Moiecuiar Microbiology (1992) 6(5), 643-651
Regulatory mutants and transcriptional control of the Serratia marcascens extracellular nuclease gene Yi-Chi Chen,' Gregory L. Shipley,^'Timothy K. Ball^ and Michael J. Benedik^* 'Department of Biochemical and Biophysical Sciences, University of Houston, Houston, Texas 77204-5934, USA. ^Department of fi/iicrobiology and Motecutar Genetics, University oi Texas Health Science Center at Houston, Houston. Texas 77030, USA. ^fvlonsanto Co.. 700 Chesterfield Village Parkway, St Louis. Missouri 63198, USA. Summary The extracellular nuclease of Serratia marcesoens is regulated in a complex fashion. Unlike most cataboHc enzymes, it appears not to be substrate regulated. However we have shown it to be regulated by an SOSlike system in S. marcescens. Additionally nuciease expression is regulated In a growth-phase-dependent manner. In this work we demonstrate that growthphase-dependent regulation is at the transcriptional level. The putative LexA-binding site which mediates SOS regulation is shown to act as an operator site in viva. The boundaries of a minimal promoter, stilt regulated by growth phase and SOS regulation, are defined along with the transcriptional start site. However, a region upstream of the nuclease promoter is shown to enhance significantly the expression of nuclease.
Introduction Degradative enzymes are usually regulated in microbial systems. This regulation most often takes the form of substrate regulation where expression of the enzyme is induced by the presence of substrate in the cell or in the media. The enteric bacterium Serratia marcescens produces a number of extracellular enzymes, most of which are regulated in this fashion. Its extracellular proteases are regulated by the presence of protein or leucine in the media (Bromke and Hammel, 1979), chitinase is induced by the presence of chitin (Monreal and Reese, 1969;
Received 19 September, 1991; revised 14 November, 1991; accepted 18 November, 1991. 'For correspondence. Tei. (713) 743 8377; Fax (713) 743 8351.
Jones et ai, 1986), and a lipase is induced by its substrates (Winkler and Stuckman, 1979). However the extracellular nuclease, an extremely potent non-specific nuclease (Eaves and Jeffries. 1963), is apparently not regulated in this fashion. Until recently no known regulation of nuclease expression had been demonstrated; neither the addition of nucleic acids nor nucleotides regulate its expression nor is catabolite regulation, mediated by the presence or absence of glucose, observed. Despite this apparent lack of regulation, mutants have been described which increase nuclease and other extracellular enzyme expression; these, paradoxically, can only be assumed to be regulatory mutants (Winkler, 1968; Winkler and Timmis, 1973). We have recently shown that nuclease expression is regulated by an SOS-like system in S. marcescens (Ball et ai. 1990). Mutations in recA abolish nuclease expression and agents which induce the SOS system in E. coli, such as u.v. damage and mitomycin C. induce expression of nuclease to a high level. Using gene fusions this regulation was shown to occur at the transcriptional level. The 120 bases of DNA upstream from the nuclease reading frame was sufficient to allow SOSregulated nuclease expression; presumably from its normal promoter. From the DNA sequence (Ball et ai, 1987) a consensus LexA-binding site could be found just upstream of the nuclease gene. SOS regulation of extracellular protein expression is not unique to nuclease or to S. marcescens. Chitinase expression can be greatly induced by SOS induction independent of the presence or absence of chitin. The general lipase also appears to be SOS induced in S. marcescens (Ball etai, 1990), although, unlike nuclease, its expression is not abolished by a recA mutant, suggesting it is not directly repressed by LexA. The proteases and an extracellular phospholipase A are not SOS regulated (Givskov etai. 1988; S. C. Braunagei and M. J. Benedik, personal communication; M. Givskov and S. Molin, personal communication). In Erwinia carotovora the extracellular pectin lyase and carotovoricin are similarly SOS regulated (Zink etai. 1985). In this work we further characterize the expression of the extracellular nuclease. It is shown to be growth-phase regulated at the transcriptional level independent of SOS induction. The transcription start is defined and important regulatory mutants are described.
644
Y.-C. Chen, G. L Shipley. T. K. Ball and M. J. Benedik
Table 1, Nuclease promoter expression in SU mutants. Nuclease
p-Galactosidase
Strains
-mitC
+ mitC
-mitC
+ mitC
SM6 SU93 SU95 SU132 SU161
9 400 400 80 80
700 700 700 1000 1000
81 430 550 350 270
1200 1100 1100 1500 1500
The strains listed carrying the plasmid pNuc2-LacZ were grown in LB medium and a half ot each divided culture was induced wilh mitomycin C during exponential growth. The cultures were further incubated overnight and nuclease measured from Ilie culture supernatants by the micfotitre dish assay. The values listed represent the dilution factor required to show no loss of fluorescence. p-Galactosidase was assayed from the total culture.
Results Isoiation of nuclease regulatory mutants After mutagenesis by the transposon Tn5, colonies were screened for changes in their nuclease halo size. A number of mutants were found that were reduced or off for nuclease expression; these will be fully described elsewhere. Of interest here are four mutants that overexpressed nuclease. Based on halo size, two mutants, SM6-SU93 and SM6-SU95, expressed significantly more nuclease than the parent SM6; the other two mutants. SM6-SU132 and SM6-SU161, were similar and they expressed intermediate levels of nuclease. These two phenotypes are similar to the Nuc(SU) phenotypes described by Winkler (1968) and Winkler and Timmis (1973). The levels of nuclease expression and of p-galactosidase expression from a nucP-lacZ fusion of these four mutants are shown in Table 1. It is clear that promoter expression, as measured from the fusion, correlates with observed extracellular nuclease levels. Because these mutations were caused by Tn5 insertions they are gene inactivation mutations whereas the previously described mutants were chemically induced and may have been missense mutations. This allows us to conclude that the increase in nuclease expression is most likely caused by loss of a repressor rather than a promoter up-mutant or a change of function mutant in a regulatory protein. The presence of the transposon allowed the use of Tn5 as a probe on Southern blots to identify whether these mutations appeared allelic. Genomic DNA was digested with EcoRI. which does not cleave in Tn5. from the four mutants and wild-type SM6 and Southern blots were prepared (data not shown). Mutants SM6-SU93 and SM6SU95 both showed a fragment with similar mobility {>25kb) as did the pair SM6-SU132 and SM6-SU161 (20 kb). No Tn5 band was seen in SM6. This suggests that each pair of mutants with the same phenotype carry
an insertion in the same restriction fragment; thus, the mutants with the same phenotype are probably allelic. The two different phenotypes map to different restriction fragments and probably represent two different genes in which insertion mutations increase expression of nuclease. Furthermore, a 450 bp fragment of the nuclease gene itself was then used to probe the same filters, none of the mutations were in the restriction fragment carrying the nuclease gene (data not shown). Growth-phase regulation of nuclease To probe whether the appearance of extracellular nuclease was growth-phase regulated, cultures of S. marcescens were sampled during growth beginning in exponential phase and continuing to stationary phase. In Fig. 1 we have plotted the appearance of extracellular nuclease from strain SM6, with or without mitomycin C induction, as a function of culture density as well as from one of the overexpressing mutants. SM6-SU93. which does not require induction for high-level expression. The appearance of extracellular nuclease coincides with the transition of the culture from exponential to stationary phase in both strains at about the same culture density (Aeoo>2.5}. We can rule out an indirect effect of mitomycin C because the super-expressing strain shows similar kinetics. 300
250 -
200 -
150 -
100 -
2
4
6
8
ID
12
14
16
IS
20
Time (hours) Rg. 1. Cells from a fresh overnight culture were diluted back and grown until the cultures reached a measurable density. At this time {T=0) mitomycin C was added. At the time intervals shown samples were collected and the optical density (Aeoo) * a s measured and plotted as a function of time shown by the dashed lines and open symbols ( n , SM6; O, SM6 + mitC; A . SU93). Nuclease activity was measured from each culture supernatant by the microtitre dish assay and is shown by the solid lines and the same filled symbols. The volume of supernatant used in the assay was adjusted to a constant ce)l optical density. The mitomycin Cinduced culture began showing visible lysis by 8 fi and no further time points were taken from it.
Regulation of Serratia marcescens nuclease
645
C to identical nucP-/acZ bearing cultures at 1-h intervals, thereby inducing them at different cell densities, if mitomycin C addition initiates nuclease induction, the three cultures should show p-galactosidase induction at different cell densities. If growth-phase regulation is independent of the time of drug addition, then all cuitures should show an increase in nuclease expression at the same cell density, independent of the time of mitomycin C addition. The growth curves from these cultures are shown in Fig. 3A. The appearance of (i-galactosidase is plotted in Fig. 3B where we show it appeared at the same culture density (c. A6oo=1 -5). independent of the time of induction.
8
10 12 14 16
20 22 24
rime (hours) Fig. 2. Same as Fig. 1 except intracellular p-galactosidase was measured in place ol nuclease.
