Resolution of liver fibrosis requires myeloid cell-driven sinusoidal angiogenesis   Chahrazade Kantari-Mimoun1, Magali Castells1, Ralph Klose1, Anna-Katharina Meinecke2, Ursula J. Lemberger3, Pierre-Emmanuel Rautou1,4, Hélène PinotRoussel1,5, Cécile Badoual1,5, Katrin Schrödter2, Christoph H. Österreicher3, Joachim Fandrey2, Christian Stockmann1

1

Institut National de la Santé et de la Recherche Médicale (INSERM), Unit 970, Paris

Cardiovascular

Research

Center,

Paris,

France;

2

Institut

für

Universitätsklinikum Essen, Universität Duisburg-Essen, Germany;

Physiologie, 3

Institute of

Pharmacology, Center for Physiology and Pharmacology Medical University of Vienna, Austria; 4  DHU Unity, Pôle des Maladies de l’Appareil Digestif, Service d'Hépatologie, Centre de Référence des Maladies Vasculaires du Foie, Hôpital Beaujon,

AP-HP,

Clichy,

France;

5

Service

d'Anatomie

et

Pathologie,

Hôpital Européen Georges Pompidou, APHP, Paris, France;

Keywords: Vascular

Endothelial

Growth

Factor,

scar-associated

macrophage,

vascular

remodeling, matrix metalloproteinases, fibrolysis

This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1002/hep.27635 This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

  Contact Information: Christian Stockmann, PARCC, Paris - Centre de recherche Cardiovasculaire à l’HEGP, Inserm - UMR 970, 56 rue Leblanc, 75015 Paris, France. Email: [email protected] Phone: +33153988011 Fax: +33153987953 Abbreviations: VEGF Vascular Endothelial Growth Factor ECM extracellular matrix MMPs matrix metalloproteinases TIMP tissue inhibitor of metalloproteinases, VEGFR2 VEGF-Receptor 2 SMA alpha-smooth muscle actin CCL4 carbontetrachloride PDGFR-β Platelet-derived Growth Factor receptor beta DEN diethylnitrosamine TAA thioacetamide CXCL9 chemokine (C-X-C motif) ligand 9 BDL bile duct ligation

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

Financial Support: C.S is funded by the Deutsche Forschungsgemeinschaft (STO/787 3-1 and GRK 1739/1 – project No. 7); Institut National de la Santé et de la Recherche Médicale (INSERM), (ATIP-AVENIR program, Plan Cancer), Mairie de Paris, program "Emergences".

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

Abstract   Angiogenesis is a key feature of liver fibrosis. Although, sinusoidal remodeling is believed to contribute to fibrogenesis, the impact of sinusoidal angiogenesis on the resolution of liver fibrosis remains undefined. Myeloid cells, particularly macrophages constantly infiltrate the fibrotic liver and can profoundly contribute to remodeling of liver sinusoids. We observe that the development of fibrosis is associated with decreased hepatic Vascular Endothelial Growth Factor (VEGF) expression as well as sinusoidal rarefication of the fibrotic scar. In contrast, the resolution of fibrosis is characterized by a rise in hepatic VEGF levels and revascularization of the fibrotic tissue. Genetic ablation of VEGF in myeloid cells or pharmacological inhibition of VEGF receptor 2 signaling prevents this angiogenic response and the resolution of liver fibrosis. We observe increased expression of Matrix Metalloproteases as well as decreased expression of Tissue inhibitor of metalloproteases confined to sinusoidal endothelial cells in response to myeloid cell VEGF. Remarkably, reintroduction of myeloid cell-derived VEGF upon recovery restores collagenolytic acitivity and the resolution of fibrosis. We identify myeloid cell-derived VEGF as a critical regulator extracellular matrix degradation by liver endothelial cells, thereby unmasking an unanticipated link between angiogenesis and the resolution of fibrosis.

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

In response to chronic liver injury activated myofibroblasts deposit collagen and other extracellular matrix (ECM) components resulting in scar formation and organ fibrosis (1, 2). However, clinical observations and experimental models suggest that liver fibrosis is a dynamic bidirectional process with the capacity for recovery even at advanced stages. Yet, underlying biological mechanisms for the resolution of fibrosis remain insufficiently defined (3). Fibrosis and excessive ECM deposition are believed to be a consequence of insufficient ECM degradation activity (4). Whether net ECM accumulation or degradation occurs depends mostly on the balance between a family of zincdependent matrix metalloproteinases (MMPs) and their potent inhibitors (tissue inhibitor of metalloproteinases, (TIMP) (5-7). Therefore, approaches that promote ECM degradation by tipping over the MMP/TIMP balance in favor of MMPs represent a promising therapeutic avenue (8). In the fibrotic liver, myeloid cells and particularly macrophages constantly infiltrate the fibrotic scar. Scar-associated macrophages have been shown to play a dichothomous role in the context of liver fibrosis as they play a profibrogenic role during the development of fibrosis whereas macrophage MMP expression crucially contributes to the resolution of fibrosis upon recovery from liver injury (9). Besides their direct fibrolytic action, macrophages can release large amounts of the major angiogenic cytokine Vascular Endothelial Growth Factor A (VEGF) (10) and induce the formation of new blood vessels (11-13). Angiogenesis and sinusoidal remodeling are typical features of liver fibrosis (14, 15). Although the role of angiogeneis is debated quite controversially (14, 16, 17), pharmacological and experimental approaches to inhibit angiogenic signaling seem to rather slow the

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

development of fibrosis (14). In contrast, a recent study indicated that VEGF promotes fibrosis resolution by regulating vascular permeability and trafficking of matrix-degrading macrophages (18). The role of angiogenesis and sinusoidal remodeling for the resolution of liver fibrosis, however, remains largely unadressed. Therefore, we set out to analyze the role of myeloid cell-driven angiogenesis and vascular remodeling in the resolution of fibrosis by using targeted VEGF deletion in myeloid cells, (LysMCre/VEGF+f/+f mice) (11-13) in well-defined mouse models of liver fibrosis (9). Here we show that the fibrotic scar is characterized by vascular rarefication and that the resolution of fibrosis is associated with sinusoidal angiogenesis. However, genetic inactivation of VEGF in scar-infiltrating macrophages prevented this angiogenic response and abrogated the resolution of liver fibrosis. Furthermore, we show that the resolution of liver fibrosis is associated with increased expression of Matrix Metalloproteases (MMP)-2 and -14 as well as decreased expression of Tissue inhibitor of metalloproteases (TIMP)-1 and 2 in sinusoidal endothelium.

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

Experimental Procedures For the induction of hepatic fibrosis female mice were treated with CCl4 intraperitoneally (240 µl CCl4 suspended in olive oil per kg body weight three times a week a week) for 12 weeks. Control mice received i.p. injections of 100 µl olive oil. For Bile Duct Ligation (BDL), an upper-midline laparotomy incision was made in male mice, and the common bile duct was ligated with 6-0 silk suture (Unify sutures). All steps, excluding ligation of the bile duct, were performed for sham operations. In accordance with previous studies, we chose to analyze mice 12 days after BDL (19, 20). Additional experimental procedures can be found in the online supplement.

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

Results

The fibrotic scar in human livers is characterized by sinusoidal rarefication and low VEGF expression The impact of angiogenesis in the context of liver fibrosis is controversial. Nevertheless, most of the studies are in favor of the idea that the release of angiogenic cytokines and subsequent sinusoidal remodeling promote the fibrogenic process (14, 16, 17). Given the existing confusion regarding the role of angiogenesis and vascular remodeling in liver fibrosis, we first determined the distribution of liver sinusoids on human surgical biopsies of fibrotic (F3 Metavir classification) and cirrhotic

livers

(F4)

versus

non-fibrotic

liver

samples

by

simultaneous

immunofluorescence for VEGF-Receptor 2 (VEGFR2-) expressing sinusoids and the myofibroblast marker alpha-smooth muscle actin (SMA) (Figure 1A). Consistent with previous reports we observed overall increased vessel density in fibrotic and cirrhotic livers (Figure 1A and B). However, this increase in VEGFR2(+) vessels was localized to the perifibrotic regions whereas sinusoids were almost absent from the scar in fibrotic and even more in cirrhotic livers (Figure 1C). Next, we anayzed the spatial expression pattern of the major angiogenic cytokine VEGF in this context by simultaneous immunofluorescence for VEGF and SMA. As shown in Figure 1D the overall VEGF postive area decreases with progression of the scar area in fibrotic and cirrhotic livers. Most importantly, the fibrotic scar itself shows low VEGF expression compared the surrounding perifibrotic or healthy liver parenchyma (Figure 1D).

