J Biochem. 109, 404-409 (1991)
Renaturation, Purification, and Characterization of Human Truncated Macrophage Colony-Stimulating Factor Expressed in Escherichia coli Kazuya Yamanishi, Masayuki Takahashi, Tsutomu Nishida, Yasukazu Ohmoto, Masaaki Takano, Satoru Nakai, and Yoshikatsu Hirai Cellular Technology Institute, Otsuka Pharmaceutical Co, Ltd., 463-10 Kagasuno, Kawauchi-cho, Tokushima, Tokushuna 771-01 Received for publication, September 6, 1990
A human truncated macrophage colony-stimulating factor (M-CSF) encoding the amino acid residues from 3 to 153 of the native M-CSF was expressed by using a two-cistron expression system in Esclierichia coli. The truncated M-CSF found in inclusion bodies was renatured and had CSF activity. Purification, which included a QAE-ZeTa preparative cartridge concentration step followed sequentially by HPLC on TSK-gel Phenyl-5PW and TSK-gel DEAE-5PW columns, gave an overall yield of 63.8%. The punned truncated M-CSF had a specific activity of 4X10 7 units/mg of protein. Peptide mapping of a lysylendopeptidase digest by reversed-phase HPLC confirmed the amino acid sequence predicted from the cDNA sequence. SDS-PAGE of the purified truncated M-CSF gave a single band at 17 kDa under reducing conditions and at 32 kDa under non-reducing conditions. Activated Thiol-Sepharose 6B column chromatography and other experiments failed to detect any free cysteine residue in spite of the existence of 7 cysteine residues in the truncated M-CSF subunit. These results indicate that it is a dimeric structure linked by one or more intermolecular disulfide bonds.
Colony-stimulating factors are glycoproteins which regulate the production of hematopoietic cells (1). Among them, the macrophage colony-stimulating factor (M-CSF, otherwise known as CSF-1) can selectively stimulate the survival, proliferation, and differentiation of mononuclearphagocyte lineage cells (2). M-CSF also stimulates effector functions of the mature monocyte, such as antifungal activity (3) and lymphokine-induced tumoricidal activity (4). Native M-CSF has been purified from serum-free conditioned medium of murine L-cells (5), a human lymphoblastoid cell line, CEM-ON (6), or a human pancreatic carcinoma cell line, MIA-PaCa (7) and from human urine (8-11). Molecular cloning of cDNA encoding human MCSF has been reported and three types of cDNA, which encode precursors composed of 554, 438, and 256 amino acid residues, have been isolated (10, 12-14). These are thought to be formed by alternative splicing. Expression studies have also been performed using mainly eukaryotic expression systems such as COS cells (14), CHO cells (10), and insect cells (15). A moderate amount of M-CSF was expressed and prepared using those expression systems. From an economic standpoint, however, Escherichia coli expression systems are generally superior to eukaryotic systems. The M-CSF molecule is a dimer which is stabilized by one or more disulfide bridges (16). The dimeric structure is essential for biological activity (2, 7, 16). Treatments with endoglycosidase caused a decrease in the molecular weight of M-CSF but did not affect its in vitro biological activity (16). These results suggest that the nonglycosylated M-CSF molecule expressed in E. coli Abbreviations: M-CSF, macrophage colony-stimulating factor; N-termrnal, ammo-terminal; C-terminal, carboxyl-terminal; TFA, trifluoroacetic acid.
404
would be biologically active, as long as the molecule is folded into its native dimeric form. We have shown that the carboxyl (C)-terminal 369 amino acids of the 554 amino acid precursor are not essential for its in vitro activity (14). We report here that the truncated M-CSF, which consisted of 151 amino acid residues (positions 3 to 153 of mature M-CSF), was expressed in E. coli and could be renatured to its biologically active dimeric form. The results confirm that the amino (N)-terminal region is sufficient for biological activity, and that the nonglycosylated M-CSF is biologically active. We have tried to detect free sulfhydryl groups in the refolded protein using activated Thiol-Sepharose 6B column chromatography, Ellman's reagent and chemical modification with iodoacetamide. The results show that the truncated M-CSF has no free sulfhydryl groups, and it should thus have seven disulfide bonds in the dimeric form. MATERIALS AND METHODS Construction and Expression of Truncated Human MCSF—The expression of a truncated form of human M-CSF was performed using a two-cistron expression system. The COS expression plasmid (pcDhMCSFl 1 -185), which encodes the 185 N-terminal residues of the M-CSF precursor (14), was digested with Seal and BamtU.. The resultant Scal-BaniHl fragment (about 450 bp) was ligated with a synthetic linker having an internal SD sequence, a termination codon for the first cistron, and an initiation codon for the second cistron. The ligated fragment was inserted between the Xbal and BamHl sites of ptrpIL-2D8zJ (unpublished data). The resultant plasmid, ptrpIL-2X M-CSF 101 (Fig. 1), was then transformed into J. Biochem.