To investigate whether the growth-phase-regulated appearance of nuclease was at the level of expression, activation or excretion, a n[JcP-/acZ transcriptiona! fusion was used to monitor expression from that promoter. Using pNuc2-LacZ similar growth curves were performed and (i-galactosidase activity monitored. Figure 2 shows that the appearance of p-galactosidase is also growthphase regulated and closely resembles the appearance of nuclease in Fig. 1. This demonstrates that the growthphase-regulated appearance of nuclease is due to transcriptional regulation of its promoter. To provide additional confirmation that the apparent growth-phase regulation is not an indirect delayed response to mitomycin C induction, we added mitomycin 3.5
3.0 -
Using the pNuc2-LacZ transcriptional fusion plasmid we asked whether the nuclease overexpressing mutants still demonstrated growth-phase regulation of the nuclease promoter. In Fig. 4 we show that all four overexpressing mutants of strain SM6 still showed growth-phase-regulated transcription from the nuclease promoter, although the SU132 and SU161 mutant pair show a slightly later induction of p-galactosidase expression than the other two mutants and wild type.
Characterizing the nuclease transcript Total RNA was isolated from a mitomycin C-induced culture of SM6. This RNA was used for primer extension with an oligonucleotide that lies just inside the amino terminus of the nuciease open reading frame. The same primer was used to prime DNA synthesis for dideoxy sequencing on a single-strand M13 template carrying the nuclease gene. The length of the extended fragment corresponded to the A (TTC&CTGT) at position 75 on the gene sequence (Ball etai, 1987; see also Fig. 7). This position 120
100 -
1.0 0.5
0.0
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
Cell Density (O.D.) Fig. 3. An exponentially growing culture of SM6 was diluted into two flasks each at an optical density of Aeoo=0.05(*), 0,1 (•) and 0.2(A) and mitomycin C added after 1 h to 1 flask of each dilution. The growth curve of the cultures is shown in panel A. Samples were removed to assay p-gaiactosidase which is plotted in pane! B as a function of cell density.
646
Y.-C. Chen. G. L Shipley. T. K. Ball and ful. J. Benedik
0.5 1.0 1.5 2.0 2.5 5.0 5.5 4.0 4.5 5.0 5.5 6,0 Cell density (O.D.)
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0 5.5 6.0 Cell density (O.D.)
Fig. 4. Exponentially growing cultures of the overexpressing mutants were split and 1 sample of each induced with mitomycin C, At time intervals samples were removed and assayed for p galactosidase wFiicfi is ploned as a function of cell density { • , SM6-SU93; • , SM6-SU95; A , SM6-SU132; T , SM6SUi 61). Panel A shows the curve for uninduced cultures while panel B shows the curve for mitomycin C-induced cultures.
is 45 bases upstream of the gene start (data not shown). The length of the nuclease message was determined from a Northern blot shown in Fig. 5 where an internal nuclease gene probe was used to identify the nuclease mRNA. The band representing the nuclease transcript is a single band of about 1 kb in length. The 266 amino acids of the nuclease pro-protein corresponds to a gene 798 bases in length, which suggests that the nuclease message is monocistronic; there is no significant open reading frame after that of nuclease. Mapping elements in the nuclease regulatory region Previously we showed that a regulated promoter sufficient for nuclease expression lay in the 120 bases upstream of the nuclease gene after the Rsa\ restriction site (see Fig. 7). Thirty bases downstream of the Rsa\ site is a Nde\ site. A deletion was made in pNuc4-R by digestion with Nde\ followed by ligation and recircularizatlon of the plasmid. This removes the upstream 30 bases and about 250 bases of lacZ DNA from the pUCi8 vector. This plasmid was introduced into TT392 and nuclease activity was monitored with or without mitomycin C induction and compared with the parent plasmid. pNuc4-R. There was no difference in nuclease expression between the two plasmids when compared by halo size on indicator plates {uninduced) or by microtitre dish assay of induced and uninduced cultures (not shown). This 80 bp region from the Nde\ to the gene start defines a minimal promoter region. To verify that the LexA box noted previously (Ball etai, 1990) actually serves as an operator site regulating
nuclease expression, a mutation was made which abolishes an important consensus element of a LexA-binding site. The consensus site CTG(N}ioCAG was changed to CTG{N},oGGG by site-directed mutagenesis in Nuci using the LexA mutant primer listed. The wild type and the putative O'^ mutant allele were subcioned into pAC9 and nuclease activity monitored. From indicator media it was clear that the mutant greatly overexpressed nuclease. Assay results from wild-type pAC9-Nuc1 showed an induction by mitomycin C of nuclease expression from 27 to 2100. The pAC9-Nuc1-O'^ expressed an equivalent activity of 2100 and was not further induced by mitomycin C. However this plasmid causes both S. marcescens and Escherichia coli cells to grow significantly slower than
2.gkb. 2.1kb1.4kbnuclease -
Fig. 5. A northem blot of RNA prepared from uninduced (-) and mitomycin C induced SM6 (+) and probed with a probe entirely internal to the nuclease open reading frame is shown with size standards.
Regulation of Serratia marcescens nuclease 300
647
Upstream activating sequence
160
pNud
pNuc4
pNud- ASph Plaamld
Fig. 6. Nuclease was measured from supernatants of strain TTF carrying the designated plasmid and is expressed as relative dilution factor. Plasmid pNuci carries 600 bases upstream and 1000 bases downstream of the nuclease gene. The pNuc4 plasmid carries only 120 bases upstream and 500 downstream. The downstream region is deleted in pNuci-ASph. Plasmid pNuc1-Bal31A5 has only the 180 bases upstream of the nuclease gene,
with the wild-type plasmid and is very prone to mutation or rearrangement. There were two potential Met start codons noted in the sequence (Ball ef ai. 1987), the second of which was assumed to be the correct start owing to its proper placement after a good consensus ribosome-binding-site sequence. This was verified by site-directed mutagenesis where either the first (Meti") or the second (Met2~) Met codon was changed in pNuc4. When expressed either from the lac promoter in pUCI 8 or only from its own promoter in pUC19 after mitomycin C induction in S. marcescens strain TT392, it was found that less than 10% of wiid-type nuclease activity was detected from the Met2' mutant while essentially normal ieveis were found from the Met1~ mutant. The double Met1~Met2^ mutant made no detectable nuclease. The mutations were then subcioned into a lower copy-number derivative pAC9 Nuc1 where Meti" produced nuclease activities identical to the wild-type control pAC9Nuc1 while Met2~ produced less than 1% of wild-type levels. This suggests that although both Met codons can be used in vivo, the second Met codon is the predominant start codon.
Our previous work on nuclease expression (Ball ef ai, 1987; 1990) was done using the high copy-number plasmids pUC18 and pUCi9 where the plasmids pNuci (2.5 kb) and the shorter pNuc4 (1.47 kb) expressed nuclease at about the same levei. During this work we transferred a number of these constructions to the lower copy-number vector pAC9 based on the p15 replicon of pACYCi77. In this vector system a dramatic difference is observed between the two nuclease clones. The longer clone (pNud) expressed significantiy more nuclease than the shorter clone {pNuc4) based on halo size on indicator plates. Both couid be further induced by mitomycin C (Fig. 6). This led us to Identify the DNA sequences required for this enhancement of nuclease expression. The DNA downstream of the nuclease gene was first deleted using a convenient Sphl site 180 bases after the stop codon. This had no effect on nuclease expression, showing the upstream region to be critical. A deletion previously made in the laboratory to facilitate DNA sequencing of the nuclease gene, Nuc2Bal31A5, carries about 120 bases upstream of +1, which is about 70 bases more than in Nuc4. This extra DNA restored nuctease expression in pAC9 to the level found with pAC9Nuc1, as shown in Fig. 6. We have not previously published this DNA sequence and it is presented in Fig. 7 along with the nuclease regulatory region for reference. Using the transcriptional fusions to IacZ we show this upstream region acts at the level of transcription in Table 2.
Table 2. Nuclease promoter expression in SM6 and MCl 000,1. (t-Galactosidase Strains
-mitC
+ mitC
SM6 (pNuc2-LacZ) Sfyl6 (pNuc4-LacZ) MClOOO,! (pNuc2 LacZ) MC1000.1 (pNuc4 LacZ)
60 53 38 20
4100 340 250 76
The strains carrying the listed plasmids were grown in LB medium with ampicillin and induced with mitomycin C (mit C) during exponential growth. The cultures were further incubated overnight and p-galactosidase activity was determined.
Upstream Activating Region Rsal Ndel -35 GGCGTCTGTTGGACGCCGnTTTATTTCCGCCGTATTTAACGTGTGGCCTGGCTGTACCATGACTGACACATTCACAACACACATATGTTGCATTGTTGT -+100
101
- mRNA s t a r t S.D. ATTCGTTTCACTGCGATAAGTTTAATTCACTGTAAATATATACAGTATTTTTTAACTTATTGAGGATATGAATATGCGCTTTAACAACAAGATGTTGGCC + +--+ + + + + + + ZOO LexA HetArgPheAsnAsnLysHetLeuAla
Fig. 7. The sequence of Ihe nuclease gene regulatory region is s h o w n . The 55 bases upstream of the R s a l site, required tor maximal gene expression, has not been previously published and there are two corrections of the published sequence (Ball et al.. 1987) which change three residues of the signal peptide. W e are not fully certain of the sequence from positions 1 0 - 2 0 as this region is highly compressed in all sequencing runs. The start of the nuclease m R N A is shown by Ihe arrow and the LexA binding site is underlined. The second Met codon (see text) is shown as the translational start. Assignments for the - 1 0 and - 3 5 regions are made on the basis of position from the m R N A start, and do not represent the closest to consensus sequences.
