Original Articles

FOODBORNE PATHOGENS AND DISEASE Volume 12, Number 5, 2015 ª Mary Ann Liebert, Inc. DOI: 10.1089/fpd.2014.1825

Resistance to Sulfonamides and Dissemination of sul Genes Among Salmonella spp. Isolated from Food in Poland _ _ ´ ska,1 Magdalena Modzelewska,1 Łukasz Ma˛ka,1 Elzbieta Mac´kiw,1 Halina S´ciezyn and Magdalena Popowska 2

Abstract

Antimicrobial resistance of pathogenic bacteria, including Salmonella spp., is an emerging problem of food safety. Antimicrobial use can result in selection of resistant organisms. The food chain is considered a route of transmission of resistant pathogens to humans. In many European countries, sulfonamides are one of the most commonly used antimicrobials. The aim of our investigation was to assess the prevalence of sul genes and plasmid occurrence among sulfonamide-resistant Salmonella spp. Eighty-four sulfonamide-resistant isolates were collected in 2008 and 2013 from retail products in Poland. Minimal inhibitory concentration of all of these isolates was ‡ 1024 lg/mL. Resistant isolates were tested for the presence of sul1, sul2, sul3, and int1 genes by using multiplex polymerase chain reaction. In total, 44.0% (37/84) isolates carried the sul1 gene, 46.4% (39/84) were sul2 positive, while the sul3 gene was not detected in any of the sulfonamide-resistant isolates tested. It was found that 3.6% (3/84) of resistant Salmonella spp. contained sul1, sul2, and intI genes. All 33 intI-positive isolates carried the sul1 gene. Eleven of the sulfonamide-resistant isolates were negative for all the sul genes. Most of the sulfonamide-resistant Salmonella spp. harbored plasmids; only in eight isolates were no plasmids detected. Generally, the size of the plasmids ranged from approximately 2 kb to ‡ 90 kb. Our results revealed a relatively a high prevalence of sulfonamides-resistant Salmonella spp. isolated from retail food. Additionally, we have detected a high dissemination of plasmids and class 1 integrons that may enhance the spread of resistance genes in the food chain.

Introduction

S

almonella spp. are some of the most common human foodborne pathogens in the European Union (EU). A total of 92,916 salmonellosis cases were reported by the 27 EU member countries in 2012 (EFSA and ECDC, 2014). The 2 most commonly reported Salmonella serovars in 2012, of all confirmed cases in humans, were Salmonella Enteritidis (41.3%) and Salmonella Typhimurium (22.1%). In Poland in 2012, a total of 8444 salmonellosis cases were reported, including 8267 cases of food poisoning. The most frequently isolated serotype was Salmonella Enteritidis (75.2%), while the second was Salmonella Typhimurium (6.6%) (Czarkowski et al., 2013). Humans are infected via the contaminated food, mainly chicken, dairy products, and eggs. Antimicrobial resistance of pathogenic bacteria is an emerging problem. According to official documents, about

25,000 patients die each year in the EU, Iceland, and Norway from infections with antibiotic-resistant bacteria. Infections from resistant bacteria result in annual costs of at least EUR 15 billion in the EU due to additional healthcare and loss of productivity (ECDC/EMEA, 2009). Resistance among foodborne pathogens is linked to use of antimicrobials in animals (Phillips et al., 2004). Sulfonamides are one of the most commonly used antimicrobials. In total, 17% of the sales of veterinary antibacterial agents in the 10 European countries were sulfonamides and trimethoprim (as sulfonamides or in combination) (Grave et al., 2010). Sulfonamides exhibit bacterial activity against many aerobic bacteria, usually used in combination with trimethoprim. In human medicine, sulfonamides may be utilized in gastrointestinal infections or urinary tract infections, and in animals they may also used in therapy of the respiratory system.

1 Laboratory of Food Microbiology, Department of Food Safety, National Institute of Public Health—National Institute of Hygiene, Warsaw, Poland. 2 Department of Applied Microbiology, Institute of Microbiology, Faculty of Biology, University of Warsaw, Warsaw, Poland.