Renaturation, Purification, and Characterization of Human Truncated M-CSF E. coli SG21058 (17). Renaturation of Truncated M-CSF from E. coli—E. coli SG21058 harboring the plasmid ptrpIL-2X M-CSF 101 was shaken at 37'C for 8 h in a 300 ml flask containing 50 ml of M9 medium supplemented with 1% casamino acids, 0.4% glucose, 5 //g/ml of thiamine-HCl, 20 jug/ml of L-cysteine, and 50/*g/ml of ampicillin. E. coh cells (7.5 g of wet weight) were harvested by centrifugation, uniformly suspended in 100 ml of 50 mM Tris-HCl, pH 7.0, and stirred at 4'C. Lysozyme (24 mg) and EDTA (final 10 mM) were added to the above suspension. After being stirred for 15 min at 4'C, the solution was sonicated. The resultant lysate was centrifuged at 10,000 X g for 20 min and the pellet was washed twice with 50 ml of 50 mM Tris-HCl, pH7.0, containing 2.0% Triton X-100. The final pellet gave an inclusion body containing the truncated M-CSF. The inclusion body was solubilized in 20 ml of 50 mM Tris-HCl, pH 7.5, containing 7.0 M guanidine-HCl and 25 mM 2-mercaptoethanol and stirred for 4 h at room temperature. The solubilized inclusion body was slowly dropped into 2 liters of glutathione solution (0.5 mM reduced and 0.1 mM oxidized glutathione and 2.0 M urea in 50 mM Tris-HCl, pH 8.5) and vigorously stirred. The solution was kept at 4*C for 2 days. Gel Filtration HPLC on a Shodex WS-803 Column— Renatured protein solution (10 ml) was concentrated to 500 //I using an Amicon YM-10 membrane (Amicon, Lexington, U.S.A.) and applied to a Shodex WS-803 column (Showa Denko, Tokyo) previously equilibrated with 40 mM sodium phosphate containing 0.3 M NaCl, pH 6.8, for gel filtration HPLC at a flow rate of 0.7 ml/min. Each fraction was subjected to the M-CSF assay described below. Molecular weights were estimated by comparison with those of standard proteins (glutamate dehydrogenase, 290,000; lactate dehydrogenase, 142,000; enolase, 67,000; adenylate kinase, 32,000; cytochrome c, 12,400; purchased from Oriental Yeast, Osaka). Purification of the Truncated M-CSF—Concentration on QAE-ZeTa preparative cartridge: The renatured protein solution (2 liters) was centrifuged at 10,000 X g for 20 min. The supernatant was then applied to a QAE-ZeTa preparative cartridge 100 (Pharmacia-LKB, Uppsala, Sweden) previously equilibrated with 50 mM Tris-HCl, pH8.5. After washing of the cartridge with the same buffer, the truncated M-CSF was eluted with 0.5 M NaCl in 50 mM Tris-HCl, pH 8.5. Hydrophobic interaction HPLC on TSK-gel PhenylSPW column: Solid ammonium sulfate was slowly added to the concentrated sample with gentle stirring to obtain 30% saturation. After centrifugation at 10,000 X g for 20 min, the supernatant was applied to a TSK-gel Phenyl-5PW HPLC column (21.5x150 mm, Tosoh, Tokyo) previously equilibrated with 40 mM sodium phosphate, pH 7.4 containing ammonium sulfate at 30% saturation. The protein was eluted at a flow rate of 3 ml/min with a decreasing concentration gradient of ammonium sulfate from 30 to 0% saturation for 40 min. The active fractions were concentrated on a YM-10 membrane and dialyzed against 40 mM sodium phosphate, pH 7.4. Ion exchange HPLC on a TSK-gel DEAE-5PW column: The concentrated sample solution (17.5 ml) was applied to a TSK-gel DEAE-5PW column (21.5X150 mm, Tosoh) which had been pre-equilibrated with 40 mM sodium Vol 109, No. 3, 1991
405