648
Y.-C. Chen, G. L Shipley, T K. Ball and M. J. Benedik
Nuclease promoter expression in E. coli We had previously observed that the nuclease promoter fails to function in E. coli and that there is no induction by mitomycin C above the basai ievei of nuclease expression found (Ball etai. 1987; 1990) in strain JM101. It has been observed that the S. liquefaciens phospholipase A promoter works only in selected £ coli strains (M. Givskov and S. Molin, personal communication). Based on their suggestion a number of different E coli strains were tested for nuclease expression. Only in MClOOO (and MCI 000.1) was significant nuclease activity observed. The nuclease promoter appeared to be correctly regulated in this strain in that pAC9Nuc1 expresses more nuclease than pAC9Nuc4, and proportionally higher levels of nuolease could be observed from both after mitomycin C induction. This was quantified using pNuc2-LacZ and pNuc4"LacZ and the data is presented in Table 2.
Dlscussion Many extracellular proteins made by S. marcescens are partly co-ordinated in the regulation of their expression. The nuclease. chitinase, and phospholipase are all found at increased levels when bacterial growth slows down. The signals specifying growth-phase regulation have not yet been determined for these proteins. Additionally, chitinase and nuclease are regulated by an SOS-like system. Their expression can be greatly induced by DNA-damaging agents but the phospholipase is not. Chitinase expression is further modulated by the presence or absence of chitin; similarly lipase expression is induced by certain lipid and ester substrates (Winkler and Stuckman, 1979). However, the nuclease does not appear to be substrate regulated as we have only been able to demonstrate growth phase and SOS modes of regulation. In this work we extend our studies of nuclease regulation. The nuclease mRNA is most likely a monocistronic message with an approximate size of 1 kb, slightly larger than the nuclease reading frame of 801 bases. The start point of transcription is 45 bases upstream of the translational start. All the RNA determinations were done after SOS induction of the nuclease promoter. The level of nuclease expression is too low without induction to confirm that uninduced expression utilizes the same promoter, but there is no evidence to suggest otherwise. All the regulatory mutants isolated to date affect both basal and induced levels of nuclease including mutants described in this work and the previously described mutant in recA (Ball et ai, 1990) which completely abolishes all observable nuclease expression by virtue of overproducing LexA repressor and preventing SOS induction. The 100 bases of DNA upstream of the promoter has been shown to be important for higher level transcription
from the nuolease promoter. The pNUC4 clones carry only about 30 nucleotides upstream of the essential promoter region and the Nde\ deletion is immediately upstream of the promoter. These clones still express nuclease and are both growth phase and SOS regulated. Therefore they appear to carry a functional and regulated promoter region. However the inclusion of an additional 55 base pairs upstream increases nuclease expression by about 10-fold. We have not found any change in the overall pattern of regulation by the addition of this region other than an increase in net nuclease transcription. It would be reasonable to postulate that a binding site for a transcriptional activator lies in this upstream region, however there is no direct evidence for this. It remains possible that this DNA region is important for structural reasons, such as for DNA bending or looping. We hope that further characterization of our mutants and analysis of this region will shed light on this. Four transposon-induced regulatory mutants (SU93, SU95, SU132, SU161) which increase nuclease expression were isolated. The simplest explanation for these is that the Tn5 insertions disrupt repressor genes which act to regulate nuclease expression. The mutations fall into two classes based both on phenotype and Southern blotting. This suggests that they define two negative regulatory loci for nuclease expression. Both these classes of mutants have been found by Winkler (1968). The nuclease overexpressing mutants still maintain growth-phase regulation, although the two classes have slightly altered timing relative to each other. The SU93 and SU95 mutants induce at about the same time as wild type while SU132 and SU161 are slightly delayed. This allows us to conclude that these mutants affect different aspects of nuclease expression. They also still respond to SOS induction and are not complemented by the E. coli IexA gene (data not shown). Although the mutants presumably define negative regulators, we cannot determine from our data whether they act directly at an operator of the nuclease promoter or whether they act to modulate another regulatory protein such as an activator. Transcriptional fusions expressing [i-galactosidase from nucP verified that these mutations increase transcription from the nuciease promoter and do not simply affect the externalization of nuclease. The presence of the transposon defining these loci will allow us to isolate and characterize these genes. Out of this mutant hunt four additional regulatory mutants were identified which abolish nuclease expression. These mutants define putative activators of this system. Characterization of these mutants is underway and will be completely described later. However they point out the complexity of this regulatory paradigm. We would suggest that at least one activator is essential for transcription from the nuclease promoter based on the
Regulation of Serratia marcesoens nuclease following observations: (i) the nuclease promoter fails to work in most E. coli strains; (ii) the roie of the DNA sequence upstream of the promoter is most readily explained as an activator-binding site; (iii) regulatory mutants have been identified which totally abolish nuclease expression (verified by transcriptional fusions); (iv) one clone has been identified which transactivates the nuclease promoter in E. coli. It is still premature to conclude whether there is more than one activator of the nuclease promoter or whether its expression is tightly regulated by a number of other regulatory gene products. The number of regulatory loci identified in our mutant hunts and the apparent complexity of nuclease regulation continue to make this an exciting and novel model system for continued study.
Experimental procedures Bacterial strains The S- marcescens strain SM6 was used as our laboratory W\\d type. Strain W1050 is from SM6(F'pro/ac) (obtained from U. Winkier) and carries a chemically induced pleiotropic mutation which overexpresses nuclease as well as other extracellular enzymes (Ball etai. 1990; Winkler, 1968; Winkler and Timmis, 1973). A nuclease mutant SM6nuc/A::Mu-L was previously described as a Mud\{tac,Ap) insertion apparently into the nuclease structural gene (Hines et ai, 1988). Strain TT392 also carries a mutation in the nuclease structural gene (Hines et ai, 1988). It was derived from a non-pigmented nosocomial isolate of S. marcescens strain Sr41 (Takagi et at., 1985), and is a chemically induced mutant which expresses no enzymological or immunologrcally detectable extracellular nuclease. Additionally it carries mutations making it restriction deficient and more sensitive to ampicillin and kanamycin than wild-type S. marcescens. The E. co//strain JM101 was used for most plasmid manipulations (Vieira and Messing, 1982). Strain MClOOO.1 is a spontaneous derivative of strain MClOOO (F" araD139 A(ara-/eu)7679 gatU gatK A{tac)X74 rpsL thij whose growth is no longer inhibited by DNase Test Agar media.
Media and growth conditions Luria-Bertani (LB) medium was used for routine growtfi of both E. coti and S. marcescens. For plasmid maintenance, 100 jjg mP^ ampicillin was used for E. coii and S. marcescens siram TT392 whereas 1 mg ml"' ampicillin was used with SM6 derivatives. Kanamycin was used at 25 ^g ml"' for E. coti or TT392, and 100 |ig ml"' for SM6 strains. E. coli was routinely grown at 37''C and S. marcescens at 30°C. Nuclease indicator medium was DNase Test Agar from Difco or Gibco. Tfiis was supplemented with 80 ^ig ml"' methyl green. For SOS induction mitomycin C (Sigma) was added to a final concentration of 0.1 lag m r ' to cultures in mid log*phase and growth was allowed to continue as described or until the cells entered stationary phase or had grown overnight. Cell density was assayed by measuring absorbance at 600 nm. Cultures greater
649
than A6oo= 1 were diluted 10-fold in LB or phosphate-buffered saline for measurements. Significant cell lysis occurred if dilutions were made with H^O.
Isolation of mutants Mutants of SM6 were generated by transposon mutagenesis using Tn5 as described by Hines et at. (1988). After selecting for transposition events, colonies were picked with sterile toothpicks to DNase Test Agar and mutants identified by halo size.