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

Ablation of VEGF specifically in scar-infiltrating myeloid cells prevents the resolution of fibrosis Myeloid cells and particularly macrophages constantly infiltrate the liver scar tissue and have been shown to be pivotal in regulating the fibrotic process (3, 9). In addition, studies on tumor angiogenesis have revealed that myeloid cells crucially mediate vascular remodeling by releasing the angiogenic cytokine VEGF-A (11-13). Hence we reasoned that myeloid cells might represent an important source of VEGF within fibrotic scars and decided to investigate the effect of a targeted deletion of VEGF-A in myeloid cells using a loxP-flanked Vegfa allele crossed to the lysozyme M promoter-driven Cre recombinase (13) on angiogenesis and fibrogenesis in a mouse model of cholestatic liver fibrosis after bile duct ligation (BDL) as well as in a carbontetrachloride- (CCL4) induced mouse model of reversible liver fibrosis. As shown in Figure 2 A, visualization of fibrotic scars by sirius red staining on liver sections reveals that wildtype (WT) and mutant (Mut) mice with a myeloid cellspecific deletion of VEGF-A develop liver fibrosis to a similar degree after BDL. This was further substantiated by quantitative analysis of the sirius red-positive area as well as by determination of the hydroxy-proline content of WT and Mut livers (Figure 2 B and C). In line with this, WT and Mut mice show comparable levels of liver fibrosis after 12 weeks of CCL4 challenge (Figure 2 D, E and F). However, whereas livers from WT mice fully recover and reverse fibrotic changes after an additional 4 week period without CCL4 treatment (recovery), Mut mice show persistence of fibrotic scars and completely fail to resolve fibrosis (Figure 2 D, E and F). Likewise, pharmacological inhibition of VEGF receptor 2 signaling by means of the small molecule

inhibitor

compound

SU5416

upon

recovery

prevents

This article is protected by copyright. All rights reserved.

fibrolysis

   

HEP-14-1032.R1 

   

(Supplementary Figure 1A), suggesting involvement of VEGFR2 in the resolution of fibrosis. This indicates that VEGF delivered by scar-infiltrating myeloid cells upon recovery from chronic liver injury is indispensable for complete resolution of liver fibrosis.

Genetic targeting of myeloid cell-derived VEGF specifically prevents sinusoidal angiogenesis Next, we aimed to analyze VEGF expression throughout development and resolution of fibrosis after CCL4 treatment. Noteworthy, the development of liver fibrosis was associated with a drop in hepatic VEGF expression at the mRNA level (Figure 3A) as well as at the protein level (Figure 3 B) without any genotype-specific differences. Again, in analogy to our observation in human samples, the strongest VEGF expression was detected in the perifibrotic area (Supplementary Figure 1B). During recovery and resolution of fibrosis though, VEGF expression in the liver reaugments (Figure 3A and B), whereas the absence of myeloid cell-derived VEGF upon recovery prevents this rise of overall hepatic VEGF levels (Figure 3A and B). Thus, we concluded that particularly during the resolution of fibrosis, myeloid cells are a potent contributor to hepatic VEGF expression that can't be compensated for by other cell types. In order to determine to which extent fluctuations in VEGF levels translate into changes of the vascular phenotype, we performed a quantitative analysis of VEGFR2(+) sinusoidal vessels on liver sections from CCL4-treated WT and Mut mice. As depicted in Figure 3C, in WT mice the induction of fibrosis results in increased vascular density, whereas in the absence of myeloid cell VEGF this increase in vessel density is significantly diminished. However, this has no obvious effect on the

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

degree of liver fibrosis (Figure 2 D, E and F). Along with the regression of fibrosis, vascular density in WT livers decreases, suggesting a normalization of the vascular bed. In recovering Mut livers, however, despite rather low VEGF levels, we observe an increase in vessel density similar to the one in WT livers upon induction of fibrosis (Figure 3D), indicating a delayed angiogenic response. This is presumably due to compensatory action of other angiogenic factors in the absence of myeloid cellderived VEGF. Next, we wanted to determine the distribution of liver sinusoids in conjunction with the expansion and regression of the scar area. Therefore, we performed simultaneous detetection of sinusoidal vessels and the fibrotic scar by means of double immunofluorescence for VEGFR2 and SMA. In the BDL model, WT and Mut mice do not show obvious differences in angiogenesis (Supplementary Figure 3C) which is consistent with a recent publication (18). Noteworthy, the fibrotic scar itself seems to be devoid of VEGFR2+ sinusoids (Supplementary Figure 3C). In the CCL4 model, though, the rise in sinusoidal density in fibrotic WT livers is localized to the perifibrotic area, whereas the fibrotic scar is mostly devoid of sinusoids, suggesting sinusoidal rarification in this area (Figure 3C). Upon regression of the fibrotic scar, the fibrotic areas become revascularized, resulting in a more homogenous distribution of sinusoidal vessels, similar to what is found in control livers (Figure 3C). In contrast, in the absence of myeloid cell-derived VEGF, the scar persists and despite high sinusoid density in the perifibrotic region, sinusoids fail to infiltrate the fibrotic area (Figure 3C). Thus, the absence of VEGF expression in scarinfiltrating myeloid cells prevents the rise of hepatic VEGF levels upon recovery, the angiogenic response and sinusoidal remodeling in the fibrotic scar, resulting in a failure to resolve liver fibrosis.

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

Myeloid cell VEGF induces the expression matrix degrading enzymes in liver endothelial cells and promotes ECM breakdown. The resolution of fibrosis involves the breakdown of the ECM network by various proteases. Therefore, we wanted to test whether CCL4-challenged Mut mice fail to resolve fibrosis due to  the inability to degrade ECM components. To this end we performed an in situ zymography by incubating liver sections with fluorescein-labeled gelatin (DQ-gelatin™). This fluorogenic substrate yields a bright fluorescent signal upon proteolytic digestion and allows the in situ detection of ECM degradation and protease activity. Quantitative anlysis of the fluorescent signal revealed that protease activity in WT livers peaked during the recovery phase (Figure 4 A and B), consistent with the idea of enhanced ECM breakdown as a prerequisite for the resolution of fibrosis (Henderson and Iredale, 2007). In contrast, this increase in protease activity and ECM degradation was absent in liver sections upon ablation of VEGF in myeloid cells (Figure 4 A and B), suggesting that Mut mice are unable to sufficiently breakdown ECM in order to resolve fibrosis. Next, we wished to further unravel the mechanism behind this ECM degradation defect in the absence of myeloid cell-derived VEGF. The net ECM degradation activity is largely determined by the balance between matrix degrading MMPs and their inhibitors TIMPs (7). Hence, we analyzed the expression of several MMPs and TIMPs in whole livers as well as in different cell types that we isolated from WT and Mut livers at different time points by magnetic bead sorting. MMP and TIMP expression by macrophages has been shown to be crucial for ECM degradation during the resolution of fibrosis (7). Therefore, we wanted to analyze a potential autocrine effect of VEGF on macrophage MMP expression. Gene expression analysis for several MMPs and TIMPs in isolated liver macrophages

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

revealed high expression of some MMPs and TIMPs in comparison to whole liver, yet, without genotype-specific differences (Supplementary Figure 2). A recent study showed that VEGF promotes early macrophage-mediated matrix degradation after CCL4-challenge via the cytokine CXCL9 and elevated expression of MMP 13 (18). In analogy, we analyzed the degree of fibrosis (Supplementary Figure 3A). as well as the expression of CXCL9 and MMPs/TIMPs in whole livers from WT and Mut mice one week after cessation of CCL4-treatment in an isolated set of experiments (Supplementary Figure 3B and 3C). Interestingly, although CXCL9 and some MMPs show increased expression upon early recovery, we did not observe genotype specific differences (Supplementary Figure 3B and 3C Furthermore, the expression of MMP 9 and MMP 13, which are known to be crucial for macrophagedependent fibrolysis, was similar in isolated macrophages from WT and Mut livers after 1 week of recovery Supplementary Figure 3D. It was also suggested that VEGF is required for transendothelial migration of macrophages and the subsequent resolution of fibrosis after CCL4-challenge (18). Noteworthy, myeloid cell-specific deletion of VEGF did not result in an infiltration defect of scar associated macrophages (Supplementary Figure 4 and 5) or neutrophils (Supplementary Figure 6 and 7) after BDL or CCL4 challenge. In line with previous publications (11-13), this suggests that at least autocrine VEGF is dispensable for the infiltration of myeloid cells. VEGF has been implicated in hepatocyte proliferation and early liver regeneration (21, 22). Therefore, we wanted to investigate the effect of myeloid cell-derived VEGF on liver regeneration in the CCL4 model by analyzing the number of PCNA-positive proliferating hepatocytes in WT and Mut livers at different time points. However, we did not observe differences between genotypes (Supplementary Figure 8).