phosphate, pH 7.4, and eluted at a flow rate of 3 ml/min with an NaCl gradient. Peptide Mapping—A 1 ml aliquot of truncated M-CSF solution (150//g/ml) was diluted with 4 ml of 0.1 M Tris-HCl buffer, pH 8.0, containing 7 M guanidine-HCl and 0.01% EDTA. The truncated M-CSF was then reduced with 0.95 mg of dithiothreitol at 55"C under nitrogen gas. After 2 h, 2.22 mg of iodoacetamide dissolved in a small volume of 0.1 M Tris-HCl, pH8.0, was added to the reaction mixture and it was kept for 30 min at room temperature. The reduced and carboxyamidomethylated M-CSF was applied to a reversed-phase HPLC column (RP-304; 4.6 x 250 mm; Bio-Rad, CA, U.S.A.) and eluted with an acetonitrile gradient. After concentration and pH adjustment to pH 8.5 with 0.05 M Tris-HCl, pH 8.5, lysylendopeptidase was added to the solution at the enzyme/substrate ratio of 1 : 50 (w/w) and the reaction mixture was kept at 37'C for 15 h. M-CSF fragments obtained were then applied to a reversed-phase HPLC column (RP-304) which was equilibrated with 0.1% trifluoroacetic acid (TFA) in H2O and separated with an acetonitrile Linear gradient of 0.5% per min at aflowrate of 1 ml per min Every peak was analyzed by an amino acid analyzer. SDS-Polyacrylamide Gel Electrophoresis—SVS-'PAGE was performed with the buffer system of Laemmli in 15% polyacrylamide gel (18). Samples were prepared by heating at 95'C for 5 min in 0.15 M Tris-HCl, pH 6.8, containing 2% SDS, 10% glycerol, and 2% 2-mercaptoethanol. Gels were stained with Coomassie Brilliant Blue R-250. Molecular weight standards included; phosphorylase b, 130,000; bovine serum albumin, 75,000; ovalbumin, 50,000; lactate dehydrogenase, 39,000; soybean trypsin inhibitor, 27,000; ribonuclease, 17,000 (prestaining kit, Bio-Rad). Protein Assay—Protein concentration was determined with a Bio-Rad protein assay kit using human serum albumin as a standard. Quantitation of Thiol Groups Using EUman's Reagent —The M-CSF (40//g/100//l) was dissolved in 0.1 M Tris-HCl, pH 8.0, containing 6 M guanidine-HCl and 0.01 M EDTA (900 pel). Ellman's reagent solution (19) (0.01 mM Ellman's reagent in 0.05 M sodium phosphate, pH 7.0) was then added. The reaction was monitored by measuring the absorbance increase at 412 nm, and the number of free cysteine residues per M-CSF molecule was calculated. Chemical Modification of Free Cysteine Residues Using Iodoacetamide—Truncated M-CSF (30//g) was dissolved in 0.1 M Tris-HCl, pH 6.9, containing 7 M guanidine-HCl. Iodoacetamide was added to the solution and mixed. The reaction was performed in the dark at room temperature for 30 min. The modified M-CSF was isolated by reversedphase HPLC on an RP-304 column. The detection of carboxyamidomethylated cysteine was performed by amino acid analysis. Activated Thiol-Sepharose 6B Column Chromatography —An activated Thiol-Sepharose 6B column (2 ml of gel volume) was preequilibrated with 50 mM Tris-HCl, pH 8.0, containing 8 M urea, 1 mM EDTA, and 0.5 M NaCl. The truncated M-CSF (100 //g) dissolved in the same buffer (100 fxl) was applied to the column and held in the column by stopping the flow for 1 h. After washing of the column with the same buffer, elution was performed with 20 and 50 mM 2-mercaptoethanol in the same buffer, respectively. The M-CSF was detected by SDS-PAGE. Human interleu-
K. Yamanishi et aL
406 kin-l/S (20) (100//g), which was used as a reference, was also treated in the same way. Amino Acid Analysis—Aliquots (7.5 ng) of the purified M-CSF were hydrolyzed for 4 h at 130*C in 6 N HC1 containing 1% phenol. The hydrolysate was analyzed on a Hitachi amino acid analyzer using o-phthalaldehyde as a coloring reagent. M-CSF Bioassay—M-CSF bioassay was performed by using the murine bone marrow assay as follows (6). Bone marrow cells (1.5 X10*) from a BALB/c mouse were grown in 0.5 ml of a MEM medium containing 20% FCS and 0.3% agar. After 7 days of incubation at 37'C under 5% carbon dioxide in air, colonies containing more than 50 cells were counted. RESULTS AND DISCUSSION