383

384

Resistance to sulfonamides is commonly associated with genes encoding alternative variants of dihydropteroate synthase (DHPS) that have no affinity for sulfonamides, or less frequently with mutations in the chromosomal DHPS gene (folP) (Swedberg et al., 1993; Sko¨ld, 2000). Resistance to sulfonamides among Salmonella spp. is associated with the presence of sul genes, encoding dihydropteroate synthase in a form that is not inhibited by the drug (Enne et al., 2001; Antunes et al., 2005). The dissemination of antimicrobial resistance often occurs via mobile genetic elements such as plasmids, transposons, and gene cassettes in integrons (Thomas and Nielsen, 2005; Popowska and Krawczyk-Balska, 2013). There are three sul genes known (sul1, sul2, and sul3) that encode resistance to sulfonamides. The first one, sul1, is often located within 3¢-conserved segment (3¢-CS) of class 1 integrons (Sko¨ld, 2000; Infante et al., 2005), whereas sul2 is usually associated with small multicopy plasmids or large transmissible multiresistance plasmids (Enne et al., 2001, 2004; Guerra et al., 2002). These two genes are the most frequently found among sulfonamide-resistant isolates. In 2003, Perreten and Boerlin (2003) described the sul3 gene, detected in Escherichia coli isolated from pigs in Switzerland. This gene can be detected in Salmonella spp. strains of different origins and serotypes on various large plasmids (Guerra et al., 2004). However, dissemination of sul1 and sul2 is reported more often than sul3 (Antunes et al., 2005; Infante et al., 2005; Byrne-Bailey et al., 2009; Kozak et al., 2009; Beutlich et al., 2010). The aim of this study was to investigate the dissemination of sul genes (sul1, sul2, and sul3) among Salmonella spp. isolated from retail food in Poland.

MA ˛ KA ET AL.

pretive criteria of Clinical and Laboratory Standards Institute (CLSI) were used, due to the lack of the European Committee on Antimicrobial Susceptibility Testing (EUCAST) interpretive criteria for sulfamethoxazole: Resistant was defined as MIC ‡ 512 lg/mL and susceptible as £ 256 lg/mL (CLSI, 2012). DNA isolation

Genomic DNA was isolated using the boiling technique. Briefly, three to five well-isolated colonies from a Plate Count Agar (Biomerieux) plate were suspended in 20 lL of 0.25% sodium dodecyl sulfate and 0.05% NaOH. After incubation for 20 min at 95C, 180 lL of distilled cold water was added. Samples were centrifuged at 13,000 · g for 3 min. The resulting supernatants were used as DNA templates in the polymerase chain reaction (PCR) mixture. Plasmid isolation

Plasmids were isolated using a commercial kit for the isolation of low and medium copy number large-plasmid DNA (Plasmid Mini AX; A&A Biotechnology) according to the manufacturer’s instructions. Isolates were subjected to electrophoresis on 0.6% agarose gel (SeaKem Gold Agarose; Lonza). The reference plasmids were obtained from the strains of E. coli V517 (Wang et al., 2003) and Salmonella Oranienburg 32/01 (Gierczyn´ski et al., 2003). PCR amplification

Materials and Methods

Amplification of sul1, sul2, sul3, and intI was performed for all resistant Salmonella spp. DNA isolated from sulfonamideresistant E. coli 6.1 and Aeromonas spp. 6.8 (previously characterized in the Department of Applied Microbiology, Institute of Microbiology, Faculty of Biology, University of Warsaw) was used as a positive control.

Collection of isolates

Analysis of sulfonamides resistance

A total of 84 sulfonamides-resistant Salmonella spp. isolates were collected in 2008 and 2013. Isolates were derived from retail foods in Poland, as previously described (Ma˛ka et al., 2014). Isolates were collected by Sanitary and Epidemiological Stations in the course of an Official Control and Monitoring Program. The strains were isolated from retail products sampled according to PN-EN ISO 6579:2003/ A1:2007 ‘‘Horizontal method for the detection of Salmonella spp.’’ Tested samples included meat products (poultry, pork, beef, and pork-beef) and other products (confectionery products, eggs, fruits, vegetables, spices, and other). Samples covered both ready-to-eat products and products requiring further processing (e.g., cooking).

Genes were screened by one multiplex PCR amplification for all genes (intI, sul1, sul2, and sul3) (Table 1). These methods have already been successfully implemented in our laboratory (i.e., specific conditions of PCR reactions were established by the Department of Applied Microbiology, Institute of Microbiology, Faculty of Biology, University of Warsaw). Positive and negative controls were included for all reactions. The PCR mixture contained 2.5 lL of 10 · concentration Dream Taq buffer (containing 1.5 mM MgCl2), 4.0 lL of dNTP mix (2 mM), 0.25 lL Dream Taq polymerase (5 U/ lL), 1 lL of template DNA, 1.25 lL of each intI, sul1, and sul2 primers (10 lM), 2.5 lL of sul3 primers, and 4.75 lL of sterile Milli-Q water. Amplification was carried out in a T-Gradient (Biometra) thermocycler using the following reaction conditions: heating at 94C for 5 min, followed by 30 cycles of 94C for 30 s, 68C for 25 s, 72C for 1 min, and the final elongation at 72C for 10 min. The amplification products were identified by their size using electrophoresis on a 2.0% agarose gel (Prona agarose) with Midori Green DNA Stain (Nippon Genetics) at 100 V for 60 min.