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

Next, we reasoned that myeloid cell VEGF-driven angiogenesis and infiltration of the scar by sinusoidal endothelial cells upon recovery might be linked to ECM degradation and the resolution of fibrosis. To test this hypothesis, we analyzed MMP and TIMP expression in isolated liver endothelial cells from WT and Mut livers at different time points by magnetic bead sorting. Remarkably, expression of MMP-2 and MMP-14 in endothelial cells was particularly high throughout the resolution phase, compared with other time points as well as with regard to whole liver expression levels (Figure 4C and D), whereas the expression of other MMPs in endothelial

cells

showed

no

significant

genotype-dependent

differences

(Supplementary Figure 9). This suggests that during the resolution of fibrosis liver endothelial cells reconstitute an important source for these MMPs. However, the absence of myeloid cell-derived VEGF resulted in a significantly reduced expression of MMP-2 and MMP-14 in endothelial cells (Figure 4C and 4D). Interestingly, immunohistochemical analysis of the proform of MMP-2 (pro MMP-2) on liver sections confirmed strong expression of pro MMP2 confined to the sinusoidal endothelium in WT mice during the resolution of fibrosis, whereas in Mut mice pro MMP-2 remained almost undetectable upon recovery (Supplementary Figure 10). Immunostaining for MMP-14 showed a more diffuse staining pattern with partial colocalization to the sinusoidal endothelium only in WT livers (Supplementary Figure 11). In contrast, the expression of the protease inhibitors TIMP-1 and TIMP-2 in the liver endothelium was increased during recovery in mice with a deletion of VEGF in myeloid cells compared to WT animals (Figure 4E and F). Immunohistochemistry showed that after 12 weeks of CCL4 treatment TIMP-1 staining was strongest in the fibrotic scar (Supplementary Figure 12) and double immunofluorescence confirmed that myofibroblasts are strongly TIMP-1-positive (Supplementary Figure 13). Upon

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

recovery, though, the sinusoidal endothelium was characterized by subtle TIMP-1 expression that persisted in Mut livers until endpoint. We concluded that in response to myeloid cell-derived VEGF the liver endothelium aquires a proresolution phenotype involving increased expression of MMP-2 and -14 as well as reduced expression of TIMP-1 and -2.

Reintroduction of Myeloid cell-delivered VEGF specifically upon recovery restores ECM breakdown and resolution of fibrosis. Although, the deletion of VEGF in myeloid cells had no obvious effects on the development of fibrosis, we wished to study the impact of myeloid cell VEGF exclusively on the resolution of fibrosis during the recovery phase. Macrophages within the fibrotic scar undergo continuous renewal resulting in a constant turnover of the macrophage population (9). We decided to take advantage of these infiltration dynamics by "switching" genotypes with regard to VEGF expression in myeloid cells after fibrosis had been developed and before the onset of the resolution phase (Figure 5A). For this purpose, we subjected CCL4-treated WT and Mut mice to whole body irradiation (10 Gy) and subsequent bone marrow transplantation (as depicted in Figure 5A). WT mice that developed liver fibrosis in the presence of myeloid cellderived VEGF were reconstituted with with bone marrow from myeloid cell VEGFdeficient Mut mice and therefore went through the recovery phase in the absence of myeloid cell-derived VEGF (WT/Mut, Figure 5A). Reintroduction of myeloid cell VEGF for the recovery phase was achieved by transplantation of WT bone marrow into Mut mice that developed fibrosis in the absence of myeloid cell-derived VEGF (Mut/WT, Figure 5A). The appropriate controls were carried out by transplanting WT

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

and Mut mice with bone marrow of the same genotype (WT/WT and Mut/Mut, Figure 5A). As shown in Figure 5B and C, reintroduction of myeloid cell VEGF upon recovery (Mut/WT) was sufficient to restore the resolution of fibrosis, whereas the absence of myeloid cell-derived VEGF exclusively during recovery (WT/Mut) resulted in a failure to resolve fibrosis. Consistently, this was reflected by impaired zymographic activity in the DQ-gelatin™ assay upon reconstitution with myeloid cell VEGF-deficient, Mut bone marrow (Figure 5D and E). In contrast, reintroduction of myeloid cell VEGF upon recovery (Mut/WT) restored protease activity and ECM breakdown (Figure 5D and E). Importantly, this was not due to quantitative differences in hepatic macrophages or neutrophils in any of the 4 treatment groups (Supplementary Figure 5A). Therefore, we wanted to determine whether this was associated with an altered MMP/TIMP balance by analyzing the expression of MMPs and TIMPs in endothelial cells isolated from bone marrow transplanted livers. Remarkably, reintroduction of myeloid cell-derived VEGF upon recovery (Mut/WT) increased expression of MMP-2 and MMP-14 in liver endothelium (Figure 5F), along with low expression of TIMP-1 and TIMP-2 remained (Figure 5F). Conversely, reconstitution with myeloid cell VEGF-deficient bone marrow (WT/Mut) lead to low expression of MMP-2 and MMP14 (Figure 5F) along with increased expression of TIMP-2 but not TIMP-1 in isolated liver endothelial cells (Figure 5F). This further suggests that myeloid cell-derived VEGF is required upon recovery to induce a proresolution phenotype in liver endothelial cells by tipping the balance to MMP over TIMP expression. Next we asked whether these differences in the endothelial MMP/TIMP balance translate into vascular changes upon recovery. We found that introduction of myeloid

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

cell VEGF (Mut/WT) resulted in a rather low density and homogenous distribution of VEGFR2 postive sinusoids in the absence of scar, comparable to WT/WT livers (Figure 5G and H). In contrast, in mice transplantated with myeloid cell VEGFdeficient bone marrow (WT/Mut), the liver scar persists and despite high sinusoidal density in the perifibrotic region similar to Mut/mut animals, sinusoids fail to repopulate the fibrotic area (Figure 5G and H).

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

Discussion A principal conclusion of this study is that angiogenesis driven by myeloid cellderived VEGF is a favourable event that contributes to the resolution of liver fibrosis. The formation of new blood vessels is a typical feature of chronic liver diseases including liver fibrosis, regardless of the underlying aetiology (15). Angiogenesis is believed to promote fibrosis, mostly due to the observation that angiogenesis and fibrotic changes occur simultaneously in many organs including the liver (23). Indeed, in human liver samples as well as in animal studies, vessel density correlates with the degree of liver fibrosis (24, 25). Furthermore, studies that target the VEGF/VEGFR2 pathway and angiogenesis pharmacologically with either receptor tyrosine kinase inhibitors (e.g. Sunitinib or Sorafenib) report a decrease in fibrosis (24, 26, 27). However, receptor tyrosine kinase inhibitor compounds can interfere "off target" with the Platelet-derived Growth Factor receptor beta (PDGFR-β) pathway and therefore the activation and differentiation of hepatic stellate cells. Nevertheless, antibody-mediated strategies that target VEGF/VEGFR2 signaling more specifically also reduce fibrosis (18, 28). Yet, it is possible that these approaches achieve their antifibrotic effects at least partially by preventing the VEGF/VEGFR2-mediated infiltration of immune cell subsets that promote the development of fibrosis (29, 30). In contrast, decreasing liver VEGF expression by genetic ablation of myeloid cellderived VEGF had no impact on the development of liver fibrosis despite reduced angiogenesis. This suggests that inhibition of VEGF signaling prevents the development of fibrosis not primarily via by its antiangiogenic effect but rather additional VEGF-mediated effects on the vasculature (e.g. vascular permeability). Interestingly, a recent study by Yang et al. showed that treatment with a VEGF neutralizing antibody abrogated the resolution of murine liver fibrosis by impeding

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

vascular permeability, monocyte infiltration and macrophage-dependent matrix degradation (18). However, we do not observe differences in scar associated macrophages or neutrophils in fibrotic livers of Mut mice. Likewise, reconstitution with myeloid cell VEGF-deficient bone marrow from Mut mice does not result in a macrophage/neutrophil infiltration defect. This indicates that myeloid cells do not rely on their ability to release VEGF in order to extravasate and to enter the fibrotic scar. Yang et al. furthermore demonstrate that VEGF fosters early resolution of liver fibrosis in a CXCL9- and MMP-13-dependent fashion. Although, we observe an overall increase in CXCL9- and MMP-13 expression upon recovery, we do not observe genotype-specific differences. One possible

explanation for these

discrepancies in macrophage infiltration and phenotype is that our approach of genetic targeting of VEGF in myeloid cells specifically blocks autocrine VEGF signaling in macrophages, whereas VEGF-neutralizing antibodies also inhibit VEGF from paracrine and endocrine sources. Therefore, we hypothesize that changes in CXCL-9 and MMP-13 expression as well as the ability of macrophages to enter the fibrotic scar do not depend on autocrine VEGF but rather on paracrine VEGF. It is also possible that antibody-mediated VEGF-neutralizing strategies reduce hepatic VEGF levels more efficiently, although, this remains to be demonstrated. Moreover, VEGF-neutralizing antibodies preferentially bind the highly diffusible and vascular permeability-inducing VEGF120 isoform as well as the VEGF164 isoform without interfering with matrix-bound and highly angiogenic VEGF188 isoform, whereas genetic deletion approaches target all VEGF isoforms (31, 32). Finally, an important issue regarding the comparability of studies is the dose and the duration of CCL4-treatment which differs tremendously between studies, e.g. 12 weeks of CCL4-treatment (9) as in our study versus 6 weeks of CCL4-treatment in other studies (18).