In order to express the truncated form of human M-CSF in E. coli, M-CSF was first ligated directly downstream of the tryptophan promoter, but the expression of M-CSF almost did not occur. Then, we constructed a two-cistron expression plasmid, ptrpEL-2X M-CSF 101, using IL-2 high expression vector (unpublished data). The plasmid encodes two polypeptides within a single transcriptional unit under the E. coU tryptophan promoter; one consisting of 65 N-terminal amino acid residues of human EL-2 (21) and 4 amino acids derived from the linker sequence, and the other consisting of 152 amino acid residues including the translation initiation methionine and the sequence spanning from positions 3 to 153 of native human mature M-CSF as shown in Fig. 1. Lane 1 in Fig. 2A shows the SDS-PAGE pattern of E. coli SG21058 lysate expressing M-CSF. When compared with the control E. coli host lysate, SG21058, two extra-strong bands of 17 and 8.5 kDa were recognized. The bands proved to be the truncated M-CSF and IL-2 fragment, respectively, in Western blot analysis using specific polyclonal antibody against human M-CSF and IL-2 (data not shown). EcoRI trp
Amp
Clal
R
AlL-2
( B )
( A )
1
2
kDa * -
75
^50 "•-39 ***•
27
• » - 17
Fig. 2. SDS-PAGE of each fraction from E. coli SG21068 expressing M-CSF (A) and purified M-CSF (B). (A) Each fraction from E. coli SG21058 was electrophoresed under reducing conditions Lane 1, E. coli lysate; lane 2, supernatant after disruption; lane 3, precipitate containing inclusion body (B) M-CSF purified by ion exchange HPLC was electrophoresed under reducing (lane 1) and non-reducing (lane 2) conditions, respectively.
E. coli cells were disrupted by sequential lysozyme/EDTA treatment and sonication, and the inclusion bodies were separated by centrifugation. Both truncated M-CSF and the IL-2 fragment were recovered only as inclusion bodies (Fig. 2A). Since M-CSF was reported to have activity only in a dimeric form (2, 7, 16), we solubilized the inclusion bodies in 7 M guanidine-HCl, and carried out renaturation using a glutathione redox system as described in "MATERIALS AND METHODS " After renaturation, the EL-2 fragment was almost wholly removed as a precipitate of the IL-2 fragment dimer linked by the intermolecular disulfide bond between Cys-58s. The precipitate was recognized by Western blot analysis of the reduced and non-reduced precipitate using polyclonal antibody against IL-2 (data not shown). The supernatant of the renatured solution showed M-CSF activity in the murine bone marrow assay (Table I). However, the recovery of M-CSF after renaturation could not be exactly calculated because the M-CSF content in the solubilized inclusion bodies could not be determined and various polymeric forms other than the dimer existed in the renatured solution as described below. When a part of the supernatant was concentrated and subjected to gel filtration HPLC on a Shodex WS-803 column, only the fractions from 37 to 40, which contained protein with a mobility of 32-34 kDa, showed M-CSF activity (Fig. 3). Fractions corresponding to a monomer and other multiple forms did not show M-CSF activity in spite of their
M-CSF
BamHI Stop
Leu Glu Arg Arg Thr His I
I Met
Val Ser
Glu
51 — C T A G A A C G G A G G A C T C A T T G A T G G T A T C A G A A T
TTGCCTCCTGAGTAACTACCATAGTCTTA
ISD( M-CSF)I
II
3'
Fig. 1. Construction of a two-cistronic expression plasmid, ptrpIL-2X M-CSF 101. The ScoI-BamHI fragment was ligated with a synthetic linker which possessed internally an SD, an initiation codon and a termination codon. The ligated fragment was inserted between the Xbal-BamHl sites of ptrpIL-2D8zJ (upper). The linker sequence is shown below.