Antimicrobial susceptibility tests and minimal inhibitory concentration (MIC) values

Resistant isolates were tested for MIC values (E-test– sulfamethoxazole; Biomerieux). Individual colonies were suspended in saline to a density equal to a 0.5 McFarland turbidity standard, measured using a densitometer (DEN 1-B Biosan). Each cell suspension was spread over the entire surface of the plate by swabbing in three directions, and the antibiotic discs or E-test were applied. The plates were then incubated at 35C for 16–20 h. Quality control tests were performed using E. coli ATCC 25922. The following inter-

Statistical analysis

Fisher’s exact test was used to determine the significance of the observed differences. The level of significance p = 0.05

DISSEMINATION OF SUL GENES AMONG SALMONELLA IN POLAND

385

Table 1. Primers Used for the Identification of Sulfonamide Resistance Genes in Multiplex Polymerase Chain Reactions (PCRs) Gene Primer intI sul1 sul2 sul3

IntF IntB Sul1-F Sul1-B Sul2-F Sul2-B Sul3-F Sul3-B

Sequence (5¢-3¢)

Size of PCR-amplified product (bp)

Reference

GCC ACTGCGCCGTTACCACC GGCCGAGCAGATCCTGCACG CGGCGTGGGCTACCTGAACG GCCGATCGCGTGAAGTTCCG GCGCTCAAGGCAGATGGCAT GCGTTTGATACCGGCACCCGT CAGATAAGGCAATTGAGCATGCTCTGC AGAATGATTTCCGTGACACTGCAATCATT

898

Kerrn et al., 2002

433

Kerrn et al., 2002

293

Kerrn et al., 2002

596

Wu et al., 2010

cassette(s), which include a functional sulfonamide resistance gene, sul1 (Stokes and Hall, 1989). Although the class 1 integrons are in and of themselves not mobile, they are frequently located on plasmids and transposons, which further increases the spread of the gene cassettes (Fluit and Schmitz, 1999; Liebert et al., 1999; An Expert Report, 2006). The presence of sul3 gene is least frequently reported by the authors. Statistically significant differences were observed, when assessing the distribution of sul genes among different Salmonella spp. serotypes (Table 2). The comparison was limited to Salmonella serotypes Infantis, Typhimurium, Newport, and Enteritidis due to the small number of isolates. The frequency of detection of sul1 and intI genes among Salmonella Infantis was higher in comparison to Salmonella serotypes Typhimurium and Enteritidis. Other differences in the distribution of sul genes between Salmonella serotypes included higher frequency of the sul2 gene in the isolates of Salmonella serotypes Typhimurium and Newport compared to other serotypes. In addition, most of Salmonella Enteritidis isolates did not carry any of the genes tested. Statistically significant differences were observed when comparing the distribution of sul1 and sul2 genes among isolates of different origin (Table 3). Salmonella spp. isolated from food of poultry origin were more frequently sul1-

was assumed for all analyses. OpenEpi 2.3.1 (http:// openepi.com) software was used for calculations. Results and Discussion Prevalence of intI and sul genes

Among 84 sulfonamides-resistant isolates, 89.3% (75) were isolated from meat products. MIC of all isolates was ‡ 1024 lg/mL. All 33 intI-positive isolates were also sul1 positive. In total, 44.0% (37/84) isolates carried the sul1 gene, 46.4% (39/84) were sul2 positive, while the sul3 gene was not detected in any of the sulfonamide-resistant isolates tested. Three of 84 (3.6%) of resistant Salmonella spp. contained both sul1 and sul2 as well as the intI gene. Eleven of 84 (13.1%) sulfonamide-resistant isolates were negative for all sul genes. This might suggest that the resistance to sulfonamides was associated with a different mechanism in those strains. It is known that the resistance to sulfonamides may sometimes be associated with mutations in the chromosomal DHPS gene (folP) (Swedberg et al., 1993). Frequent detection of sul1 and intI genes in our study is in compliance with the results of other authors. The sul1 gene is predominantly associated with class 1 integrons (sometimes together with other resistance genes), while sul2 is usually located on small plasmids (Sko¨ld, 2001). The class 1 integrons possess gene