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

Most of the studies on angiogenesis in different forms of liver fibrosis report increased vessel counts based on pan endothelial markers like CD31 without distinguishing the unique sinusoidal network (21) from afferent branches of the portal vein and hepatic artery or the efferent central veins and lack a precise description of the vascular pattern (14). Moreover, a recent study showed that the sinusoidal endothelium can differentially modulate the development of fibrosis and liver repair in a VEGFR2-dependent manner (33). Importantly, we demonstrate, in addition to overall increased sinusoidal density in fibrotic livers, a distinct vascular pattern with rarefication of VEGFR2 positive sinusoids in fibrotic scars and concomitantly increased sinusoidal density in perifibrotic areas. In addition, studies on vascular changes in fibrosis focus almost uniquely on the development of liver fibrosis, whereas the role of the angiogenic response during recovery from fibrosis has not been investigated. We show for the first time that upon resolution of liver fibrosis, VEGFR2 expressing liver sinusoids reappear in the fibrotic scar in a myeloid cell VEGF-dependent manner, thereby leading to revascularization of fibrotic liver areas and a homogenous distribution of liver sinusoids. Therefore, VEGF-driven sinusoidal angiogenesis within the scar in the absence of ongoing liver injury, resulting in improved circulation between portal vein and central vein branches as well as an overall increased cross-sectional diameter of the hepatic vascular bed could ameliorate portal hypertension. In contrast, a recent publication suggested that a decrease in portal vein pressure does not depend on angiogenesis of larger hepatic vessels (34). In contrary to numerous studies that observe increased VEGF expression during the induction of liver fibrosis (28, 35-38), we report a decrease in hepatic VEGF expression after 12 weeks of CCL4-treatment. This discrepancy is difficult to interpret since

many

studies

use

a

different

model

for

fibrosis

This article is protected by copyright. All rights reserved.

induction,

e.g.

   

HEP-14-1032.R1 

   

Dimethylnitrosamine (DEN) (35, 36) or Thioacetamide (TAA) (38, 39), different readouts for VEGF expression, e.g. immunohistochemical scoring of VEGF staining (37) (versus VEGF mRNA expression and VEGF ELISA in our study) or simply different time points for the analysis of VEGF expression. To resolve this issue, we analyzed VEGF expression at an earlier time point (6 weeks of CCL4-treatment) and indeed we observe increased VEGF mRNA expression (Supplementary Figure 14), indicating that VEGF expression occurs with a transient peak after initial liver injury at early time points with a subsequent decline during prolonged liver damage, at least in the CCL4-model. Noteworthy, whereas VEGF has been implicated to play a role in liver fibrosis by various studies (14), the spatial expression pattern of VEGF during fibrogenesis and fibrolysis had not been demonstrated. Neither had the contribution of different cell types to overall hepatic VEGF levels been examined. We show on human liver samples as well as in experimental murine liver fibrosis that VEGF expression is particularly low in fibrotic scars and that this is associated with sinusoidal rarefication. Furthermore, we identify myeloid cells as an indispensable source of whole liver VEGF during revascularization of the fibrotic scar and the resolution of fibrosis. Therefore, it is possible that myeloid cells as abundant cell type within the scar have the unique ability to generate an "inward" VEGF gradient that guides endothelial cells back into the fibrotic area upon the resolution of fibrosis. Noteworthy in this context, as shown by Thomas et al. successful macrophage therapy and improved resolution of murine liver fibrosis is associated with increased hepatic VEGF expression (40). We demonstrate a defect in zymographic activity and ECM degradation in the absence of myeloid cell-derived VEGF that prevents the resolution of fibrosis. A principal feature of ECM accumulation during hepatic fibrosis is the disbalance between ECM-degrading MMPs and TIMPs, resulting in potent inhibition of ECM

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

degradation, primarily by TIMP-1 and TIMP-2 despite the simultaneous expression of various MMPs (41). Consequently, the resolution of fibrosis is believed to require either downregulation of TIMPs and/or upregulation of MMPs. In line with this, we observe an upregulation of MMP-2 and MMP-14 as well as downregulation of TIMP-1 and TIMP-2 in liver endothelial cells during liver fibrolysis. In contrast, in the absence of myeloid cell-derived VEGF and the persistence of liver fibrosis, liver endothelial cells fail to upregulate MMP-2 as well as MMP-14 and show continuously elevated expression of TIMP-1 and TIMP-2. Interestingly, although, MMP2 has been proposed to play a role in fibrolysis (42), the source of MMP2 during the resolution remained an unresolved issue (7). We show that MMP2 expression in the context of fibrolysis is mostly confined to the sinusoidal endothelium. In addition, in a mouse model of lung regeneration, MMP-14 is expressed in the vasculature in a VEGFR2-dependent manner (43). Along with this, membrane-bound MMP-14 is able to foster ECM breakdown through activation of pro-MMP-2 (44). Therefore, increased expression of MMP-14 and MMP-2 with simultaneous downregulation of TIMPs in endothelial cells could enhance periendothelial fibrolytic activity. This locally restricted ECMdegradation activity may drive endothelial cell migration as well as revascularization and resolution of the fibrotic scar. Interestingly, in the context of tumor angiogenesis it has been shown that MMPs in tumor endothelial cells and degradation of the perivascular ECM are required for the neo formation of tumor blood vessel (45, 46). Hence, the mechanism that contributes to growth of malignant tumors may also promote the resolution of fibrosis, thereby unmasking an unanticipated link between angiogenesis and resolution of fibrosis. In summary, myeloid cell-derived VEGF induces a proresolution phenotype in liver sinusoidal

cells

and

drives

the

revascularization

of

the

This article is protected by copyright. All rights reserved.

fibrotic

scar.

   

HEP-14-1032.R1 

   

References 1.

Iredale JP, Benyon RC, Pickering J, McCullen M, Northrop M, Pawley S,

Hovell C, et al. Mechanisms of spontaneous resolution of rat liver fibrosis. Hepatic stellate cell apoptosis and reduced hepatic expression of metalloproteinase inhibitors. J Clin Invest 1998;102:538-549. 2.

Desmouliere A, Darby IA, Gabbiani G. Normal and pathologic soft tissue

remodeling: role of the myofibroblast, with special emphasis on liver and kidney fibrosis. Lab Invest 2003;83:1689-1707. 3.

Pellicoro A, Ramachandran P, Iredale JP, Fallowfield JA. Liver fibrosis and

repair: immune regulation of wound healing in a solid organ. Nat Rev Immunol 2014;14:181-194. 4.

Iredale JP, Benyon RC, Arthur MJ, Ferris WF, Alcolado R, Winwood PJ, Clark

N, et al. Tissue inhibitor of metalloproteinase-1 messenger RNA expression is enhanced relative to interstitial collagenase messenger RNA in experimental liver injury and fibrosis. Hepatology 1996;24:176-184. 5.

Schaefer B, Rivas-Estilla AM, Meraz-Cruz N, Reyes-Romero MA, Hernandez-

Nazara ZH, Dominguez-Rosales JA, Schuppan D, et al. Reciprocal modulation of matrix metalloproteinase-13 and type I collagen genes in rat hepatic stellate cells. Am J Pathol 2003;162:1771-1780. 6.

Iredale JP. Hepatic stellate cell behavior during resolution of liver injury. Semin

Liver Dis 2001;21:427-436. 7.

Hemmann S, Graf J, Roderfeld M, Roeb E. Expression of MMPs and TIMPs in

liver fibrosis - a systematic review with special emphasis on anti-fibrotic strategies. J Hepatol 2007;46:955-975.

This article is protected by copyright. All rights reserved.

    8.

HEP-14-1032.R1 

   

Friedman SL, Sheppard D, Duffield JS, Violette S. Therapy for fibrotic

diseases: nearing the starting line. Sci Transl Med 2013;5:167sr161. 9.

Duffield JS, Forbes SJ, Constandinou CM, Clay S, Partolina M, Vuthoori S,

Wu S, et al. Selective depletion of macrophages reveals distinct, opposing roles during liver injury and repair. J Clin Invest 2005;115:56-65. 10.