Initiation (M-CSF)
J. Biochem.
407
Renaturation, Purification, and Characterization of Human Truncated M-CSF TABLE I
Purification of human truncated M-CSF. Volume (ml)
Fraction s.o I
0 02
(0
«
a
s
3 0
|
eta
Renaturation, Purification, and Characterization of Human Truncated Macrophage Colony-Stimulating Factor Expressed in Escherichia coli Kazuya Yamanishi, Masayuki Takahashi, Tsutomu Nishida, Yasukazu Ohmoto, Masaaki Takano, Satoru Nakai, and Yoshikatsu Hirai Cellular Technology Institute, Otsuka Pharmaceutical Co, Ltd., 463-10 Kagasuno, Kawauchi-cho, Tokushima, Tokushuna 771-01 Received for publication, September 6, 1990
A human truncated macrophage colony-stimulating factor (M-CSF) encoding the amino acid residues from 3 to 153 of the native M-CSF was expressed by using a two-cistron expression system in Esclierichia coli. The truncated M-CSF found in inclusion bodies was renatured and had CSF activity. Purification, which included a QAE-ZeTa preparative cartridge concentration step followed sequentially by HPLC on TSK-gel Phenyl-5PW and TSK-gel DEAE-5PW columns, gave an overall yield of 63.8%. The punned truncated M-CSF had a specific activity of 4X10 7 units/mg of protein. Peptide mapping of a lysylendopeptidase digest by reversed-phase HPLC confirmed the amino acid sequence predicted from the cDNA sequence. SDS-PAGE of the purified truncated M-CSF gave a single band at 17 kDa under reducing conditions and at 32 kDa under non-reducing conditions. Activated Thiol-Sepharose 6B column chromatography and other experiments failed to detect any free cysteine residue in spite of the existence of 7 cysteine residues in the truncated M-CSF subunit. These results indicate that it is a dimeric structure linked by one or more intermolecular disulfide bonds.
Colony-stimulating factors are glycoproteins which regulate the production of hematopoietic cells (1). Among them, the macrophage colony-stimulating factor (M-CSF, otherwise known as CSF-1) can selectively stimulate the survival, proliferation, and differentiation of mononuclearphagocyte lineage cells (2). M-CSF also stimulates effector functions of the mature monocyte, such as antifungal activity (3) and lymphokine-induced tumoricidal activity (4). Native M-CSF has been purified from serum-free conditioned medium of murine L-cells (5), a human lymphoblastoid cell line, CEM-ON (6), or a human pancreatic carcinoma cell line, MIA-PaCa (7) and from human urine (8-11). Molecular cloning of cDNA encoding human MCSF has been reported and three types of cDNA, which encode precursors composed of 554, 438, and 256 amino acid residues, have been isolated (10, 12-14). These are thought to be formed by alternative splicing. Expression studies have also been performed using mainly eukaryotic expression systems such as COS cells (14), CHO cells (10), and insect cells (15). A moderate amount of M-CSF was expressed and prepared using those expression systems. From an economic standpoint, however, Escherichia coli expression systems are generally superior to eukaryotic systems. The M-CSF molecule is a dimer which is stabilized by one or more disulfide bridges (16). The dimeric structure is essential for biological activity (2, 7, 16). Treatments with endoglycosidase caused a decrease in the molecular weight of M-CSF but did not affect its in vitro biological activity (16). These results suggest that the nonglycosylated M-CSF molecule expressed in E. coli Abbreviations: M-CSF, macrophage colony-stimulating factor; N-termrnal, ammo-terminal; C-terminal, carboxyl-terminal; TFA, trifluoroacetic acid.
404
would be biologically active, as long as the molecule is folded into its native dimeric form. We have shown that the carboxyl (C)-terminal 369 amino acids of the 554 amino acid precursor are not essential for its in vitro activity (14). We report here that the truncated M-CSF, which consisted of 151 amino acid residues (positions 3 to 153 of mature M-CSF), was expressed in E. coli and could be renatured to its biologically active dimeric form. The results confirm that the amino (N)-terminal region is sufficient for biological activity, and that the nonglycosylated M-CSF is biologically active. We have tried to detect free sulfhydryl groups in the refolded protein using activated Thiol-Sepharose 6B column chromatography, Ellman's reagent and chemical modification with iodoacetamide. The results show that the truncated M-CSF has no free sulfhydryl groups, and it should thus have seven disulfide bonds in the dimeric form. MATERIALS AND METHODS Construction and Expression of Truncated Human MCSF—The expression of a truncated form of human M-CSF was performed using a two-cistron expression system. The COS expression plasmid (pcDhMCSFl 1 -185), which encodes the 185 N-terminal residues of the M-CSF precursor (14), was digested with Seal and BamtU.. The resultant Scal-BaniHl fragment (about 450 bp) was ligated with a synthetic linker having an internal SD sequence, a termination codon for the first cistron, and an initiation codon for the second cistron. The ligated fragment was inserted between the Xbal and BamHl sites of ptrpIL-2D8zJ (unpublished data). The resultant plasmid, ptrpIL-2X M-CSF 101 (Fig. 1), was then transformed into J. Biochem.