Plasmids The pUC18/19 vectors were used for routine clonings in this work. The plasmid pAC9 (T. Baldwin, personal communication) was used as a lower copy-number vector. This is a derivative of pACYCI 77 expressing kanamycin resistance but which carries the IacZ a complementation region and multiple cloning sites from pUC9. Plasmids pNuci and pNuc4 were as described by Ball etai (1987), and carry the nuclease gene from SM6. The nuclease gene In pNuci is on a 2.5 kb EcoRI fragment in pUCIB; nuclease is expressed only from its own promoter in S. marcescens and at a low basal level in most E. coti strains. A subclone carrying a 1.4 kb Rsal fragment inserted into the Smal site of pUC18 was used to make pNuc4 and pNuc4-R. These have the same fragment in opposite orientations such that pNuc4 can express nuclease from both the plasmid tae promoter and the nuclease promoter; pNuo4-R expresses nuclease only from its own promoter. About 120 bases remain upstream of the nuclease gene start in these two plasmids. Two different nuclease promoter-/acZ transcriptional fusions (Pnuc-tacZ) were created. The first was made by subcloning an EcoRI to EcoRV fragment from pNuci into pUC18 digested with EcoRI and Smal. This carries the 500 base upstream region which we have shown contains both the nuclease regulatory region and a transcription terminator upstream preventing plasmid promoters from transcribing the nuclease gene (Ball et at.. 1987). The EcoRV site is within the nuclease structural gene. The EcoRI to H/ndlll fragment was isolated from this subclone in pUC18 and inserted into pTrpLac which carries a frp-/ac transcriptional fusion replacing the tetracycline gene of pBR322 and oriented in the same direction. This plasmid is pNuc2-lacZ. Similarly the region downstream of the EcoRV site was deleted from pNuc4 by ligating an EcoRV and HincW digestof the plasmid. This was then subcloned into pTrp-Lac as an EcoRI-AY/ndlll fragment lo create pNuc4-lacZ and carries oniy 120 bp of the upstream region. Transformation of S. marcescens was done essentially as described by Reid etai (1982). In later experiments plasmids were introduced into S. marcescens by electroporation.
Enzyme assays Levels of nuclease production were determined from halo size on DNase Test Agar medium. This indicator medium is especially sensitive and can detect nuciease levels lass than 10"^ of that of uninduced SM6. A microtitre dish assay, which has been previously described by Ball et ai (1990). was used for more quantitative analysis. Three-fold serial dilutions of a culture supernatant or ceii extract were made down the wells of a
650
Y.-C. Chen, G. L. Shipley, T. K. Ball and M. J. Benedik
column of a microtitre dish containing DNA and ethidium bromide. Dilutions of multiple samples were made concurrently using a 12-tip multichannel pipettor. Nuclease activities are presented as the dilution factor required to show no loss of fluorescence for a certain incubation period. All samples for any single experiment were measured together in a single dish. However nuclease levels between different experiments cannot be directly compared because the dishes might not have been incubated for the same time. p-Galactosidase levels from the /acZfusions were assayed by the method of Miller (1972).
DNA polymerase according to the procedure of Kunkei et ai (1987) and recovered into by transformation of JM101. Mutations were verified by dideoxy sequencing. The following oligonucieotides, with the mutations underlined, were used for mutagenesis: Met-1" 5'-GAG-GAT-ATC-AAT-ATG-CGC-3'; Met-2" 5'-GAT-ATG-AAT-AT£-CGC-TTT-3'; LexA mutant 5'CTGTAAATATATAC20GTATT-3V The mutant genes were then subcioned from M13 into the appropriate plasmid iisted in the text.
Acknowledgements RNA isolation and mapping A modified hot-phenol extraction was used to prepare RNA from S. marcescens because of the active nuclease produced. RNA was isolated from early stationary phase cells of SM6 that had been induced with 0.1 |j,g ml"' of mitomycin C at Agoo = 0.5-0.7 and grown for an additionai 3 h until the culture reached A60f, = 3. From this, 4 ml was removed and added to a 15 ml Corex tube containing 1 ml cell lysis buffer (0.5 M NaOAc pH 5.0, 5% sodium dodecyl sulphate, 250 mM ethylenediamine tetracetic acid) which had been prewarmed to 95°C. The tube was mixed rapidly and incubated for 5 min at 95"C. The hot Iysate was poured into a flask containing 5 ml of buffer-saturated phenol prewarmed to 68''C and mixed vigorously for 5 min at 68°C in a shaker bath. The hot emulsion was poured into a precooled 15 ml centrifuge tube and chilled in an ice bath for 5 min ihen centrifuged at 8000 x g for 10 min at 2'-'C. The aqueous phase was removed into a fresh centrifuge tube and extracted again with an equal volume of buffer-saturated phenol. After centrifugation the aqueous phase was extracted with a phenol:chloroform mixture (50% phenol, 48% chloroform and 2% isoamyl alcohol). After vigorous mixing and centrifugation, the aqueous layer was removed to a fresh tube to which 0.25 volumes of 10M LiC! (finai concentration 2M) was added, mixed well and left at 4"C overnight to precipitate the RNA. The pellet was collected by centrifugation at 8000 x gfor 10 min at 2''C and washed with 2 M LiCI, The RNA was pelleted again from the wash. The RNA pellet was dissolved in 2 mi iH2O and ethanol precipitated after the addition of NaOAc (pH 5.2) to 0.3 M followed by a 70% ethanol wash. The finai RNA peiiet was resuspended in H^O for use. Northern blots were prepared using formaldefiyde RNA gels and blotted to an Immobilon N membrane (Millipore) according to the procedure of Fourney et ai. (1988). The probe, labelled in a random priming reaction, was the purified 450 bp Sty\EcoRV restriction fragment which spans from the signal sequence to the middle of the nuciease gene. Ribosomal RNA from Physarum polycephalum was loaded in adjacent lanes for size markers. Primer extension analysis was performed using reverse transcriptase with the primer 5'-CTGCGCGGCGAACAGCAG3' which extends from bases 156 to 173 of the published sequence. This primer lies within the signal sequence and primes DNA synthesis back towards the promoter region.
Site-directed mutagenesis Template DNA from the nuclease gene cloned into M13mp19 was prepared in the dut ung strain CJ236, elongated using T4
This work was supported by grant GM36891 from the National Institutes of Health and a Texas Advanced Research Program award #36521178.
References Ball, T.K., Saurugger. P.N., and Benedik, M.J. (1987) The extracellular nuclease gene of Serratia marcescens and its secretion from Escherichia coti Gene 57: 183-192. Ball. T.K., Wasmuth, C.R., Braunagei. S.C, and Benedik, M.J. (1990) Expression of Serratia marcescens extracellular proteins requires recA. J Bacteriot 172: 342-349. Bromke. B.J., and Hammel, J.M. (1979) Regulation of extracellular protease formation by Serratia marcescens. Can J Microbiol25: 47-52. Eaves, G.N., and Jeffries. C D . (1963) isoiation and properties of an exoceilular nuclease of Serratia marcescens. J Bacteriot 85: 273-27Q. Fourney, R.M., Miyakoshi, J., Day Ml, R.S., and Patterson, M.C (1988) Northern biotting: efficient RNA staining and transfer. Focus 10: 5-7. Givskov, M.. Olsen, L., and Mclin, S. (1988) Cioning and expression in Escherichia coli of the gene for extracellular phospholipase A l from Serratia tiquefaciens. J Bacterioi 170:5855-5862. Hines, D.W,. Saurugger, P.N., Ihler, G.M., and Benedik, M.J. (1988) Genetic analysis of extracellular proteins of Serratia marcescens. J Bacteriot 170: 4141-4146. Jones, J.D., Grady, K.L., Suslow, T.V., and Bedbrook. J.R. (1986) isolation and characterization of genes encoding two chitinase enzymes from Serratia marcescens. EMBO J 5: 467-^73. Kunkei. T., Roberts, J.. and Zakour, R. (1987) Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods Enzymol 15^*: 367-382. Miller. J.H. (1972) Experiments in Molecular Genetics. Cold Spring Harbor. New York: Cold Spring Harbor Laboratory Press. Monrea!. J.. and Reese. E.T. (1969) The chitinase of Serratia marcescens. Can J Microbiol IS: 689-696. Reid, J.D., Stoufer. S.D.. and Ogrydziak, D.M. (1982) Efficient transformation of Serratia marcescens with pBR322 plasmid DNA. Gene17:107-112. Takagi, T,, and Kisumi, M. (1985) Isolation of a versatile Serratia marcescens mutant as a host and molecular cloning of theaspartase gene. J Bacterioi 161:1-6. Vieira, J.. and Messing, J. (1982) The pUC plasmids, and M13mp7 derived system for insertion mulagenesis and sequencing with synthetic universal primers. Gene 19: 259-268.
Regulation of Serratia marcescens nuclease Winkler, U. (1968) Mutants of Serrate marcescens defective or superactive in the release of a nuclease. In Motecutar Genetics. Wittman, H.G., and Schuster, H. (eds). Berlin-Heideiberg: Springer, pp, 187-201. Winkler. U., and Stuckman, M. (1979) Glycogen, hyaiuronate, and some other polysaccharides greatly enhance the formation of exolipase by Serratia marcescens. J Bacteriot 138: 663-670.
651
Winkter, U., and Timmis, K. (1973) Pteiotropic mutations in Serratia marcescens which increase the synthesis of certain exoceilular proteins and the rate of spontaneous prophage excision. MolGen Genef\24:197-206. Zink, R.T., Engwall. J.K.. McEvoy, J.L., and Chatterjee, A.K. (1985) RecA is required in the induction of pectin lyase and carotovoricin in Erwinia carotovora subsp. carotovora. J Sacter/o/164: 390-396.