Leung DW, Cachianes G, Kuang WJ, Goeddel DV, Ferrara N. Vascular

endothelial growth factor is a secreted angiogenic mitogen. Science 1989;246:13061309. 11.

Stockmann C, Kirmse S, Helfrich I, Weidemann A, Takeda N, Doedens A,

Johnson RS. A wound size-dependent effect of myeloid cell-derived vascular endothelial growth factor on wound healing. J Invest Dermatol 2011;131:797-801. 12.

Stockmann C, Kerdiles Y, Nomaksteinsky M, Weidemann A, Takeda N,

Doedens A, Torres-Collado AX, et al. Loss of myeloid cell-derived vascular endothelial growth factor accelerates fibrosis. Proc Natl Acad Sci U S A 2010;107:4329-4334. 13.

Stockmann C, Doedens A, Weidemann A, Zhang N, Takeda N, Greenberg JI,

Cheresh DA, et al. Deletion of vascular endothelial growth factor in myeloid cells accelerates tumorigenesis. Nature 2008;456:814-818. 14.

Thabut D, Shah V. Intrahepatic angiogenesis and sinusoidal remodeling in

chronic liver disease: new targets for the treatment of portal hypertension? J Hepatol 2010;53:976-980. 15.

Coulon S, Heindryckx F, Geerts A, Van Steenkiste C, Colle I, Van Vlierberghe

H. Angiogenesis in chronic liver disease and its complications. Liver Int 2011;31:146162.

This article is protected by copyright. All rights reserved.

    16.

HEP-14-1032.R1 

   

Paternostro C, David E, Novo E, Parola M. Hypoxia, angiogenesis and liver

fibrogenesis in the progression of chronic liver diseases. World J Gastroenterol 2010;16:281-288. 17.

Bosch J, Abraldes JG, Fernandez M, Garcia-Pagan JC. Hepatic endothelial

dysfunction and abnormal angiogenesis: new targets in the treatment of portal hypertension. J Hepatol 2010;53:558-567. 18.

Yang L, Kwon J, Popov Y, Gajdos GB, Ordog T, Brekken RA, Mukhopadhyay

D, et al. Vascular Endothelial Growth Factor Promotes Fibrosis Resolution and Repair in Mice. Gastroenterology 2014. 19.

Georgiev P, Jochum W, Heinrich S, Jang JH, Nocito A, Dahm F, Clavien PA.

Characterization of time-related changes after experimental bile duct ligation. Br J Surg 2008;95:646-656. 20.

Yang YY, Liu H, Nam SW, Kunos G, Lee SS. Mechanisms of TNFalpha-

induced cardiac dysfunction in cholestatic bile duct-ligated mice: interaction between TNFalpha and endocannabinoids. J Hepatol 2010;53:298-306. 21.

Ding BS, Nolan DJ, Butler JM, James D, Babazadeh AO, Rosenwaks Z, Mittal

V, et al. Inductive angiocrine signals from sinusoidal endothelium are required for liver regeneration. Nature 2010;468:310-315. 22.

LeCouter J, Moritz DR, Li B, Phillips GL, Liang XH, Gerber HP, Hillan KJ, et al.

Angiogenesis-independent endothelial protection of liver: role of VEGFR-1. Science 2003;299:890-893. 23.

Lee JS, Semela D, Iredale J, Shah VH. Sinusoidal remodeling and

angiogenesis: a new function for the liver-specific pericyte? Hepatology 2007;45:817825. 24.

Tugues S, Fernandez-Varo G, Munoz-Luque J, Ros J, Arroyo V, Rodes J,

Friedman SL, et al. Antiangiogenic treatment with sunitinib ameliorates inflammatory

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

infiltrate, fibrosis, and portal pressure in cirrhotic rats. Hepatology 2007;46:19191926. 25.

Taura K, De Minicis S, Seki E, Hatano E, Iwaisako K, Osterreicher CH,

Kodama Y, et al. Hepatic stellate cells secrete angiopoietin 1 that induces angiogenesis in liver fibrosis. Gastroenterology 2008;135:1729-1738. 26.

Mejias M, Garcia-Pras E, Tiani C, Miquel R, Bosch J, Fernandez M. Beneficial

effects of sorafenib on splanchnic, intrahepatic, and portocollateral circulations in portal hypertensive and cirrhotic rats. Hepatology 2009;49:1245-1256. 27.

Hennenberg M, Trebicka J, Stark C, Kohistani AZ, Heller J, Sauerbruch T.

Sorafenib targets dysregulated Rho kinase expression and portal hypertension in rats with secondary biliary cirrhosis. Br J Pharmacol 2009;157:258-270. 28.

Yoshiji H, Kuriyama S, Yoshii J, Ikenaka Y, Noguchi R, Hicklin DJ, Wu Y, et al.

Vascular endothelial growth factor and receptor interaction is a prerequisite for murine hepatic fibrogenesis. Gut 2003;52:1347-1354. 29.

Dineen SP, Lynn KD, Holloway SE, Miller AF, Sullivan JP, Shames DS, Beck

AW, et al. Vascular endothelial growth factor receptor 2 mediates macrophage infiltration into orthotopic pancreatic tumors in mice. Cancer Res 2008;68:4340-4346. 30.

Cursiefen C, Chen L, Borges LP, Jackson D, Cao J, Radziejewski C, D'Amore

PA, et al. VEGF-A stimulates lymphangiogenesis and hemangiogenesis in inflammatory neovascularization via macrophage recruitment. J Clin Invest 2004;113:1040-1050. 31.

Ferrara N, Houck KA, Jakeman LB, Winer J, Leung DW. The vascular

endothelial growth factor family of polypeptides. J Cell Biochem 1991;47:211-218. 32.

Grunstein J, Masbad JJ, Hickey R, Giordano F, Johnson RS. Isoforms of

vascular endothelial growth factor act in a coordinate fashion To recruit and expand tumor vasculature. Mol Cell Biol 2000;20:7282-7291.

This article is protected by copyright. All rights reserved.

    33.

HEP-14-1032.R1 

   

Ding BS, Cao Z, Lis R, Nolan DJ, Guo P, Simons M, Penfold ME, et al.

Divergent angiocrine signals from vascular niche balance liver regeneration and fibrosis. Nature 2014;505:97-102. 34.

Ehling J, Bartneck M, Wei X, Gremse F, Fech V, Mockel D, Baeck C, et al.

CCL2-dependent infiltrating macrophages promote angiogenesis in progressive liver fibrosis. Gut 2014. 35.

Bozova S, Elpek GO. Hypoxia-inducible factor-1alpha expression in

experimental cirrhosis: correlation with vascular endothelial growth factor expression and angiogenesis. APMIS 2007;115:795-801. 36.

Corpechot C, Barbu V, Wendum D, Kinnman N, Rey C, Poupon R, Housset C,

et al. Hypoxia-induced VEGF and collagen I expressions are associated with angiogenesis and fibrogenesis in experimental cirrhosis. Hepatology 2002;35:10101021. 37.

Vanheule E, Geerts AM, Van Huysse J, Schelfhout D, Praet M, Van

Vlierberghe H, De Vos M, et al. An intravital microscopic study of the hepatic microcirculation in cirrhotic mice models: relationship between fibrosis and angiogenesis. Int J Exp Pathol 2008;89:419-432. 38.

Xie G, Wang X, Wang L, Wang L, Atkinson RD, Kanel GC, Gaarde WA, et al.

Role of differentiation of liver sinusoidal endothelial cells in progression and regression of hepatic fibrosis in rats. Gastroenterology 2012;142:918-927 e916. 39.

Kornek M, Raskopf E, Guetgemann I, Ocker M, Gerceker S, Gonzalez-

Carmona MA, Rabe C, et al. Combination of systemic thioacetamide (TAA) injections and ethanol feeding accelerates hepatic fibrosis in C3H/He mice and is associated with intrahepatic up regulation of MMP-2, VEGF and ICAM-1. J Hepatol 2006;45:370376.

This article is protected by copyright. All rights reserved.

    40.

HEP-14-1032.R1 

   

Thomas JA, Pope C, Wojtacha D, Robson AJ, Gordon-Walker TT, Hartland S,

Ramachandran P, et al. Macrophage therapy for murine liver fibrosis recruits host effector

cells

improving

fibrosis,

regeneration,

and

function.

Hepatology

2011;53:2003-2015. 41.

Benyon RC, Iredale JP, Goddard S, Winwood PJ, Arthur MJ. Expression of

tissue inhibitor of metalloproteinases 1 and 2 is increased in fibrotic human liver. Gastroenterology 1996;110:821-831. 42.

Zhou X, Hovell CJ, Pawley S, Hutchings MI, Arthur MJ, Iredale JP, Benyon

RC. Expression of matrix metalloproteinase-2 and -14 persists during early resolution of experimental liver fibrosis and might contribute to fibrolysis. Liver Int 2004;24:492501. 43.