Renaturation, Purification, and Characterization of Human Truncated M-CSF E. coli SG21058 (17). Renaturation of Truncated M-CSF from E. coli—E. coli SG21058 harboring the plasmid ptrpIL-2X M-CSF 101 was shaken at 37'C for 8 h in a 300 ml flask containing 50 ml of M9 medium supplemented with 1% casamino acids, 0.4% glucose, 5 //g/ml of thiamine-HCl, 20 jug/ml of L-cysteine, and 50/*g/ml of ampicillin. E. coh cells (7.5 g of wet weight) were harvested by centrifugation, uniformly suspended in 100 ml of 50 mM Tris-HCl, pH 7.0, and stirred at 4'C. Lysozyme (24 mg) and EDTA (final 10 mM) were added to the above suspension. After being stirred for 15 min at 4'C, the solution was sonicated. The resultant lysate was centrifuged at 10,000 X g for 20 min and the pellet was washed twice with 50 ml of 50 mM Tris-HCl, pH7.0, containing 2.0% Triton X-100. The final pellet gave an inclusion body containing the truncated M-CSF. The inclusion body was solubilized in 20 ml of 50 mM Tris-HCl, pH 7.5, containing 7.0 M guanidine-HCl and 25 mM 2-mercaptoethanol and stirred for 4 h at room temperature. The solubilized inclusion body was slowly dropped into 2 liters of glutathione solution (0.5 mM reduced and 0.1 mM oxidized glutathione and 2.0 M urea in 50 mM Tris-HCl, pH 8.5) and vigorously stirred. The solution was kept at 4*C for 2 days. Gel Filtration HPLC on a Shodex WS-803 Column— Renatured protein solution (10 ml) was concentrated to 500 //I using an Amicon YM-10 membrane (Amicon, Lexington, U.S.A.) and applied to a Shodex WS-803 column (Showa Denko, Tokyo) previously equilibrated with 40 mM sodium phosphate containing 0.3 M NaCl, pH 6.8, for gel filtration HPLC at a flow rate of 0.7 ml/min. Each fraction was subjected to the M-CSF assay described below. Molecular weights were estimated by comparison with those of standard proteins (glutamate dehydrogenase, 290,000; lactate dehydrogenase, 142,000; enolase, 67,000; adenylate kinase, 32,000; cytochrome c, 12,400; purchased from Oriental Yeast, Osaka). Purification of the Truncated M-CSF—Concentration on QAE-ZeTa preparative cartridge: The renatured protein solution (2 liters) was centrifuged at 10,000 X g for 20 min. The supernatant was then applied to a QAE-ZeTa preparative cartridge 100 (Pharmacia-LKB, Uppsala, Sweden) previously equilibrated with 50 mM Tris-HCl, pH8.5. After washing of the cartridge with the same buffer, the truncated M-CSF was eluted with 0.5 M NaCl in 50 mM Tris-HCl, pH 8.5. Hydrophobic interaction HPLC on TSK-gel PhenylSPW column: Solid ammonium sulfate was slowly added to the concentrated sample with gentle stirring to obtain 30% saturation. After centrifugation at 10,000 X g for 20 min, the supernatant was applied to a TSK-gel Phenyl-5PW HPLC column (21.5x150 mm, Tosoh, Tokyo) previously equilibrated with 40 mM sodium phosphate, pH 7.4 containing ammonium sulfate at 30% saturation. The protein was eluted at a flow rate of 3 ml/min with a decreasing concentration gradient of ammonium sulfate from 30 to 0% saturation for 40 min. The active fractions were concentrated on a YM-10 membrane and dialyzed against 40 mM sodium phosphate, pH 7.4. Ion exchange HPLC on a TSK-gel DEAE-5PW column: The concentrated sample solution (17.5 ml) was applied to a TSK-gel DEAE-5PW column (21.5X150 mm, Tosoh) which had been pre-equilibrated with 40 mM sodium Vol 109, No. 3, 1991
405