Regulatory mutants and transcriptional control of the Serratia marcascens extracellular nuclease gene Yi-Chi Chen,' Gregory L. Shipley,^'Timothy K. Ball^ and Michael J. Benedik^* 'Department of Biochemical and Biophysical Sciences, University of Houston, Houston, Texas 77204-5934, USA. ^Department of fi/iicrobiology and Motecutar Genetics, University oi Texas Health Science Center at Houston, Houston. Texas 77030, USA. ^fvlonsanto Co.. 700 Chesterfield Village Parkway, St Louis. Missouri 63198, USA. Summary The extracellular nuclease of Serratia marcesoens is regulated in a complex fashion. Unlike most cataboHc enzymes, it appears not to be substrate regulated. However we have shown it to be regulated by an SOSlike system in S. marcescens. Additionally nuciease expression is regulated In a growth-phase-dependent manner. In this work we demonstrate that growthphase-dependent regulation is at the transcriptional level. The putative LexA-binding site which mediates SOS regulation is shown to act as an operator site in viva. The boundaries of a minimal promoter, stilt regulated by growth phase and SOS regulation, are defined along with the transcriptional start site. However, a region upstream of the nuclease promoter is shown to enhance significantly the expression of nuclease.
Introduction Degradative enzymes are usually regulated in microbial systems. This regulation most often takes the form of substrate regulation where expression of the enzyme is induced by the presence of substrate in the cell or in the media. The enteric bacterium Serratia marcescens produces a number of extracellular enzymes, most of which are regulated in this fashion. Its extracellular proteases are regulated by the presence of protein or leucine in the media (Bromke and Hammel, 1979), chitinase is induced by the presence of chitin (Monreal and Reese, 1969;
Received 19 September, 1991; revised 14 November, 1991; accepted 18 November, 1991. 'For correspondence. Tei. (713) 743 8377; Fax (713) 743 8351.
Jones et ai, 1986), and a lipase is induced by its substrates (Winkler and Stuckman, 1979). However the extracellular nuclease, an extremely potent non-specific nuclease (Eaves and Jeffries. 1963), is apparently not regulated in this fashion. Until recently no known regulation of nuclease expression had been demonstrated; neither the addition of nucleic acids nor nucleotides regulate its expression nor is catabolite regulation, mediated by the presence or absence of glucose, observed. Despite this apparent lack of regulation, mutants have been described which increase nuclease and other extracellular enzyme expression; these, paradoxically, can only be assumed to be regulatory mutants (Winkler, 1968; Winkler and Timmis, 1973). We have recently shown that nuclease expression is regulated by an SOS-like system in S. marcescens (Ball et ai. 1990). Mutations in recA abolish nuclease expression and agents which induce the SOS system in E. coli, such as u.v. damage and mitomycin C. induce expression of nuclease to a high level. Using gene fusions this regulation was shown to occur at the transcriptional level. The 120 bases of DNA upstream from the nuclease reading frame was sufficient to allow SOSregulated nuclease expression; presumably from its normal promoter. From the DNA sequence (Ball et ai, 1987) a consensus LexA-binding site could be found just upstream of the nuclease gene. SOS regulation of extracellular protein expression is not unique to nuclease or to S. marcescens. Chitinase expression can be greatly induced by SOS induction independent of the presence or absence of chitin. The general lipase also appears to be SOS induced in S. marcescens (Ball etai, 1990), although, unlike nuclease, its expression is not abolished by a recA mutant, suggesting it is not directly repressed by LexA. The proteases and an extracellular phospholipase A are not SOS regulated (Givskov etai. 1988; S. C. Braunagei and M. J. Benedik, personal communication; M. Givskov and S. Molin, personal communication). In Erwinia carotovora the extracellular pectin lyase and carotovoricin are similarly SOS regulated (Zink etai. 1985). In this work we further characterize the expression of the extracellular nuclease. It is shown to be growth-phase regulated at the transcriptional level independent of SOS induction. The transcription start is defined and important regulatory mutants are described.
644
Y.-C. Chen, G. L Shipley. T. K. Ball and M. J. Benedik
Table 1, Nuclease promoter expression in SU mutants. Nuclease
p-Galactosidase
Strains
-mitC
+ mitC
-mitC
+ mitC
SM6 SU93 SU95 SU132 SU161
9 400 400 80 80
700 700 700 1000 1000
81 430 550 350 270
1200 1100 1100 1500 1500
The strains listed carrying the plasmid pNuc2-LacZ were grown in LB medium and a half ot each divided culture was induced wilh mitomycin C during exponential growth. The cultures were further incubated overnight and nuclease measured from Ilie culture supernatants by the micfotitre dish assay. The values listed represent the dilution factor required to show no loss of fluorescence. p-Galactosidase was assayed from the total culture.
Results Isoiation of nuclease regulatory mutants After mutagenesis by the transposon Tn5, colonies were screened for changes in their nuclease halo size. A number of mutants were found that were reduced or off for nuclease expression; these will be fully described elsewhere. Of interest here are four mutants that overexpressed nuclease. Based on halo size, two mutants, SM6-SU93 and SM6-SU95, expressed significantly more nuclease than the parent SM6; the other two mutants. SM6-SU132 and SM6-SU161, were similar and they expressed intermediate levels of nuclease. These two phenotypes are similar to the Nuc(SU) phenotypes described by Winkler (1968) and Winkler and Timmis (1973). The levels of nuclease expression and of p-galactosidase expression from a nucP-lacZ fusion of these four mutants are shown in Table 1. It is clear that promoter expression, as measured from the fusion, correlates with observed extracellular nuclease levels. Because these mutations were caused by Tn5 insertions they are gene inactivation mutations whereas the previously described mutants were chemically induced and may have been missense mutations. This allows us to conclude that the increase in nuclease expression is most likely caused by loss of a repressor rather than a promoter up-mutant or a change of function mutant in a regulatory protein. The presence of the transposon allowed the use of Tn5 as a probe on Southern blots to identify whether these mutations appeared allelic. Genomic DNA was digested with EcoRI. which does not cleave in Tn5. from the four mutants and wild-type SM6 and Southern blots were prepared (data not shown). Mutants SM6-SU93 and SM6SU95 both showed a fragment with similar mobility {>25kb) as did the pair SM6-SU132 and SM6-SU161 (20 kb). No Tn5 band was seen in SM6. This suggests that each pair of mutants with the same phenotype carry
an insertion in the same restriction fragment; thus, the mutants with the same phenotype are probably allelic. The two different phenotypes map to different restriction fragments and probably represent two different genes in which insertion mutations increase expression of nuclease. Furthermore, a 450 bp fragment of the nuclease gene itself was then used to probe the same filters, none of the mutations were in the restriction fragment carrying the nuclease gene (data not shown). Growth-phase regulation of nuclease To probe whether the appearance of extracellular nuclease was growth-phase regulated, cultures of S. marcescens were sampled during growth beginning in exponential phase and continuing to stationary phase. In Fig. 1 we have plotted the appearance of extracellular nuclease from strain SM6, with or without mitomycin C induction, as a function of culture density as well as from one of the overexpressing mutants. SM6-SU93. which does not require induction for high-level expression. The appearance of extracellular nuclease coincides with the transition of the culture from exponential to stationary phase in both strains at about the same culture density (Aeoo>2.5}. We can rule out an indirect effect of mitomycin C because the super-expressing strain shows similar kinetics. 300
250 -
200 -
150 -
100 -
2
4
6
8
ID
12
14
16
IS
20
Time (hours) Rg. 1. Cells from a fresh overnight culture were diluted back and grown until the cultures reached a measurable density. At this time {T=0) mitomycin C was added. At the time intervals shown samples were collected and the optical density (Aeoo) * a s measured and plotted as a function of time shown by the dashed lines and open symbols ( n , SM6; O, SM6 + mitC; A . SU93). Nuclease activity was measured from each culture supernatant by the microtitre dish assay and is shown by the solid lines and the same filled symbols. The volume of supernatant used in the assay was adjusted to a constant ce)l optical density. The mitomycin Cinduced culture began showing visible lysis by 8 fi and no further time points were taken from it.
Regulation of Serratia marcescens nuclease
645
C to identical nucP-/acZ bearing cultures at 1-h intervals, thereby inducing them at different cell densities, if mitomycin C addition initiates nuclease induction, the three cultures should show p-galactosidase induction at different cell densities. If growth-phase regulation is independent of the time of drug addition, then all cuitures should show an increase in nuclease expression at the same cell density, independent of the time of mitomycin C addition. The growth curves from these cultures are shown in Fig. 3A. The appearance of (i-galactosidase is plotted in Fig. 3B where we show it appeared at the same culture density (c. A6oo=1 -5). independent of the time of induction.
8
10 12 14 16
20 22 24
rime (hours) Fig. 2. Same as Fig. 1 except intracellular p-galactosidase was measured in place ol nuclease.