Ding BS, Nolan DJ, Guo P, Babazadeh AO, Cao Z, Rosenwaks Z, Crystal RG,

et al. Endothelial-derived angiocrine signals induce and sustain regenerative lung alveolarization. Cell 2011;147:539-553. 44.

Ingvarsen S, Madsen DH, Hillig T, Lund LR, Holmbeck K, Behrendt N,

Engelholm LH. Dimerization of endogenous MT1-MMP is a regulatory step in the activation of the 72-kDa gelatinase MMP-2 on fibroblasts and fibrosarcoma cells. Biol Chem 2008;389:943-953. 45.

Perentes JY, Kirkpatrick ND, Nagano S, Smith EY, Shaver CM, Sgroi D,

Garkavtsev I, et al. Cancer cell-associated MT1-MMP promotes blood vessel invasion and distant metastasis in triple-negative mammary tumors. Cancer Res 2011;71:4527-4538. 46.

Fang J, Shing Y, Wiederschain D, Yan L, Butterfield C, Jackson G, Harper J,

et al. Matrix metalloproteinase-2 is required for the switch to the angiogenic phenotype in a tumor model. Proc Natl Acad Sci U S A 2000;97:3884-3889.

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

Figure legends

Figure 1: The fibrotic scar in human livers is characterized by sinusoidal rarefication and low VEGF expression. (A) Representative images of non-fibrotic and fibrotic human liver sections coimmunolabeled for VEGFR2 and SMA. (B) Ratio of VEGFR2- and α-SMA -positive area in healthy and fibrotic human liver sections as shown in (A) quantified in pixel (px). (nonfibrotic: n = 5; fibrotic: n = 6). (C) Quantification of VEGFR2-positive area as shown in (A) in pixel (px) (F3 fibrotic liver: n = 7; F3 perifibrotic liver: n = 6; F4 fibrotic liver: n = 11; F4 perifibrotic liver: n = 11). (D) Microscopical images of VEGF/α-SMA double-stained human liver samples. Error bars represent SEM. Scale bars equal 100 µm.

Figure 2: Genetic ablation of VEGF specifically in scar-infiltrating myeloid cells prevents the resolution of fibrosis (A) Representative histological images of Sirius Red-stained liver sections obtained from WT and Mut mice subjected to Bile Duct Ligation, BDL, (right panel) or Sham, control, (left panel) surgery. (B) Quantification of collagen-positive area in murine livers sections as shown in (A). (sham: n =24; BDL: n =19). (C) Determination of free hydroxyproline in livers derived from WT and Mut mice at indicated treatment-conditions (sham: n =12; BDL: n =16). (D) Representative histological images of Sirius Red-stained liver sections obtained from WT and Mut mice without treatment, control, (left panel), after the CCL4-

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

induction of liver fibrosis, 12 weeks, (middle panel) and at the end of a 4 week recovery phase, recovery,(right panel). (E) Quantification of collagen-positive area in murine livers sections as shown in (D). (control: n ≥ 4; 12 weeks: n ≥ 8; recovery: n ≥ 10). (F) Determination of free hydroxyproline in livers derived from WT and Mut mice at indicated treatment-conditions (control: n = 8; 12 weeks: n = 4; recovery: n ≥ 4). Error bars represent SEM. Scale bars equal 100 µm.

Figure 3: Genetic ablation of VEGF specifically in scar-infiltrating myeloid cells prevents sinusoidal angiogenesis (A) Quantification of VEGF-A-transcript levels in untreated (control), CCL4-treated (12 weeks), and 4 weeks recovered mice (recovery), (WT: n ≥ 5; Mut: n ≥ 7). (B) VEGF-A protein levels in whole liver lysates derived from WT and Mut mice as determined by ELISA (WT: n ≥ 7; Mut: n ≥ 7). (C) Microscope images of coimmunolabeled VEGFR-2- and α-SMA liver sections obtained from WT and Mut mice before (left panel, control), after (middle panel, 12 weeks) CCl4-treatment and at the end of the 4 weeks recovery phase (left panel, 4 weeks recovery). (D) Quantification of VEGFR-2 positive cells as shown in (C) (control: n ≥ 5; 12 weeks: n ≥ 10; 4 weeks recovery: n ≥ 8). Error bars represent SEM. Scale bars equal 100 µm.

Figure 4: Myeloid cell VEGF induces the expression of matrix degrading enzymes in liver endothelial cells. (A) In situ zymography illustrating the gelatinolytic activity in untreated (upper panel,

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

control), fibrotic (middle panel, 12 weeks CCL4) and recovered livers (lower panel, 4 weeks recovery) derived from control, CCL4-treated of 4 weeks recovered WT and Mut mice. (B) Quantification of DQTM-gelatine-positive areas as shown in (A) (control: n = 4; 12 weeks: n = 4; recovery: n = 6). (C-F) Quantitative real time-analysis of MMP2, MMP14, TIMP1- and TIMP2expression respectively in liver endothelial cells derived from WT and Mut mice after the induction of fibrosis and a recovery phase of 2 weeks or 4 weeks. Livers of untreated animals served as controls (control: n ≥ 8, 12 weeks: n ≥ 4; 2 weeks recovery: n ≥ 9, 4 weeks recovery: n ≥ 7). Error bars represent SEM. Scale bars equal 100 µm.

Figure 5: Reintroduction of Myeloid cell-delivered VEGF specifically upon recovery restores ECM breakdown and resolution of fibrosis. (A) Time-schedule for the CCl4-treatment of bone-marrow transplanted WT and Mut mice. Control mice received bone-marrow of the same genotype. (B) Quantification of collagen-positive area in WT and Mut mice that received a transplant of WT or Mut bone-marrow (WT/WT: n = 6; Mut/Mut: n = 6; Mut/WT: n = 4; WT/Mut: n = 5). (C) Determination of free hydroxyproline in livers derived from bone-marrow transplanted WT and Mut mice. Control mice received bone-marrow from the same genotype (WT/WT: n = 4, Mut/Mut: n = 4, Mut/WT: n = 6, WT/Mut: n = 5). (D) Representative images of zymographic activity in WT and Mut livers after transplantation of WT (upper panel) and Mut bone marrow (lower panel). (E) Quantification of DQTM-gelatine-positive areas in WT and Mut livers as shown in (D) in pixel (px) (WT/WT: n ≥ 4 ;Mut/Mut: n ≥ 5 ; Mut/WT: n ≥ 5 ; WT/Mut: n ≥ 6).

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

(F) Quantification of MMP2-, MMP14-, TIMP1-, TIMP2-mRNA-transcript levels in isolated liver-endothelial cells derived from WT and Mut mice after transplantation of WT and Mut bone-marrow. Control mice received bone-marrow of the same genotype (WT/WT: n ≥ 4 ;Mut/Mut: n ≥ 5 ; Mut/WT: n ≥ 5 ; WT/Mut: n ≥ 6). (G) Representative images of VEGFR2-α-SMA double-stained livers derived from WT and Mut mice that received a transplant of WT or Mut bone-marrow. (H) Quantification of VEGFR2-positive areas shown in (J) in pixel (px) (WT/WT: n ≥ 4 ;Mut/Mut: n ≥ 5 ; Mut/WT: n ≥ 5 ; WT/Mut: n ≥ 6). Error bars represent SEM. Scale bars equal 100 µm.

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

Supplementary Figure legends: Supplementary Figure S1: (A) Determination of free hydroxyproline in livers derived from WT and Mut mice at indicated treatment-conditions (control: n = 8; 12 weeks: n ≥ 4; recovery: n ≥ 5). (B) Representative images of VEGF and α-SMA co-immunolabeled liver sections obtained from WT and Mut mice before (left panel, control), after, (middle panel, 12 weeks) CCl4-treatment and at the end of the recovery phase, (left panel, recovery). (C) Representative images of VEGFR2 and α-SMA co-immunolabeled liver sections obtained from WT and Mut mice subjected to sham (upper panel), or BDL surgery (lower panel). Error bars represent SEM. Scale bars equal 100 µm.

Supplementary Figure S2: Quantitative real time-analysis of indicated MMP- and TIMP-expression in scarassociated macrophages (SAMs) and whole liver tissues derived from WT and Mut mice after the induction of fibrosis (12 weeks) and a recovery phase of 2 weeks or 4 weeks. Livers of untreated animals served as controls (control: n ≥ 6, 12 weeks: n ≥ 4; 2 weeks recovery: n ≥ 4, 4 weeks recovery: n ≥ 7). Error bars represent SEM.