Table 2. Distribution of sul and intI Genes Among Salmonella Serotypes Serotype Salmonella Infantis Salmonella Typhimurium Salmonella Newport Salmonella Enteritidis Salmonella Saintpaul Salmonella Kentucky Salmonella Kottbus Salmonella Chester Salmonella Sandiego Salmonella Eko Salmonella Derby Salmonella Virchow Salmonella Tshongue Salmonella Saintpaul monophasic isolates S. enterica subsp. entericaa Total a

intI + sul1

int + sul1 + sul2

sul1

sul2

None

Total

18 6 0 1 0 2 0 2 0 0 0 0 0 0 0 1 30

0 0 0 0 1 0 0 0 0 1 1 0 0 0 0 0 3

0 0 0 0 1 0 0 0 2 0 0 0 0 1 0 0 4

0 13 11 0 0 0 1 0 0 0 0 1 1 0 7 2 36

2 0 3 4 0 0 1 0 0 0 0 0 0 0 0 1 11

20 19 14 5 2 2 2 2 2 1 1 1 1 1 7 4 84

Unidentified serotypes of Salmonella spp.

386

MA ˛ KA ET AL.

Table 3. Distribution of sul Genes in Salmonella spp. Isolated from Different Sources Food origin

sul1

sul2

sul1 + sul2

None

Poultry Pork Mixed meat Nonmeata

24 3 4 3

14 13 8 1

1 0 2 0

3 0 3 5

a

Vegetables, spices, confectionery products.

positive compared to pork products, while isolates of pork origin more often contained sul2 compared to food of poultry origin. Despite the relatively low number of ‘‘nonmeat’’ isolates, there was a significant difference recorded in the frequency of sul genes in comparison to meat products (poultry, pork, and mixed meat). Most of the ‘‘meat’’ isolates contained sul1 and/or sul2 (69/75), while 5 of 9 Salmonella spp. isolated from foods other than meat did not harbor any of them. Table 4 presents results obtained from Salmonella spp. strains isolated from ready-to-eat products. Three isolates did not carry any of the tested genes (Salmonella serotypes Enteritidis and Newport, and Salmonella enterica subsp. enterica), four were intI, sul1–positive, six were sul2-positive, and one isolate (Salmonella Saintpaul) carried intI, sul1, and sul2 genes. It confirms additional risk associated with Salmonella spp. in food (i.e., resistant genes). Antunes et al. (2005) conducted a similar study in Portugal, even though the isolates apart from food were also derived from clinical laboratories. Of 200 (16.9% of test isolates) sulfonamide-resistant isolates, 152 (76%) were positive for sul1, 74 (37%) for sul2, and 14 (7%) for sul3 gene. More than 1 gene coding for sulfonamide resistance was present in 34 isolates: sul1 and sul2 in 24; sul1 and sul3 in 4; and sul1, sul2, and sul3 in 6. The frequency of the sul1 gene was more than twice higher compared to sul2. This is in contrast to our result, where the prevalence of sul1 and sul2 genes was comparable. Additionally, as opposed to the study of Antunes et al. (2005), we have not detected the sul3 gene. Of Salmonella enterica strains isolated from humans and animals in the United Kingdom, 127 were resistant to sulfadiazine. MIC of sulfadiazine against strains harboring sul1 and sul2 genes amounted to > 2048 mg/L. Seven sulfadia-

zine-resistant isolates did not contain sul1 or sul2 genes (Randall et al., 2004). Nine of 110 Salmonella spp. isolated from retail meats in Canada were resistant to sulfonamides (sulfisoxazole) (i.e., lower level of resistance when compared to our results). The sul3 gene was detected in a single pork isolate, 5 isolates contained sul1, and 3 of them contained the sul3 gene (Aslam et al., 2012). Kozak et al. (2009) assessed the distribution of sul genes in S. enterica isolates in pigs and chickens in Canada between 2003 and 2005. They found that 76.9% of Salmonella isolates contained the sul1 gene, 10.7% harbored sul2, 2.1% were sul3-positive, and 1.3% of sulfonamide-resistant Salmonella isolates did not contained any of the sul genes. Certain isolates harbored two different sul genes: sul1 and sul2 (3.0%), and sul2 and sul3 (6.0%). The multidrug-resistant Salmonella enterica isolated in the United States and Canada from various sources (animals, retail meats, and humans) contained sul1 (26/56) and sul2 genes (23/56) (Glenn et al., 2013). Taking into account food isolates, food of animal origin is a main source of Salmonella strains carrying sul genes. This is consistent with our results, as only nine isolates were of different origin than meat. However, resistance genes present in bacteria of animal origin may be transferred to other environments. For example, manuring of arable soils may stimulate the spread of resistance genes (including sul genes). The results obtained by Heuer and Smalla (2007) suggested that the manure from treated pigs enhanced the spread of antibiotic resistance in bacterial communities of the soil. Sulfonamides used in agriculture, aquaculture, and veterinary and as well as human medicines may be released to the environment with their degradation products. Therefore, they may be found in dung, manure, surface water, and groundwater (Sarmah et al., 2006; Sukul and Spiteller, 2006). Persistence of sulfonamide resistance may be the result not only of the antimicrobial compounds applied in veterinary practice, but also the absence of selection pressure, as it was, for example, demonstrated for the plasmids harboring sul2, indicating that not all sulfonamide-resistant determinants exert a fitness cost (Enne et al., 2001, 2004; Grave et al., 2010).