To investigate whether the growth-phase-regulated appearance of nuclease was at the level of expression, activation or excretion, a n[JcP-/acZ transcriptiona! fusion was used to monitor expression from that promoter. Using pNuc2-LacZ similar growth curves were performed and (i-galactosidase activity monitored. Figure 2 shows that the appearance of p-galactosidase is also growthphase regulated and closely resembles the appearance of nuclease in Fig. 1. This demonstrates that the growthphase-regulated appearance of nuclease is due to transcriptional regulation of its promoter. To provide additional confirmation that the apparent growth-phase regulation is not an indirect delayed response to mitomycin C induction, we added mitomycin 3.5
3.0 -
Using the pNuc2-LacZ transcriptional fusion plasmid we asked whether the nuclease overexpressing mutants still demonstrated growth-phase regulation of the nuclease promoter. In Fig. 4 we show that all four overexpressing mutants of strain SM6 still showed growth-phase-regulated transcription from the nuclease promoter, although the SU132 and SU161 mutant pair show a slightly later induction of p-galactosidase expression than the other two mutants and wild type.
Characterizing the nuclease transcript Total RNA was isolated from a mitomycin C-induced culture of SM6. This RNA was used for primer extension with an oligonucleotide that lies just inside the amino terminus of the nuciease open reading frame. The same primer was used to prime DNA synthesis for dideoxy sequencing on a single-strand M13 template carrying the nuclease gene. The length of the extended fragment corresponded to the A (TTC&CTGT) at position 75 on the gene sequence (Ball etai, 1987; see also Fig. 7). This position 120
100 -
1.0 0.5
0.0
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
Cell Density (O.D.) Fig. 3. An exponentially growing culture of SM6 was diluted into two flasks each at an optical density of Aeoo=0.05(*), 0,1 (•) and 0.2(A) and mitomycin C added after 1 h to 1 flask of each dilution. The growth curve of the cultures is shown in panel A. Samples were removed to assay p-gaiactosidase which is plotted in pane! B as a function of cell density.
646
Y.-C. Chen. G. L Shipley. T. K. Ball and ful. J. Benedik
0.5 1.0 1.5 2.0 2.5 5.0 5.5 4.0 4.5 5.0 5.5 6,0 Cell density (O.D.)
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0 5.5 6.0 Cell density (O.D.)
Fig. 4. Exponentially growing cultures of the overexpressing mutants were split and 1 sample of each induced with mitomycin C, At time intervals samples were removed and assayed for p galactosidase wFiicfi is ploned as a function of cell density { • , SM6-SU93; • , SM6-SU95; A , SM6-SU132; T , SM6SUi 61). Panel A shows the curve for uninduced cultures while panel B shows the curve for mitomycin C-induced cultures.
is 45 bases upstream of the gene start (data not shown). The length of the nuclease message was determined from a Northern blot shown in Fig. 5 where an internal nuclease gene probe was used to identify the nuclease mRNA. The band representing the nuclease transcript is a single band of about 1 kb in length. The 266 amino acids of the nuclease pro-protein corresponds to a gene 798 bases in length, which suggests that the nuclease message is monocistronic; there is no significant open reading frame after that of nuclease. Mapping elements in the nuclease regulatory region Previously we showed that a regulated promoter sufficient for nuclease expression lay in the 120 bases upstream of the nuclease gene after the Rsa\ restriction site (see Fig. 7). Thirty bases downstream of the Rsa\ site is a Nde\ site. A deletion was made in pNuc4-R by digestion with Nde\ followed by ligation and recircularizatlon of the plasmid. This removes the upstream 30 bases and about 250 bases of lacZ DNA from the pUCi8 vector. This plasmid was introduced into TT392 and nuclease activity was monitored with or without mitomycin C induction and compared with the parent plasmid. pNuc4-R. There was no difference in nuclease expression between the two plasmids when compared by halo size on indicator plates {uninduced) or by microtitre dish assay of induced and uninduced cultures (not shown). This 80 bp region from the Nde\ to the gene start defines a minimal promoter region. To verify that the LexA box noted previously (Ball etai, 1990) actually serves as an operator site regulating
nuclease expression, a mutation was made which abolishes an important consensus element of a LexA-binding site. The consensus site CTG(N}ioCAG was changed to CTG{N},oGGG by site-directed mutagenesis in Nuci using the LexA mutant primer listed. The wild type and the putative O'^ mutant allele were subcioned into pAC9 and nuclease activity monitored. From indicator media it was clear that the mutant greatly overexpressed nuclease. Assay results from wild-type pAC9-Nuc1 showed an induction by mitomycin C of nuclease expression from 27 to 2100. The pAC9-Nuc1-O'^ expressed an equivalent activity of 2100 and was not further induced by mitomycin C. However this plasmid causes both S. marcescens and Escherichia coli cells to grow significantly slower than
2.gkb. 2.1kb1.4kbnuclease -
Fig. 5. A northem blot of RNA prepared from uninduced (-) and mitomycin C induced SM6 (+) and probed with a probe entirely internal to the nuclease open reading frame is shown with size standards.
Regulation of Serratia marcescens nuclease 300
647
Upstream activating sequence
160
pNud
pNuc4
pNud- ASph Plaamld
Fig. 6. Nuclease was measured from supernatants of strain TTF carrying the designated plasmid and is expressed as relative dilution factor. Plasmid pNuci carries 600 bases upstream and 1000 bases downstream of the nuclease gene. The pNuc4 plasmid carries only 120 bases upstream and 500 downstream. The downstream region is deleted in pNuci-ASph. Plasmid pNuc1-Bal31A5 has only the 180 bases upstream of the nuclease gene,
with the wild-type plasmid and is very prone to mutation or rearrangement. There were two potential Met start codons noted in the sequence (Ball ef ai. 1987), the second of which was assumed to be the correct start owing to its proper placement after a good consensus ribosome-binding-site sequence. This was verified by site-directed mutagenesis where either the first (Meti") or the second (Met2~) Met codon was changed in pNuc4. When expressed either from the lac promoter in pUCI 8 or only from its own promoter in pUC19 after mitomycin C induction in S. marcescens strain TT392, it was found that less than 10% of wiid-type nuclease activity was detected from the Met2' mutant while essentially normal ieveis were found from the Met1~ mutant. The double Met1~Met2^ mutant made no detectable nuclease. The mutations were then subcioned into a lower copy-number derivative pAC9 Nuc1 where Meti" produced nuclease activities identical to the wild-type control pAC9Nuc1 while Met2~ produced less than 1% of wild-type levels. This suggests that although both Met codons can be used in vivo, the second Met codon is the predominant start codon.
Our previous work on nuclease expression (Ball ef ai, 1987; 1990) was done using the high copy-number plasmids pUC18 and pUCi9 where the plasmids pNuci (2.5 kb) and the shorter pNuc4 (1.47 kb) expressed nuclease at about the same levei. During this work we transferred a number of these constructions to the lower copy-number vector pAC9 based on the p15 replicon of pACYCi77. In this vector system a dramatic difference is observed between the two nuclease clones. The longer clone (pNud) expressed significantiy more nuclease than the shorter clone {pNuc4) based on halo size on indicator plates. Both couid be further induced by mitomycin C (Fig. 6). This led us to Identify the DNA sequences required for this enhancement of nuclease expression. The DNA downstream of the nuclease gene was first deleted using a convenient Sphl site 180 bases after the stop codon. This had no effect on nuclease expression, showing the upstream region to be critical. A deletion previously made in the laboratory to facilitate DNA sequencing of the nuclease gene, Nuc2Bal31A5, carries about 120 bases upstream of +1, which is about 70 bases more than in Nuc4. This extra DNA restored nuctease expression in pAC9 to the level found with pAC9Nuc1, as shown in Fig. 6. We have not previously published this DNA sequence and it is presented in Fig. 7 along with the nuclease regulatory region for reference. Using the transcriptional fusions to IacZ we show this upstream region acts at the level of transcription in Table 2.
Table 2. Nuclease promoter expression in SM6 and MCl 000,1. (t-Galactosidase Strains
-mitC
+ mitC
SM6 (pNuc2-LacZ) Sfyl6 (pNuc4-LacZ) MClOOO,! (pNuc2 LacZ) MC1000.1 (pNuc4 LacZ)
60 53 38 20
4100 340 250 76
The strains carrying the listed plasmids were grown in LB medium with ampicillin and induced with mitomycin C (mit C) during exponential growth. The cultures were further incubated overnight and p-galactosidase activity was determined.
Upstream Activating Region Rsal Ndel -35 GGCGTCTGTTGGACGCCGnTTTATTTCCGCCGTATTTAACGTGTGGCCTGGCTGTACCATGACTGACACATTCACAACACACATATGTTGCATTGTTGT -+100
101
- mRNA s t a r t S.D. ATTCGTTTCACTGCGATAAGTTTAATTCACTGTAAATATATACAGTATTTTTTAACTTATTGAGGATATGAATATGCGCTTTAACAACAAGATGTTGGCC + +--+ + + + + + + ZOO LexA HetArgPheAsnAsnLysHetLeuAla
Fig. 7. The sequence of Ihe nuclease gene regulatory region is s h o w n . The 55 bases upstream of the R s a l site, required tor maximal gene expression, has not been previously published and there are two corrections of the published sequence (Ball et al.. 1987) which change three residues of the signal peptide. W e are not fully certain of the sequence from positions 1 0 - 2 0 as this region is highly compressed in all sequencing runs. The start of the nuclease m R N A is shown by Ihe arrow and the LexA binding site is underlined. The second Met codon (see text) is shown as the translational start. Assignments for the - 1 0 and - 3 5 regions are made on the basis of position from the m R N A start, and do not represent the closest to consensus sequences.