Supplementary Figure S3: (A) Determination of free hydroxyproline in whole liver tissues derived from WT and Mut mice after the induction of fibrosis and a recovery phase of 1 week (control: n =

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

11; recovery: n=9). (B) Quantitative real time-analysis of indicated CXCL9-expression in whole liver tissues derived from WT and Mut mice after the induction of fibrosis (12 weeks) or after a recovery phase of 2 weeks (recovery 2 weeks) or 4 weeks (recovery 4 weeks). Livers of untreated animals served as controls (n=6 for each condition). Quantitative real time-analysis of indicated CXCL9-expression in whole liver tissues derived from WT and Mut mice after the induction of fibrosis followed by 1 week of recovery (recovery 1 week) (n=6 for each condition). (C) Quantitative real time-analysis of indicated MMP- and TIMP-expression in whole liver tissues derived from WT and Mut mice after the induction of fibrosis followed by a recovery phase of 1 week (control: n = 10; recovery: n=16). (D) Quantitative real time-analysis of indicated MMP-9 and-13 and TIMP-expression in scar-associated macrophages (SAMs) derived from WT and Mut mice after the induction of fibrosis followed by a recovery phase of 1 week (control: n=7, 1 week recovery n=13). Error bars represent SEM.

Supplementary Figure S4: Representative immunofluorescence staining for MAC-2 on liver sections derived from CCl4-treated (12 weeks CCL4) and 1, 2 or 4 weeks of recovery for WT and Mut mice. Scale bars equal 100 µm.

Supplementary Figure S5:

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

(A) Representative immunofluorescence staining for MAC-2 on liver sections derived from WT and Mut mice subjected to BDL surgery. B) Quantification of MAC2 positive cells on liver sections derived from 12 weeks CCl4-treated, 1, 2 or 4 weeks of recovery for WT and Mut mice (n=5 for each condition). (C) Quantification of MAC2 positive cells on liver sections as shown in (A) (n=5 for each condition). Error bars represent SEM. Scale bars equal 100 µm.

Supplementary Figure S6: Representative immunohistochemical staining for NIMP-R14 on liver sections derived from untreated (control), CCl4-treated (12 weeks CCL4) and 1 (1 week recovery), 2 (2 weeks recovery), or 4 weeks (4 weeks recovery) of recovery for WT and Mut mice. Scale bars equal 100 µm.

Supplementary Figure S7: (A) Representative immunohistochemical staining for NIMP-R14 on liver sections derived from WT and Mut mice subjected to sham (lower panel) or BDL surgery (upper panel). (B) Quantification of NIMP-R14 positive cells as shown in supplementary figure 6. (n=5 for each condition) (C) Quantification of NIMP-R14 positive cells as shown in (A). (n=5 for each condition) Error bars represent SEM. Scale bars equal 100 µm.

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

Supplementary Figure S8: Quantification of PCNA positive nucleus on liver sections derived from untreated (control), CCl4-treated (12 weeks) and 1, 2 or 4 weeks of recovery for WT and Mut mice. (n=5 for each condition). Error bars represent SEM.

Supplementary Figure S9: Quantitative real time-analysis of MMP7-, MMP13, MMP15- and TIMP3-expression in liver endothelial cells derived from WT and Mut mice after the induction of fibrosis (12 weeks) and a recovery phase of 2 weeks or 4 weeks. Endothelial cells from untreated animals served as controls (control) (control: n ≥ 8, 12 weeks: n ≥ 4; 2 weeks recovery: n ≥ 9, 4 weeks recovery: n ≥ 7). Error bars represent SEM.

Supplementary Figure S10: Representative immunohistochemical staining for pro-MMP2 on liver sections derived from untreated (control), CCl4-treated (12 weeks CCL4) and 2 or 4 weeks recovery in WT and Mut mice. Scale bars equal 100 µm.

Supplementary Figure S11: Representative immunohistochemical staining for MMP14 on liver sections derived from untreated (control), CCl4-treated (12 weeks CCL4) and 2 or 4 weeks recovery in WT and Mut mice.

This article is protected by copyright. All rights reserved.

   

HEP-14-1032.R1 

   

Scale bars equal 100 µm.

Supplementary Figure S12: Representative immunohistochemical staining for TIMP1 on liver sections derived from untreated (control), CCl4-treated (12 weeks CCL4) and 2 or 4 weeks recovery in WT and Mut mice. Scale bars equal 100 µm.

Supplementary Figure S13: Representative immunofluorescence double staining for α-SMA and TIMP1 on liver sections derived from 12 weeks CCl4-treated in WT and Mut mice. Scale bars equal 100 µm.

Supplementary Figure S14: (A) Quantification of MAC2 positive cells on liver sections derived from bone-marrow transplanted WT and Mut mice (WT/WT: n = 4, Mut/Mut: n = 4, Mut/WT: n = 7, WT/Mut: n = 5). (B) Quantification of NIMP-R14 positive cells on liver sections derived from bonemarrow transplanted WT and Mut mice (WT/WT: n = 4, Mut/Mut: n = 4, Mut/WT: n = 7, WT/Mut: n = 5). (C) Quantification of PCNA positive nucleus on liver sections derived from bonemarrow transplanted WT and Mut mice (n=5 for each condition). (D) Quantitative real time-analysis of VEGF-expression in whole liver tissues derived from WT and Mut mice after the CCl4-induction of fibrosis (6 weeks) (control: n ≥ 10, 6 weeks: n ≥ 6). Error bars represent SEM.

This article is protected by copyright. All rights reserved.

Hepatology

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

210x308mm (300 x 300 DPI)

Hepatology This article is protected by copyright. All rights reserved.

Page 38 of 63

Page 39 of 63

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Hepatology

210x297mm (300 x 300 DPI)

Hepatology This article is protected by copyright. All rights reserved.

Hepatology

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

210x297mm (300 x 300 DPI)

Hepatology This article is protected by copyright. All rights reserved.

Page 40 of 63

Page 41 of 63

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Hepatology

210x297mm (300 x 300 DPI)

Hepatology This article is protected by copyright. All rights reserved.

Hepatology

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

210x297mm (300 x 300 DPI)

Hepatology This article is protected by copyright. All rights reserved.

Page 42 of 63

Page 43 of 63

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Hepatology

Supplementary Experimental Procedures

Animals The Animal Care and Use Committee of the Bezirksregierung Düsseldorf, Germany, approved all procedures performed on mice. Female and male mice at 10-12 weeks of age were used in this study. Myeloid cell-specific knock out of VEGF was achieved by breeding male Mice (C57/B6), with both alleles of exon 3 of VEGF-A flanked by loxP sites (VEGF+f/+f) with female mice (C57/B6) homozygous for the floxed VEGF allele

expressing Cre

recombinase

driven

by

the

lysozyme

M

promoter

(LysMCre+/VEGF+f/+f) (11-13). For ous studies we used mice carrying two floxed VEGF alleles and positive for cre-expression (LysMCre+/VEGF+f/+f) designated as mutants (Mut) whereas female littermates negative for cre expression (LysMCre/VEGF+f/+f) served as wildtype controls (WT). All animals received care according to the "Guide for the care and use of laboratory animals".

Human liver samples Immunohistochemical analysis was performed samples from patients with a non-viral aetiology of fibrosis/cirrhosis. Human liver tissue specimens were obtained from surgical liver biopsies or liver resection in the context of gastrointestinal malignancies. Histological samples were analyzed and classified as fibrotic or cirrhotic by the pathology department at George Pompidou Hospital according to the Metavir classification. F3 liver specimens were characterized by periportal fibrosis and numerous septa without cirrhosis. F4 liver specimens showed cirrhosis, periportal and septal fibrosis . Uninvolved liver segments from surplus resectional liver served as nonfibrotic controls.

Hepatology This article is protected by copyright. All rights reserved.

Hepatology

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 44 of 63

Tissue preparation Mice were sacrificed at indicated time points and livers harvested for further analysis. For histology, livers were fixed in 4 % (w/v) PFA overnight and embedded in paraffin or alternatively frozen in O.C.T. tissue TEK. For RNA and protein isolation livers were separated and snap-frozen in liquid nitrogen.

Immunofluorescence and immunohistochemistry 5-µm sections were deparaffinized with xylene and rehydrated in a graded ethanol series. Antigen retrieval was performed by boiling the sections in low-pH citrate buffer for 15 minutes. Sections were treated with 3 % (v/v) H2O2 for 10 min at RT, blocked with 5 % normal goat serum (Sigma) for 1 hour at RT and incubated with the primary antibody overnight at 4 °C. Antigens of interest were visualized using the Vectastain ABC kit (Vector Laboratories) or by species-specific fluorochrome-conjugated secondary antibodies. For stainings with mouse-derived antibodies, Mouse on mouse (M.O.M.) Basic Kit (Vector Laboratories) was used following the kit instructions. Cell nuclei were stained with DAPI (Invitrogen) and coverslips were mounted with Mounting Medium (Dako). The following antibodies were used in this study: Rat CD31 at 1:100 dilution (BD Bioscience), mouse MAC-2 at 1:100 dilution (Cedarlane), mouse α-SMA at 1:500 dilution (Chemikon), rabbit VEGFR-2 at 1:100 dilution (Cell signaling), rabbit VEGF (Calbiochem) at 1:200, mouse pro-MMP2 (Chemicon) at 1:100, rabbit MMP-14 (Abcam) at 1:1000, goat TIMP-1 (R&D) at 1:400, rat NIMPR14 at 1:1000, mouse PCNA (Sigma) at 1:200.