Table 4. Distribution of intI and sul Genes in Salmonella spp. Isolated from Ready-to-Eat Products Food origin Cream cake Wafer with custard Rum cake with custard Salad with black cabbage Black pepper Alfalfa Poultry product Luncheon meat Turkey luncheon meat Roast Sausage Stuffed bacon Pork roulade Bacon

Isolate Salmonella Salmonella Salmonella Salmonella Salmonella Salmonella Salmonella Salmonella Salmonella Salmonella Salmonella Salmonella Salmonella Salmonella

Typhimurium Enteritidis Enteritidis Typhimurium Newport enterica subsp. enterica Saintpaul Infantis Virchow Typhimurium enterica subsp. enterica Typhimurium Typhimurium Typhimurium

intI

sul1

sul2

sul3

+ + + + + -

+ + + + + -

+ + + + + + +

-

DISSEMINATION OF SUL GENES AMONG SALMONELLA IN POLAND Plasmids detection

Most of the sulfonamide-resistant Salmonella spp. harbored plasmids, as only eight isolates did not contain any plasmid according to the method described in the Materials and Methods section (monophasic Salmonella enterica subsp. enterica 1,4,[5],12:i:-, Salmonella Eko, three isolates of Salmonella serotypes Infantis, Tshongue, Saintpaul, and unidentified Salmonella enterica subsp. enterica). Two isolates without plasmids did not carry any resistance genes. Thirty-nine isolates contained plasmids of size ‡ 90 kb. Generally, the size of plasmids varied from approximately 2 kb to ‡ 90 kb. Although high-molecular-weight plasmids are often attributed to virulence and antibiotic resistance (Rychlik et al., 2006), we found no correlation between plasmid size and the presence of sul genes. Furthermore, sul1, sul2, and intI genes were detected in the isolates that did not carry plasmids, which may suggest that these genes were located on the chromosome (Van et al., 2007). The possibility of carrying sul genes on the chromosomal DNA has been previously reported by various authors. For example, Beutlich et al. (2011) investigated antimicrobial resistance in S. enterica positive for the Salmonella Genomic Island 1(SGI1). The authors found that several of the SGI-1-positive Salmonella isolates did not harbor plasmids but were resistant to sulfonamides and carried sul1 genes within SGI1, located on the chromosome. Moreover, sul1 is usually located within the class 1 integron, which can integrate with SGI1. The best-known cluster of resistance genes in salmonellae is SGI1 in the chromosome of Salmonella Typhimurium DT104 (Miriagou et al., 2006; Frye et al., 2013). The results of Hauser et al. (2010) indicated that part of the plasmid-negative isolates were sul2-positive. Overall, 27 of 61 S. enterica serovar 4, [5],12:i:-harbored at least 1 plasmid, while most of them carried the sul2 gene. The sequence sul2strA-strB was also identified as part of the complex structures, located either on the chromosome of Salmonella Typhimurium DT193 or IncI plasmid detected in Salmonella Enteritidis, which showed a high level of structural similarity (Daly et al., 2005). Shahada et al. (2011) reported the identification of the floR region located on chromosomes of three examined isolates of Salmonella Typhimurium. The floR region contained resistance genes sul2, strA, strB, tet(A), and floR mediated resistance to sulfonamides, streptomycin, tetracyclines, and chloramphenicol/florfenicol, respectively. Thong and Modarressi (2011) argued in their study that the majority of resistant Salmonella spp. isolates likely contained resistance elements other than integrons. These authors found among multidrug-resistant Salmonella spp., no class 2 or class 3 integrons and less than one third (28.8%) of the isolates harbored class 1 integrons that were mostly located on plasmids. Van et al. (2007) reported that all of the 23 isolates of antibiotic-resistant Salmonella spp. contained plasmids ranging in size from < 8 kb to > 165 kb. Thirty-five percent of the Salmonella spp. isolates contained plasmids of size > 95 kb, and some of the isolates had 2 large plasmids. This study also found that the recipients could acquire plasmids from donors during conjugation, regardless of whether the recipients harbored their own plasmids or not. This observation additionally showed that the process of conjugation