648
Y.-C. Chen, G. L Shipley, T K. Ball and M. J. Benedik
Nuclease promoter expression in E. coli We had previously observed that the nuclease promoter fails to function in E. coli and that there is no induction by mitomycin C above the basai ievei of nuclease expression found (Ball etai. 1987; 1990) in strain JM101. It has been observed that the S. liquefaciens phospholipase A promoter works only in selected £ coli strains (M. Givskov and S. Molin, personal communication). Based on their suggestion a number of different E coli strains were tested for nuclease expression. Only in MClOOO (and MCI 000.1) was significant nuclease activity observed. The nuclease promoter appeared to be correctly regulated in this strain in that pAC9Nuc1 expresses more nuclease than pAC9Nuc4, and proportionally higher levels of nuolease could be observed from both after mitomycin C induction. This was quantified using pNuc2-LacZ and pNuc4"LacZ and the data is presented in Table 2.
Dlscussion Many extracellular proteins made by S. marcescens are partly co-ordinated in the regulation of their expression. The nuclease. chitinase, and phospholipase are all found at increased levels when bacterial growth slows down. The signals specifying growth-phase regulation have not yet been determined for these proteins. Additionally, chitinase and nuclease are regulated by an SOS-like system. Their expression can be greatly induced by DNA-damaging agents but the phospholipase is not. Chitinase expression is further modulated by the presence or absence of chitin; similarly lipase expression is induced by certain lipid and ester substrates (Winkler and Stuckman, 1979). However, the nuclease does not appear to be substrate regulated as we have only been able to demonstrate growth phase and SOS modes of regulation. In this work we extend our studies of nuclease regulation. The nuclease mRNA is most likely a monocistronic message with an approximate size of 1 kb, slightly larger than the nuclease reading frame of 801 bases. The start point of transcription is 45 bases upstream of the translational start. All the RNA determinations were done after SOS induction of the nuclease promoter. The level of nuclease expression is too low without induction to confirm that uninduced expression utilizes the same promoter, but there is no evidence to suggest otherwise. All the regulatory mutants isolated to date affect both basal and induced levels of nuclease including mutants described in this work and the previously described mutant in recA (Ball et ai, 1990) which completely abolishes all observable nuclease expression by virtue of overproducing LexA repressor and preventing SOS induction. The 100 bases of DNA upstream of the promoter has been shown to be important for higher level transcription
from the nuolease promoter. The pNUC4 clones carry only about 30 nucleotides upstream of the essential promoter region and the Nde\ deletion is immediately upstream of the promoter. These clones still express nuclease and are both growth phase and SOS regulated. Therefore they appear to carry a functional and regulated promoter region. However the inclusion of an additional 55 base pairs upstream increases nuclease expression by about 10-fold. We have not found any change in the overall pattern of regulation by the addition of this region other than an increase in net nuclease transcription. It would be reasonable to postulate that a binding site for a transcriptional activator lies in this upstream region, however there is no direct evidence for this. It remains possible that this DNA region is important for structural reasons, such as for DNA bending or looping. We hope that further characterization of our mutants and analysis of this region will shed light on this. Four transposon-induced regulatory mutants (SU93, SU95, SU132, SU161) which increase nuclease expression were isolated. The simplest explanation for these is that the Tn5 insertions disrupt repressor genes which act to regulate nuclease expression. The mutations fall into two classes based both on phenotype and Southern blotting. This suggests that they define two negative regulatory loci for nuclease expression. Both these classes of mutants have been found by Winkler (1968). The nuclease overexpressing mutants still maintain growth-phase regulation, although the two classes have slightly altered timing relative to each other. The SU93 and SU95 mutants induce at about the same time as wild type while SU132 and SU161 are slightly delayed. This allows us to conclude that these mutants affect different aspects of nuclease expression. They also still respond to SOS induction and are not complemented by the E. coli IexA gene (data not shown). Although the mutants presumably define negative regulators, we cannot determine from our data whether they act directly at an operator of the nuclease promoter or whether they act to modulate another regulatory protein such as an activator. Transcriptional fusions expressing [i-galactosidase from nucP verified that these mutations increase transcription from the nuciease promoter and do not simply affect the externalization of nuclease. The presence of the transposon defining these loci will allow us to isolate and characterize these genes. Out of this mutant hunt four additional regulatory mutants were identified which abolish nuclease expression. These mutants define putative activators of this system. Characterization of these mutants is underway and will be completely described later. However they point out the complexity of this regulatory paradigm. We would suggest that at least one activator is essential for transcription from the nuclease promoter based on the
Regulation of Serratia marcesoens nuclease following observations: (i) the nuclease promoter fails to work in most E. coli strains; (ii) the roie of the DNA sequence upstream of the promoter is most readily explained as an activator-binding site; (iii) regulatory mutants have been identified which totally abolish nuclease expression (verified by transcriptional fusions); (iv) one clone has been identified which transactivates the nuclease promoter in E. coli. It is still premature to conclude whether there is more than one activator of the nuclease promoter or whether its expression is tightly regulated by a number of other regulatory gene products. The number of regulatory loci identified in our mutant hunts and the apparent complexity of nuclease regulation continue to make this an exciting and novel model system for continued study.
Experimental procedures Bacterial strains The S- marcescens strain SM6 was used as our laboratory W\\d type. Strain W1050 is from SM6(F'pro/ac) (obtained from U. Winkier) and carries a chemically induced pleiotropic mutation which overexpresses nuclease as well as other extracellular enzymes (Ball etai. 1990; Winkler, 1968; Winkler and Timmis, 1973). A nuclease mutant SM6nuc/A::Mu-L was previously described as a Mud\{tac,Ap) insertion apparently into the nuclease structural gene (Hines et ai, 1988). Strain TT392 also carries a mutation in the nuclease structural gene (Hines et ai, 1988). It was derived from a non-pigmented nosocomial isolate of S. marcescens strain Sr41 (Takagi et at., 1985), and is a chemically induced mutant which expresses no enzymological or immunologrcally detectable extracellular nuclease. Additionally it carries mutations making it restriction deficient and more sensitive to ampicillin and kanamycin than wild-type S. marcescens. The E. co//strain JM101 was used for most plasmid manipulations (Vieira and Messing, 1982). Strain MClOOO.1 is a spontaneous derivative of strain MClOOO (F" araD139 A(ara-/eu)7679 gatU gatK A{tac)X74 rpsL thij whose growth is no longer inhibited by DNase Test Agar media.
Media and growth conditions Luria-Bertani (LB) medium was used for routine growtfi of both E. coti and S. marcescens. For plasmid maintenance, 100 jjg mP^ ampicillin was used for E. coii and S. marcescens siram TT392 whereas 1 mg ml"' ampicillin was used with SM6 derivatives. Kanamycin was used at 25 ^g ml"' for E. coti or TT392, and 100 |ig ml"' for SM6 strains. E. coli was routinely grown at 37''C and S. marcescens at 30°C. Nuclease indicator medium was DNase Test Agar from Difco or Gibco. Tfiis was supplemented with 80 ^ig ml"' methyl green. For SOS induction mitomycin C (Sigma) was added to a final concentration of 0.1 lag m r ' to cultures in mid log*phase and growth was allowed to continue as described or until the cells entered stationary phase or had grown overnight. Cell density was assayed by measuring absorbance at 600 nm. Cultures greater
649
than A6oo= 1 were diluted 10-fold in LB or phosphate-buffered saline for measurements. Significant cell lysis occurred if dilutions were made with H^O.
Isolation of mutants Mutants of SM6 were generated by transposon mutagenesis using Tn5 as described by Hines et at. (1988). After selecting for transposition events, colonies were picked with sterile toothpicks to DNase Test Agar and mutants identified by halo size.