phosphate, pH 7.4, and eluted at a flow rate of 3 ml/min with an NaCl gradient. Peptide Mapping—A 1 ml aliquot of truncated M-CSF solution (150//g/ml) was diluted with 4 ml of 0.1 M Tris-HCl buffer, pH 8.0, containing 7 M guanidine-HCl and 0.01% EDTA. The truncated M-CSF was then reduced with 0.95 mg of dithiothreitol at 55"C under nitrogen gas. After 2 h, 2.22 mg of iodoacetamide dissolved in a small volume of 0.1 M Tris-HCl, pH8.0, was added to the reaction mixture and it was kept for 30 min at room temperature. The reduced and carboxyamidomethylated M-CSF was applied to a reversed-phase HPLC column (RP-304; 4.6 x 250 mm; Bio-Rad, CA, U.S.A.) and eluted with an acetonitrile gradient. After concentration and pH adjustment to pH 8.5 with 0.05 M Tris-HCl, pH 8.5, lysylendopeptidase was added to the solution at the enzyme/substrate ratio of 1 : 50 (w/w) and the reaction mixture was kept at 37'C for 15 h. M-CSF fragments obtained were then applied to a reversed-phase HPLC column (RP-304) which was equilibrated with 0.1% trifluoroacetic acid (TFA) in H2O and separated with an acetonitrile Linear gradient of 0.5% per min at aflowrate of 1 ml per min Every peak was analyzed by an amino acid analyzer. SDS-Polyacrylamide Gel Electrophoresis—SVS-'PAGE was performed with the buffer system of Laemmli in 15% polyacrylamide gel (18). Samples were prepared by heating at 95'C for 5 min in 0.15 M Tris-HCl, pH 6.8, containing 2% SDS, 10% glycerol, and 2% 2-mercaptoethanol. Gels were stained with Coomassie Brilliant Blue R-250. Molecular weight standards included; phosphorylase b, 130,000; bovine serum albumin, 75,000; ovalbumin, 50,000; lactate dehydrogenase, 39,000; soybean trypsin inhibitor, 27,000; ribonuclease, 17,000 (prestaining kit, Bio-Rad). Protein Assay—Protein concentration was determined with a Bio-Rad protein assay kit using human serum albumin as a standard. Quantitation of Thiol Groups Using EUman's Reagent —The M-CSF (40//g/100//l) was dissolved in 0.1 M Tris-HCl, pH 8.0, containing 6 M guanidine-HCl and 0.01 M EDTA (900 pel). Ellman's reagent solution (19) (0.01 mM Ellman's reagent in 0.05 M sodium phosphate, pH 7.0) was then added. The reaction was monitored by measuring the absorbance increase at 412 nm, and the number of free cysteine residues per M-CSF molecule was calculated. Chemical Modification of Free Cysteine Residues Using Iodoacetamide—Truncated M-CSF (30//g) was dissolved in 0.1 M Tris-HCl, pH 6.9, containing 7 M guanidine-HCl. Iodoacetamide was added to the solution and mixed. The reaction was performed in the dark at room temperature for 30 min. The modified M-CSF was isolated by reversedphase HPLC on an RP-304 column. The detection of carboxyamidomethylated cysteine was performed by amino acid analysis. Activated Thiol-Sepharose 6B Column Chromatography —An activated Thiol-Sepharose 6B column (2 ml of gel volume) was preequilibrated with 50 mM Tris-HCl, pH 8.0, containing 8 M urea, 1 mM EDTA, and 0.5 M NaCl. The truncated M-CSF (100 //g) dissolved in the same buffer (100 fxl) was applied to the column and held in the column by stopping the flow for 1 h. After washing of the column with the same buffer, elution was performed with 20 and 50 mM 2-mercaptoethanol in the same buffer, respectively. The M-CSF was detected by SDS-PAGE. Human interleu-
K. Yamanishi et aL
406 kin-l/S (20) (100//g), which was used as a reference, was also treated in the same way. Amino Acid Analysis—Aliquots (7.5 ng) of the purified M-CSF were hydrolyzed for 4 h at 130*C in 6 N HC1 containing 1% phenol. The hydrolysate was analyzed on a Hitachi amino acid analyzer using o-phthalaldehyde as a coloring reagent. M-CSF Bioassay—M-CSF bioassay was performed by using the murine bone marrow assay as follows (6). Bone marrow cells (1.5 X10*) from a BALB/c mouse were grown in 0.5 ml of a MEM medium containing 20% FCS and 0.3% agar. After 7 days of incubation at 37'C under 5% carbon dioxide in air, colonies containing more than 50 cells were counted. RESULTS AND DISCUSSION In order to express the truncated form of human M-CSF in E. coli, M-CSF was first ligated directly downstream of the tryptophan