387

could easily occur among the bacterial population. In general, Salmonella spp. carrying plasmids can transfer resistance genes via conjugation to other Salmonella spp. as well as other bacterial species (Ferguson et al., 2002; Van et al., 2007; Akiyama et al., 2011). Conclusions

Our results show that most of the sulfonamide-resistant Salmonella spp. strains were isolated from meat products. In total, 86.9% of the sulfonamide-resistant Salmonella spp. tested harbored at least 1 sul gene. Among 84 isolates, 44.0% (37) carried the sul1 gene, 46.4% (39) were sul2positive, while the sul3 gene was not detected in any of the sulfonamide-resistant isolates studied. Similar antimicrobial resistance does not necessarily imply similar resistance genes. Isolates may acquire sulfonamide resistance genes as a result of the use of these antimicrobial compounds in veterinary medicine; however, it was demonstrated by other authors that in the absence of selection pressure, the resistance can persist for extended periods of time. Despite the low number of nonmeat samples, the differences between dissemination of sul genes in comparison to meat samples were visible. Sulfonamides are not first-line treatment for salmonellosis; however, sul genes are usually associated with mobile genetic elements such as plasmids; thus, the presence of sul genes in studied isolates may indicate the presence of other resistance genes. Although a minority of tested isolates originated from ready-to-eat food and most tested Salmonella spp. were isolated from food intended to be cooked, it does not lessen the significance of the findings, especially taking into account the probability of undercooking and cross-contamination. Given the presence of integrons and plasmids in isolates tested, there is a probability of further dissemination of sul genes among Salmonella spp. or other bacterial species, which may pose a serious threat to the health and life of patients. These findings indicate the need for further monitoring of resistance not only to sulfonamides and sul genes but also to other antimicrobials. Acknowledgments

The authors thank Dr. D. Korsak (Department of Applied Microbiology, Institute of Microbiology, Faculty of Biology, University of Warsaw) for providing the data for PCR amplification of sul genes. This work was supported by a grant from the National Center of Science awarded on the basis of the decision DEC-2011/01/N/NZ9/00197. Disclosure Statement

No competing financial interests exist. References

Akiyama T, Khan AA, Cheng CM, Stefanova R. Molecular characterization of Salmonella enterica serovar Saintpaul isolated from imported seafood, pepper, environmental and clinical samples. Food Microbiol 2011;28:1124–1128. An Expert Report. Antimicrobial resistance: Implications for the food system. Compr Rev Food Sci Food Safety 2006;5: 71–137.