Plasmids The pUC18/19 vectors were used for routine clonings in this work. The plasmid pAC9 (T. Baldwin, personal communication) was used as a lower copy-number vector. This is a derivative of pACYCI 77 expressing kanamycin resistance but which carries the IacZ a complementation region and multiple cloning sites from pUC9. Plasmids pNuci and pNuc4 were as described by Ball etai (1987), and carry the nuclease gene from SM6. The nuclease gene In pNuci is on a 2.5 kb EcoRI fragment in pUCIB; nuclease is expressed only from its own promoter in S. marcescens and at a low basal level in most E. coti strains. A subclone carrying a 1.4 kb Rsal fragment inserted into the Smal site of pUC18 was used to make pNuc4 and pNuc4-R. These have the same fragment in opposite orientations such that pNuc4 can express nuclease from both the plasmid tae promoter and the nuclease promoter; pNuo4-R expresses nuclease only from its own promoter. About 120 bases remain upstream of the nuclease gene start in these two plasmids. Two different nuclease promoter-/acZ transcriptional fusions (Pnuc-tacZ) were created. The first was made by subcloning an EcoRI to EcoRV fragment from pNuci into pUC18 digested with EcoRI and Smal. This carries the 500 base upstream region which we have shown contains both the nuclease regulatory region and a transcription terminator upstream preventing plasmid promoters from transcribing the nuclease gene (Ball et at.. 1987). The EcoRV site is within the nuclease structural gene. The EcoRI to H/ndlll fragment was isolated from this subclone in pUC18 and inserted into pTrpLac which carries a frp-/ac transcriptional fusion replacing the tetracycline gene of pBR322 and oriented in the same direction. This plasmid is pNuc2-lacZ. Similarly the region downstream of the EcoRV site was deleted from pNuc4 by ligating an EcoRV and HincW digestof the plasmid. This was then subcloned into pTrp-Lac as an EcoRI-AY/ndlll fragment lo create pNuc4-lacZ and carries oniy 120 bp of the upstream region. Transformation of S. marcescens was done essentially as described by Reid etai (1982). In later experiments plasmids were introduced into S. marcescens by electroporation.
Enzyme assays Levels of nuclease production were determined from halo size on DNase Test Agar medium. This indicator medium is especially sensitive and can detect nuciease levels lass than 10"^ of that of uninduced SM6. A microtitre dish assay, which has been previously described by Ball et ai (1990). was used for more quantitative analysis. Three-fold serial dilutions of a culture supernatant or ceii extract were made down the wells of a
650
Y.-C. Chen, G. L. Shipley, T. K. Ball and M. J. Benedik
column of a microtitre dish containing DNA and ethidium bromide. Dilutions of multiple samples were made concurrently using a 12-tip multichannel pipettor. Nuclease activities are presented as the dilution factor required to show no loss of fluorescence for a certain incubation period. All samples for any single experiment were measured together in a single dish. However nuclease levels between different experiments cannot be directly compared because the dishes might not have been incubated for the same time. p-Galactosidase levels from the /acZfusions were assayed by the method of Miller (1972).
DNA polymerase according to the procedure of Kunkei et ai (1987) and recovered into by transformation of JM101. Mutations were verified by dideoxy sequencing. The following oligonucieotides, with the mutations underlined, were used for mutagenesis: Met-1" 5'-GAG-GAT-ATC-AAT-ATG-CGC-3'; Met-2" 5'-GAT-ATG-AAT-AT£-CGC-TTT-3'; LexA mutant 5'CTGTAAATATATAC20GTATT-3V The mutant genes were then subcioned from M13 into the appropriate plasmid iisted in the text.
Acknowledgements RNA isolation and mapping A modified hot-phenol extraction was used to prepare RNA from S. marcescens because of the active nuclease produced. RNA was isolated from early stationary phase cells of SM6 that had been induced with 0.1 |j,g ml"' of mitomycin C at Agoo = 0.5-0.7 and grown for an additionai 3 h until the culture reached A60f, = 3. From this, 4 ml was removed and added to a 15 ml Corex tube containing 1 ml cell lysis buffer (0.5 M NaOAc pH 5.0, 5% sodium dodecyl sulphate, 250 mM ethylenediamine tetracetic acid) which had been prewarmed to 95°C. The tube was mixed rapidly and incubated for 5 min at 95"C. The hot Iysate was poured into a flask containing 5 ml of buffer-saturated phenol prewarmed to 68''C and mixed vigorously for 5 min at 68°C in a shaker bath. The hot emulsion was poured into a precooled 15 ml centrifuge tube and chilled in an ice bath for 5 min ihen centrifuged at 8000 x g for 10 min at 2'-'C. The aqueous phase was removed into a fresh centrifuge tube and extracted again with an equal volume of buffer-saturated phenol. After centrifugation the aqueous phase was extracted with a phenol:chloroform mixture (50% phenol, 48% chloroform and 2% isoamyl alcohol). After vigorous mixing and centrifugation, the aqueous layer was removed to a fresh tube to which 0.25 volumes of 10M LiC! (finai concentration 2M) was added, mixed well and left at 4"C overnight to precipitate the RNA. The pellet was collected by centrifugation at 8000 x gfor 10 min at 2''C and washed with 2 M LiCI, The RNA was pelleted again from the wash. The RNA pellet was dissolved in 2 mi iH2O and ethanol precipitated after the addition of NaOAc (pH 5.2) to 0.3 M followed by a 70% ethanol wash. The finai RNA peiiet was resuspended in H^O for use. Northern blots were prepared using formaldefiyde RNA gels and blotted to an Immobilon N membrane (Millipore) according to the procedure of Fourney et ai. (1988). The probe, labelled in a random priming reaction, was the purified 450 bp Sty\EcoRV restriction fragment which spans from the signal sequence to the middle of the nuciease gene. Ribosomal RNA from Physarum polycephalum was loaded in adjacent lanes for size markers. Primer extension analysis was performed using reverse transcriptase with the primer 5'-CTGCGCGGCGAACAGCAG3' which extends from bases 156 to 173 of the published sequence. This primer lies within the signal sequence and primes DNA synthesis back towards the promoter region.
Site-directed mutagenesis Template DNA from the nuclease gene cloned into M13mp19 was prepared in the dut ung strain CJ236, elongated using T4
This work was supported by grant GM36891 from the National Institutes of Health and a Texas Advanced Research Program award #36521178.
References Ball, T.K., Saurugger. P.N., and Benedik, M.J. (1987) The extracellular nuclease gene of Serratia marcescens and its secretion from Escherichia coti Gene 57: 183-192. Ball. T.K., Wasmuth, C.R., Braunagei. S.C, and Benedik, M.J. (1990) Expression of Serratia marcescens extracellular proteins requires recA. J Bacteriot 172: 342-349. Bromke. B.J., and Hammel, J.M. (1979) Regulation of extracellular protease formation by Serratia marcescens. Can J Microbiol25: 47-52. Eaves, G.N., and Jeffries. C D . (1963) isoiation and properties of an exoceilular nuclease of Serratia marcescens. J Bacteriot 85: 273-27Q. Fourney, R.M., Miyakoshi, J., Day Ml, R.S., and Patterson, M.C (1988) Northern biotting: efficient RNA staining and transfer. Focus 10: 5-7. Givskov, M.. Olsen, L., and Mclin, S. (1988) Cioning and expression in Escherichia coli of the gene for extracellular phospholipase A l from Serratia tiquefaciens. J Bacterioi 170:5855-5862. Hines, D.W,. Saurugger, P.N., Ihler, G.M., and Benedik, M.J. (1988) Genetic analysis of extracellular proteins of Serratia marcescens. J Bacteriot 170: 4141-4146. Jones, J.D., Grady, K.L., Suslow, T.V., and Bedbrook. J.R. (1986) isolation and characterization of genes encoding two chitinase enzymes from Serratia marcescens. EMBO J 5: 467-^73. Kunkei. T., Roberts, J.. and Zakour, R. (1987) Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods Enzymol 15^*: 367-382. Miller. J.H. (1972) Experiments in Molecular Genetics. Cold Spring Harbor. New York: Cold Spring Harbor Laboratory Press. Monrea!. J.. and Reese. E.T. (1969) The chitinase of Serratia marcescens. Can J Microbiol IS: 689-696. Reid, J.D., Stoufer. S.D.. and Ogrydziak, D.M. (1982) Efficient transformation of Serratia marcescens with pBR322 plasmid DNA. Gene17:107-112. Takagi, T,, and Kisumi, M. (1985) Isolation of a versatile Serratia marcescens mutant as a host and molecular cloning of theaspartase gene. J Bacterioi 161:1-6. Vieira, J.. and Messing, J. (1982) The pUC plasmids, and M13mp7 derived system for insertion mulagenesis and sequencing with synthetic universal primers. Gene 19: 259-268.
Regulation of Serratia marcescens nuclease Winkler, U. (1968) Mutants of Serrate marcescens defective or superactive in the release of a nuclease. In Motecutar Genetics. Wittman, H.G., and Schuster, H. (eds). Berlin-Heideiberg: Springer, pp, 187-201. Winkler. U., and Stuckman, M. (1979) Glycogen, hyaiuronate, and some other polysaccharides greatly enhance the formation of exolipase by Serratia marcescens. J Bacteriot 138: 663-670.
651
Winkter, U., and Timmis, K. (1973) Pteiotropic mutations in Serratia marcescens which increase the synthesis of certain exoceilular proteins and the rate of spontaneous prophage excision. MolGen Genef\24:197-206. Zink, R.T., Engwall. J.K.. McEvoy, J.L., and Chatterjee, A.K. (1985) RecA is required in the induction of pectin lyase and carotovoricin in Erwinia carotovora subsp. carotovora. J Sacter/o/164: 390-396.