Sirius Red staining Liver tissues were stained for collagen using the Picrosirius Red Stain kit (Polysciences Inc.) following the manufacturer’s instructions. For quantitative Hepatology This article is protected by copyright. All rights reserved.

Page 45 of 63

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Hepatology

analysis of, a minimum of 10 non-overlapping fields of each sections were photographed (Nikon Eclipse E1000 microscope and the Nikon DS-Ri1 camera system) at 200x. The percentage of Sirius red staining was measured with Image J (National Institute of Health).

In situ zymography A mixture of DQTM-gelatin and reaction buffer (Invitrogen) was applied on top of OCTembedded frozen sections and incubated at 37 °C for 24 h in a dark humid chamber. The gelatinolytic activity was observed as green fluorescence by fluorescence microscopy (excitation: 342 nm; emission: 441 nm).

Quantification of histology markers For

quantitative

analysis

of

immunohistochemical

markers,

sections

were

photographed into JPEG images (Nikon Eclipse E1000 microscope and the Nikon DS-Ri1 camera system). The number of pixels marked above a threshold by each marker was measured using the ImageJ program (National Institute of Health) and calculated as the percentage of the total area covered by DAPI. For assessment of MAC-2, NIMP-R14 and PCNA , positive cells were counted in each field.

RNA extraction and qPCR-analysis Total RNA was isolated by the phenol/chloroform extraction method. cDNA was synthesized from 1 µg of DNA-free total RNA in a 25 µl reaction volume using MMLV Reverse Transkriptase (Promega) and oligo-dT-primers (Life Technologies). Gene-specific transcription levels were determined in a 20 µl reaction volume in duplicate using SYBR Green Mastermix (Promega) and an IQ5 real-time PCR machine (Bio-Rad). Quantification was done in a two-step real-time PCR with a Hepatology This article is protected by copyright. All rights reserved.

Hepatology

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 46 of 63

denaturation step at 95 °C for 10 min and followed by 40 cycles at 95 °C for 15 s and at 60 °C for 1 min. Standard cDNA samples with 10-fold serial dilutions were used for PCR efficiency calculations. Data were normalized by the level of 16S mRNA expression. Primers used in RT-qPCR reactions were as follows: 16S: forward primer: 5’-AGATGATCGAGCCGCGC-3’, reverse primer: 5’-GCTACCAGGGCCTTTGAGATGGA-3’; VEGF-A:

forward

primer:

5’-

ATCCGCATGATCTGCATGG-3’,

reverse primer: 5’- ATCCGCATGATCTGCATGG -3’; MMP2: GGCTGGAACACTCTCAGGAC-3’, reverse primer: 5’CGATGCCATCAAAGACAATG-3’; MMP14:

forward

primer:

5’-GTGCCCTATGCCTACATCCG-3’,

reverse primer: 5’-CAGCCACCAAGAAGATGTCA-3’; TIMP1:

forward

primer:

5’-CGCAGATATCCGGTACGCCTA-3’,

reverse primer: 5’-CACAAGCCTGGATTCCGTGG-3’; TIMP2:

forward

primer:

5’-GGAATGACATCTATGGCAACC-3’,

reverse primer: 5’-GGCCGTGTAGATAAACTCGAT-3’ MMP9: forward primer: 5’-CGGCACGCTGGAATGATC-3’, reverse primer: 5’-TCGAACTTCGACACTGACAAGAA-3’; MMP15:

forward

primer:

5’-GACCAGTATGGCCCCAACAT-3’,

reverse primer: 5’-CCAATTGGCATGGGGTAGTT-3’; MMP7: forward primer: 5’-GCTCTCAGAATGTGG AGTATGC-3’, reverse primer: 5’-AAGTTCACTCCTGCGTCC-3’; MMP13:

forward

primer:

5’-TGATGGCACTGCTGACATCAT-3’,

reverse primer: 5’-TGTAGCCTTTGGAACTGCTT-3’; TIMP3: forward primer: 5’-TGACAGGGCGCGTGT ATGAAGG-3’,

Hepatology This article is protected by copyright. All rights reserved.

Page 47 of 63

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Hepatology

reverse primer: 5’-GTGGTAGCGGTAATTGAGGCC-3’; CXCL-9: forward primer: 5'- TCTTGGGCATCATCTTCCTGG -3; reverse primer: 5’- GAGGTCTTTGAGGGATTTGTAGTGG -3;

Bone marrow isolation and adoptive cell transfer Hind limbs of donor mice were removed and cleaned. Both tops of the femur were cut off and each bone flushed with 5 ml RPMI 1640 containing 2 % FBS, 10 units/ml heparin, penicillin and streptomycin. The solution was filtered through a sterile 40 µm cell strainer (BD Bioscience), washed twice and the cells directly used for injection. 1 week before and 2 weeks after irradiation (10 Gray), WT and Mut recipient mice were given acidified water (pH 2.6) supplemented with 10 mg/ml Neomycin and 25 mg/ml Polymyxin B (Sigma). The animals were irradiated 48hours after the last CCL4-injection and adoptive transfer of bone marrow cells was performed 24 hours after irradiation. For adoptive transfer, 5x106 cells of the isolated bone marrow were injected into the tail-vain of the recipient mice and allowed to reconstitute for 2 weeks. Control mice received bone marrow cells of the same genotype (WT/WT, Mut/Mut).

Isolation of liver endothelial cells and macrophages For isolation of liver endothelial cells and macrophages from WT and Mut mice, freshly harvested livers were homogenized by mechanical disaggregation and digested in cell lysis buffer (DMEM + 2 mg/ml collagenase type III) for 60 minutes at 37 °C. Single cell suspensions were generated by passing the cells through a 40-µm cell strainer, followed by resuspension in MACS-buffer according to the manufacturer’s instructions (Miltenyi Biotec) and incubation of 4x107 cells with mouse CD31- or F4/80-antibodies for 45 min at 4 °C. The cell suspensions were washed Hepatology This article is protected by copyright. All rights reserved.

Hepatology

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 48 of 63

with MACS-buffer and incubated with secondary IgG microbeads for 15 min at 4 °C before positive selection using an automated MACS separator (Miltenyi Biotec). The purity of the cell isolates was tested by immunocytochemistry for VEGFR2 and MAC2 after fixing an aliquot of isolated cells on a slide with 4% PFA in order to identify endothelial cells and macrophages, respectively. The purity for endothelial cells was 86.78 % ± 1.507 (n=14) and 89.51 ± 1.281 N=16 for macrophages.

Mouse VEGF-A ELISA Snap-frozen liver samples were homogenized in 1 ml of ice-cold RIPA buffer (50 mM Tris pH 7.4, 150 mM NaCl, 1 % Triton, 0.1 M NaF) followed by the determination of VEGF-A concentration using a commercial kit (Quantikine ELISA, Mouse VEGF Immunoassay, R&D Systems).

Hydroxyproline-assay Hepatic hydroxyproline content was quantified colorimetrically using snap frozen liver samples. Tissue (~100 mg) was homogenized in distilled water and protein was precipitated using trichloroacitic acid. Samples were washed with ethanol, dried and hydrolyzed in 6 M HCl at 110°C for 18 hours. The hydrolysate was filtered and neutralized with 10 M NaOH. Samples were then incubated with freshly prepared chloramine T solution. Ehrlich’s solution was added and samples incubated for 20 minutes at 65°C. The optical density of each sample and serial dilutions of trans-4hydroxy-L-proline standard (Sigma, Saint Louis, MO) was measured at 550 nm. Hepatic hydroxyproline content is expressed as μg hydroxyproline per gram liver

Inhibition of VEGFR-2-signaling

Hepatology This article is protected by copyright. All rights reserved.

Page 49 of 63

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Hepatology

Inhibition with VEGFR-2 signaling during recovery was achieved with the small molecule inhibitor SU5416 (Sigma). After 12 weeks of CCL4 treatment, animals were treated with SU5416 for 3 weeks, twice a week 10mg/kg i.p., starting at week 2 of the 4 week recovery phase.

Statistical analysis Statistical analysis was done using Prism 6.0 software (GraphPad Software). Statistical significance was determined by ANOVA and Tukey's multiple comparison test or unpaired students-t test where appropriate. Data are expressed as mean +/SEM. Statistical significance is indicated as * p