388

Antunes P, Machado J, Sousa JC, Peixe L. Dissemination of sulfonamide resistance genes (sul1, sul2 and sul3) in Portuguese Salmonella enterica strains and relation with integrons. Antimicrob Agents Chemother 2005;49:836–839. Aslam M, Checkley S, Avery B, Chalmers G, Bohaychuk V, Gensler G, Reid-Smith R, Boerlin P. Phenotypic and genetic characterization of antimicrobial resistance in Salmonella serovars isolated from retail meats in Alberta, Canada. Food Microbiol 2012;32:110–117. Beutlich J, Rodrı´guez I, Schroeter A, Ka¨sbohrer A, Helmuth R, Guerra B. A predominant multidrug-resistant Salmonella enterica serovar Saintpaul clonal line in German turkey and related food products. Appl Environ Microb 2010;76:3657– 3667. Beutlich J, Jahn S, Malorny B, Hauser E, Hu¨hn S, Schroeter A, Rodicio MR, Appel B, Threlfall J, Mevius D, Helmuth R, Guerra B. Antimicrobial resistance and virulence determinants in European Salmonella genomic island 1-positive Salmonella enterica isolates from different origins. Appl Environ Microb 2011;77:5655–5664. Byrne-Bailey KG, Gaze WH, Kay P, Boxall ABA, Hawkey PM, Wellington EMH. Prevalence of sulfonamide resistance genes in bacterial isolates from manured agricultural soils and pig slurry in the United Kingdom. Antimicrob Agents Chemother 2009;53:696–702. [CLSI] Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Second Informational Supplement. CLSI Document M100-S22. Wayne, PA: CLSI, 2012. Czarkowski MP, Cieleba˛k E, Kondej B, Staszewska E. Infectious Diseases and Poisonings in Poland in 2012. Report prepared by National Institute of Public Health—National Institute of Hygiene, Department of Epidemiology and Chief Sanitary Inspectorate, Department for Communicable Disease and Infection Prevention and Control. Warsaw, Poland, 2013. Daly M, Villa L, Pezzella C, Fanning S, Carattoli A. Comparison of multidrug resistance gene regions between two geographically unrelated Salmonella serotypes. J Antimicrob Chemother 2005;55:558–561. ECDC/EMEA Joint Technical Report. The Bacterial Challenge: Time to React. A Call to Narrow the Gap Between Multidrug-Resistant Bacteria in the EU and the Development of New Antibacterial Agents. Stockholm, September 2009. [EFSA, ECDC] European Food Safety Authority, European Centre for Disease Prevention and Control. The European Union Summary Report on Trends and Sources of Zoonoses, Zoonotic Agents and Food-borne Outbreaks in 2012. EFSA J 2014;12:3547, 312 pp. Enne VI, Livermore DM, Stephens P, Hall LMC. Persistence of sulfonamide resistance in Escherichia coli in the UK despite national prescribing restriction. Lancet 2001;357:1325–1328. Enne VI, Bennett PM, Livermore DM, Hall LMC. Enhancement of host fitness by the sul2- coding plasmid p9123 in the absence of selective pressure. J Antimicrob Chemother 2004;53:958–963. Ferguson GC, Heinemann JA, Kennedy MA. Gene transfer between Salmonella enterica serovar Typhimurium inside epithelial cells. J Bacteriol 2002;184:2235–2242. Fluit AC, Schmitz FJ. Class 1 integrons, gene cassettes, mobility, and epidemiology. Eur J Clin Microbiol 1999;18:761–770. Frye JG, Jackson CR. Genetic mechanisms of antimicrobial resistance identified in Salmonella enterica, Escherichia coli, and Enteroccocus spp. isolated from U.S. food animals. Frontiers Microbiol 2013;4:135.

MA ˛ KA ET AL.

Gierczyn´ski R, Szych J, Cies´lik A, Rastawicki W, Jagielski M. The occurrence of the first two CTX-M-3 and TEM-1 producing isolates of Salmonella enterica serovar Oranienburg in Poland. Int J Antimicrob Agents 2003;21:497–499. Glenn LM, Lindsey RL, Folster JP, Pecic G, Boerlin P, Gilmour MW, Harbottle H, Zhao S, McDermott F, Fedorka-Cray P, Frye JG. Antimicrobial resistance genes in multidrug-resistant Salmonella enterica isolated from animals, retail meats, and humans in the United States and Canada. Microb Drug Resist 2013;19:175–184. Grave K, Torren-Edo J, Mackay D. Comparison of the sales of veterinary antibacterial agents between 10 European countries. Antimicrob Agents Chemother 2010;65:2037–2040. Guerra B, Soto S, Helmuth R, Mendoza MC. Characterization of a self-transferable plasmid from Salmonella enterica serotype Typhimurium clinical isolates carrying two integronborne gene cassettes together with virulence and drug resistance genes. Antimicrob Agents Chemother 2002;46: 2977–2981. Guerra B, Junker E, Helmuth R. Incidence of the recently described sulfonamide resistance gene sul3 among German Salmonella enterica strains isolated from livestock and food. Antimicrob Agents Chemother 2004;48:2712–2715. Hauser E, Tietze E, Helmuth R, Junker E, Blank K, Prager R, Rabsch W, Appel B, Fruth A, Malorny B. Pork contaminated with Salmonella enterica serovar 4,[5],12:i:-, an emerging health risk for humans. Appl Environ Microb 2010;76:4601– 4610. Heuer H, Smalla K. Manure and sulfadiazine synergistically increased bacterial antibiotic resistance in soil over at least two months. Environ Microbiol 2007;9:657–666. Infante B, Grape M, Larsson M, Kristiansson C, Pallecchi L, Rossolini GM, Kronvall G. Acquired sulphonamide resistance genes in faecal Escherichia coli from healthy children in Bolivia and Peru. Int J Antimicrob Agents 2005;25:308–312. Kerrn MB, Klemmensen T, Frimodt-Møller N, Espersen F. Susceptibility of Danish Escherichia coli strains isolated from urinary tract infections and bacteraemia, and distribution of sul genes conferring sulphonamide resistance. J Antimicrob Chemother 2002;50:513–516. Kozak GK, Pearl DL, Parkman J, Reid-Smith RJ, Deckert A, Boerlin P. Distribution of sulfonamide resistance genes in Escherichia coli and Salmonella isolates from swine and chickens at abattoirs in Ontario and Que´bec, Canada. Appl Environ Microb 2009;75:5999–6001. Liebert CA, Hall RM, Summers AO. Transposon Tn21, flagship of the floating genome. Microbiol Mol Biol Rev 1999;63: 507–522. Ma˛ka q, Mac´kiw E, S´cie_zyn´ska H, Paw1owska K, Popowska M. Antimicrobial susceptibility of Salmonella strains isolated from retail meat products in Poland between 2008 and 2012. Food Control 2014;36:199–204. Miriagou V, Carattoli A, Fanning S. Antimicrobial resistance islands: Resistance gene clusters in Salmonella chromosome and plasmids. Microbes Infect 2006;8:1923–1930. Perreten V, Boerlin P. A new sulfonamide resistance Gene (sul3) in Escherichia coli is widespread in the pig population of Switzerland. Antimicrob Agents Chemother 2003;47: 1169–1172. Phillips I, Casewell M, Cox T, de Groot B, Fiis C, Jones R, Nightingale C, Preston R, Waddell J. Does the use of antibiotics in food animals pose a risk to human health? A critical review of published data. J Antimicrob Chemother 2004; 53:28–52.

