protein and is activated by the protein (McCormick et al., 1990). Another dwarf mutation that does not map to Pit-I/GHF-1 is necessary for Pit-I/GHF-1 expression (Li et al., 1990). This gene may regulate Pit-I/GHF-1 expression or activity. Other POU domain proteins: Oct-3 and Oct-4 are the same protein (Okamoto et al., 1990; Rosner et al., 1990; Sch61er et al., 1990). The Oct-3/4 DNA binding protein is expressed in cell lines derived from the inner cell mass of mouse embryos; expression of the gene is limited to large regions of the early embryo and the adult germline. Expression of Oct-3/4 is markedly decreased when embryonic cell lines differentiate upon exposure to retinoic acid, suggesting that the gene is expressed only in early proliferating cells (Okamoto et al., 1990; Rosner et al.,
Cell 478
1990). The protein appears to activate transcription from an enhancer bearing an octamer sequence only in germ and early embryonic cells (Sch(31er et al., 1989). Four other POU genes, identified by sequence similarity, have been shown to be transcribed in complicated and partially overlapping patterns of various regions of the rat brain (He et al., 1989). For example, Brn-3, the closest mammalian homolog of uric-86, is expressed in regions of the brain that become sensory neurons. The complex patterns of expression of the other genes do not correlate with any anatomical or cell-type features, but they may point out previously unknown c o m m o n features of the cells or regions that express the gene. While the expression patterns of POU genes are suggestive, further genetic and biochemical analyses are necessary to prove any function during development. For example, the Pit-I/GHF-1 mRNA also appears transiently in the neural tube at day 10 of mouse development; however, the viable Pit-I/GHF-1 dwarf mutant mouse probably does not have neural tube defects, suggesting that neural tube expression has no essential function.
Conclusions POU proteins have been studied in complementary ways, often generating information that may be applicable to the whole group. For instance, in the cases for which genetic data are available (unc-86 and Pit-I/GHF-1), POU genes are required for normal development of blast cells and are necessary for specifying multiple types of differentiated cells. Those POU proteins for which biochemical data are available all bind DNA with a specificity determined by the POU domains. From studies of Oct-1 and Oct-2, the transcriptional activation function of POU proteins can be promoter specific and can be modified by association with other transcription factors. We can expect that the protein-DNA interactions between the POU-specific domain and DNA, and between the homeodomain and DNA, will be mapped in the near future. It will be interesting to see if the POU-specific domain modifies the recognition of specific binding sites by the homeodomain. The search for cellular homologs of VP16 may reveal proteins that interact with the homeodomains of POU proteins to alter their activities in different cell types. Similarly, the enhancer-specific Oct-2 activation domain will be more finely m a p p e d and used to search for interacting proteins that bind or modify the region. Such interacting proteins may also be revealed when the genes that genetically interact with unc-86 or Pit-I/GHF-1 are analyzed. References
Castrillo, J.-L., Bodner, M., and Karin, M. (1989).Science 243, 814-817. Chen, R., Ingraham, H. A., Treacy,M. N., Albert, V. R., Wilson, L., and Rosenfeld, M. G. (1990). Nature 346, 583-586. Doll~, P., Castrillo, J.-L., Theill, L. E., Deerinck, T., Ellisman, M., and Karin, M. (1990). Cell 60, 809-820. Finney, M., and Ruvkun, G. (1990). Cell 63, 895-905. Gerster, T., Balmaceda, C., and Roeder, R. G. (1990). EMBO J. 9, 1635-1643. Hanes, S., and Brent, R. (1990). Cell 57, 1275-1283.
He, X., Treacy, M. M., Simmons, D. M., Ingraham, H. A., Swanson, L. W., and Rosenfeld, M. G. (1989). Nature 340, 35-42. Herr, W., Sturm, R. A., Clem, R. G., Corcoran, L. M., Baltimore, D., Ingraham, H. A., Rosenfeld, M. G., Finney, M., Ruvkun, G., and Horvitz, H. R. (1988). Genes Dev. 2, 1513-1516. Ingraham, H. A., Chen, R., Mangalam, H. J., Elsholtz, H. P., Flynn, S. E., Lin, C. R., Simmons, D. M., Swanson, L., and Rosenfeld, M. G. (1988). Cell 55, 519-529. tngraham, H. A., Flynn, S. E., Voss, J. W., Albert, V. R., Kapiloff, M. S., Wilson, L, and Rosenfeld, M. G. (1990). Cell 61, 1021-1033. Kemler, I., Schreiber, E., M011er,M. M., Matthias, R, and Schaffner, W. (1989). EMBO J. 8, 2001-2008. LeBowitz, J. H., Clerc, R. G., Brenowitz, M., and Sharp, P. A. (1989). Genes Dev. 3, 1625-1638. Li, S., Crenshaw, E. B., Rawson, E.J., Simmons, D. M., Swanson, L. W., and Rosenfeld, M. G. (1990). Nature 347, 528-533. McCormick, A., Brady, H., Theill, L. E., and Karin, M. (1990). Nature 345, 829-832. MOiler, M. M., Ruppert, S., Schaffner, W., and Matthias, P. (1988). Nature 336, 544-551. M~iller-lmmergluck, M., Schaffner, W., and Matthias, P. (1990). EMBO J. 9, 1625-1634. Okamoto, K., Okazawa, H., Okuda, A., Sakai, M., Muramatsu, M., and Hamada, H. (1990). Cell 60, 461-472. O'Hare, P., and Goding, C. R. (1988). Cell 52, 435-445. Preston, C. M., Frame, M. C., and Campbell, M. E. M. (1988). Cell 52 425-434. Rosner, M. H., Vigano, M. A., Ozata, K., Timmons, P. M., Poirier, E, Rigby, R W. J., and Staudt, L. M. (1990). Nature 345, 686-691. Schaffner, W. (1989). Trends Genet. 5, 37-39. Sch~)ler, H. R., Ruppert, S., Suzuki, N., Chowdhury, K., and Gruss, P. (1990). Nature 344, 435-439. Simmons, D. M., Voss, J. W., Ingraham, H. A., Holloway,J. M., Broide, R. S., Rosenfeld, M. G., and Swanson, L. W. (1990). Genes Dev. 4, 695-711. Stern, S., Tanaka, M., and Herr, W. (1989). Nature 341, 624-630. Sturm, R. A., and Herr, W. (1988). Nature 336, 601-604. Tanaka, M., and Herr, W. (1990). Cell 60, 375-386. Treisman, J., G6nczy, R, Vishishtha~ M., Harris, E., and Desplan, C. (1989). Cell 59, 553-562. Verrijzer, C. R, Kal, A. J., and van der Vliet, P. C. (1990). Genes Dev. 4, 1964-1974. Way, J. C., and Chalfie, M. (1989). Genes Dev. 3, 1823-1833.