promoter, but the expression of M-CSF almost did not occur. Then, we constructed a two-cistron expression plasmid, ptrpEL-2X M-CSF 101, using IL-2 high expression vector (unpublished data). The plasmid encodes two polypeptides within a single transcriptional unit under the E. coU tryptophan promoter; one consisting of 65 N-terminal amino acid residues of human EL-2 (21) and 4 amino acids derived from the linker sequence, and the other consisting of 152 amino acid residues including the translation initiation methionine and the sequence spanning from positions 3 to 153 of native human mature M-CSF as shown in Fig. 1. Lane 1 in Fig. 2A shows the SDS-PAGE pattern of E. coli SG21058 lysate expressing M-CSF. When compared with the control E. coli host lysate, SG21058, two extra-strong bands of 17 and 8.5 kDa were recognized. The bands proved to be the truncated M-CSF and IL-2 fragment, respectively, in Western blot analysis using specific polyclonal antibody against human M-CSF and IL-2 (data not shown). EcoRI trp
Amp
Clal
R
AlL-2
( B )
( A )
1
2
kDa * -
75
^50 "•-39 ***•
27
• » - 17
Fig. 2. SDS-PAGE of each fraction from E. coli SG21068 expressing M-CSF (A) and purified M-CSF (B). (A) Each fraction from E. coli SG21058 was electrophoresed under reducing conditions Lane 1, E. coli lysate; lane 2, supernatant after disruption; lane 3, precipitate containing inclusion body (B) M-CSF purified by ion exchange HPLC was electrophoresed under reducing (lane 1) and non-reducing (lane 2) conditions, respectively.
E. coli cells were disrupted by sequential lysozyme/EDTA treatment and sonication, and the inclusion bodies were separated by centrifugation. Both truncated M-CSF and the IL-2 fragment were recovered only as inclusion bodies (Fig. 2A). Since M-CSF was reported to have activity only in a dimeric form (2, 7, 16), we solubilized the inclusion bodies in 7 M guanidine-HCl, and carried out renaturation using a glutathione redox system as described in "MATERIALS AND METHODS " After renaturation, the EL-2 fragment was almost wholly removed as a precipitate of the IL-2 fragment dimer linked by the intermolecular disulfide bond between Cys-58s. The precipitate was recognized by Western blot analysis of the reduced and non-reduced precipitate using polyclonal antibody against IL-2 (data not shown). The supernatant of the renatured solution showed M-CSF activity in the murine bone marrow assay (Table I). However, the recovery of M-CSF after renaturation could not be exactly calculated because the M-CSF content in the solubilized inclusion bodies could not be determined and various polymeric forms other than the dimer existed in the renatured solution as described below. When a part of the supernatant was concentrated and subjected to gel filtration HPLC on a Shodex WS-803 column, only the fractions from 37 to 40, which contained protein with a mobility of 32-34 kDa, showed M-CSF activity (Fig. 3). Fractions corresponding to a monomer and other multiple forms did not show M-CSF activity in spite of their
M-CSF
BamHI Stop
Leu Glu Arg Arg Thr His I
I Met
Val Ser
Glu
51 — C T A G A A C G G A G G A C T C A T T G A T G G T A T C A G A A T
TTGCCTCCTGAGTAACTACCATAGTCTTA
ISD( M-CSF)I
II
3'
Fig. 1. Construction of a two-cistronic expression plasmid, ptrpIL-2X M-CSF 101. The ScoI-BamHI fragment was ligated with a synthetic linker which possessed internally an SD, an initiation codon and a termination codon. The ligated fragment was inserted between the Xbal-BamHl sites of ptrpIL-2D8zJ (upper). The linker sequence is shown below.
Initiation (M-CSF)
J. Biochem.
407
Renaturation, Purification, and Characterization of Human Truncated M-CSF TABLE I
Purification of human truncated M-CSF. Volume (ml)
Fraction s.o I
0 02
(0
«
a
s
3 0
|
eta