DISSEMINATION OF SUL GENES AMONG SALMONELLA IN POLAND

Popowska M, Krawczyk-Balska A. Broad-host-range IncP-1 plasmids and their resistance potential. Front Microbiol 2013;4:44. Randall LP, Cooles SW, Osborn MK, Piddock LJV, Woodward MJ. Antibiotic resistance genes, integrons and multiple antibiotic resistance in thirty-five serotypes of Salmonella enterica isolated from humans and animals in the UK. J Antimicrob Chemother 2004;53:208–216. Rychlik I, Gregorova D, Hradecka H. Distribution and function of plasmids in Salmonella enterica. Vet Microbiol 2006;112: 1–10. Sarmah AK, Meyer MT, Boxall ABA. A global perspective on the use, sales, exposure pathways, occurrence, fade and effects of veterinary antibiotics (VAs) in the environment. Chemosphere 2006;65:725–759. Shahada F, Sekizuka T, Kuroda M, Kusumoto M, Ohishi D, Matsumoto A, Okazaki H, Tanaka K, Uchida I, Izumiya H, Watanabe H, Tamamura Y, Iwata T, Akiba M. Characterization of Salmonella enterica serovar Typhimurium isolates harboring a chromosomally encoded CMY-2 beta-lactamase gene located on a multidrug resistance genomic island. Antimicrob Agents Chemother 2011;55:4114–4121. Sko¨ld O. Sulfonamide resistance: Mechanisms and trends. Drug Resist Update 2000;3:155–160. Sko¨ld O. Resistance to trimethoprim and sulfonamides. Vet Res 2001;32:261–273. Stokes HW, Hall RM. A novel family of potentially mobile DNA elements encoding site-specific gene-integration functions: Integrons. Mol Microbiol 1989;3:1669–1683. Sukul P, Spiteller M. Sulfonamides in the environment as veterinary drugs. Rev Environ Contam Toxicol 2006;187:67–101.

389

Swedberg G, Ferme´r C, Sko¨ld O. Point mutations in the dihydropteroate synthase gene causing sulfonamide resistance. Adv Exp Med Biol 1993;338:555–558. Thomas CM, Nielsen KM. Mechanisms of, and barriers to, horizontal gene transfer between bacteria. Nat Rev Microbiol 2005;3:711–721. Thong KL, Modarressi S. Antimicrobial resistant genes associated with Salmonella from retail meats and street foods. Food Res Int 2011;44:2641–2646. Van TTH, Moutafis G, Tran LT, Coloe PJ. Antibiotic resistance in food-borne bacterial contaminants in Vietnam. Appl Environ Microb 2007;73:7906–7911. Wang M, Tran JH, Jacoby GA, Zhang Y, Wang F, Hooper DC. Plasmid-mediated quinolone resistance in clinical isolates of Escherichia coli from Shanghai, China. Antimicrob Agents Chemother 2003;47:2242–2248. Wu S, Dalsgaard A, Hammerum AM, Porsbo LJ, Jensen LB. Prevalence and characterization of plasmids carrying sulfonamide resistance genes among Escherichia coli from pigs, pig carcasses and human. Acta Vet Scand 2010;52:47.

Address correspondence to: qukasz Ma˛ka, MSc Laboratory of Food Microbiology Department of Food Safety National Institute of Public Health— National Institute of Hygiene Chocimska 24 00-791 Warsaw, Poland E-mail: [email protected]