Journal of Medical Virology 86:1249–1255 (2014)

Respiratory Virus Infections Among Children in South China Xiao-Ying Cai,1 Qiong Wang,2 Guang-Yu Lin,1* Zhi-Wei Cai,3 Chuang-Xing Lin,1 Pai-Zhen Chen,1 Xiao-Hua Zhou,1 Jin-Chun Xie,1 and Xue-Dong Lu2 1

Department of Pediatrics, The Second Affiliated Hospital of Shantou University Medical College, Shantou, Guangdong, China 2 Department of Clinical Laboratory Medicine, The Futian Hospital Affiliated to Guangdong Medical College, Shenzhen, Guangdong, China 3 Department of Transforming Medical Center, The Second Affiliated Hospital of Shantou University Medical College, Shantou, China

Acute respiratory tract infection is an important cause of morbidity and mortality with a worldwide disease burden. This study aimed to determine the prevalence and clinical characteristics of children with viral-induced acute respiratory tract infection, in Southern China. Nasopharyngeal aspirate samples from 1,980 pediatric patients with suspected acute respiratory tract infection, and 82 samples from healthy subject controls were collected for routine examination at the Second Affiliated Hospital of Shantou University Medical College, from October 2007 to August 2011. Specimens were tested by multiplex polymerase chain reaction (mPCR). At least one or more viruses were detected from 1,087 samples (54.9%). These included laboratory confirmations for 446 respiratory syncytial virus (RSV), 386 influenza virus A (FluA), 315 human rhinovirus (HRV), 135 human bocavirus (HBoV), 119 Parainfluenza virus 3 (PIV3), 82 Parainfluenza virus 1 (PIV1), 66 adenovirus (ADV), 53 WU polyomavirus (WUPyV), 52 human metapneumovirus (hMPV), and 29 influenza virus B (FluB) samples. Samples from healthy subjects were negative for any virus. Of the patients with positive specimens, 107 (9.8%) were admitted to pediatric intensive care unit (PICU). Co-infection with at least two of the viral pathogens under study was observed in 325 of the 1,980 patients (16.4% of the total number of cases). These findings may help in the diagnosis of viral infections of the respiratory tract in children, and help to consider current and potential therapeutic approaches for the treatment of acute respiratory tract infection, and further respiratory complications. J. Med. Virol. 86:1249–1255, 2014. # 2014 Wiley Periodicals, Inc. C 2014 WILEY PERIODICALS, INC. 

KEY WORDS:

respiratory virus; children; South China

INTRODUCTION Acute respiratory tract infection is an important cause of morbidity and mortality with a worldwide disease burden estimated at an exceedance of four million deaths per year [Seto et al., 2013]. Acute respiratory tract infection causes approximately 20% of deaths in pre-school children worldwide, with 90% of these deaths attributed to pneumonia. Common viral respiratory infections include respiratory syncytial virus (RSV), influenza types A and B (FluA and B), parainfluenza types 1 and 3 (PIV1 and 3), human rhinovirus (HRV), human metapneumovirus (hMPV), adenoviruses (ADV), WU polyomavirus (WUPyV), and human bocavirus (HBoV) [Bastien et al., 2007; Huiuijskens et al., 2012; Bierbaum et al., 2013; Kim et al., 2013]. These viruses cause acute respiratory tract disease in children, are often seasonal, and about 4–33% present with co-infection of at least one additional viral pathogen [Brunstein et al., 2008; Kaplan et al., 2008; Regamey et al., 2008; Sung et al., 2009]. Respiratory viruses can cause more serious clinical complications such as croup, bronchiolitis, and pneumonia, which often require Conflicts of Interest: None.
Correspondence to: Guang-Yu Lin, MD, Department of Pediatrics, The Second Affiliated Hospital of Shantou University Medical College, Shantou, Guangdong 515041, China. E-mail: [email protected] Accepted 21 February 2014 DOI 10.1002/jmv.23931 Published online 12 March 2014 in Wiley Online Library (wileyonlinelibrary.com).

1250

Cai et al.

hospitalization [Garcı´a-Garcı´a et al., 2012; Turner et al., 2013]. The aim of this study was to investigate the prevalence and clinical characteristics of children with viral acute respiratory tract infection in Southern China. MATERIALS AND METHODS Nasopharyngeal Aspirate Specimen Collection From October 2007 to August 2011, nasopharyngeal aspirate specimens were collected from 1,980 pediatric patients (1,188 boys and 792 girls, age range 30 days to 12 years) with suspected acute respiratory tract infection. In addition 82 nasopharyngeal aspirate specimens were collected from healthy children for routine examination following outpatient service (49 boys and 33 girls, age range 3 months to 8 years). Written informed consent was obtained from the parents of each child, and the Ethical Committee of the Second Affiliated Hospital of Shantou University Medical College approved the experimental protocols. The inclusion criterion was any acute respiratory tract infection, regardless of the reason for hospital admission. These samples were collected from a variety of geographical locations in China including Shantou, Chaozhou, Puning, Shanwei, and Jieyang. The nasopharyngeal aspirate samples were obtained within 24 hr of admission where possible, and immediately added to 3.0 ml of viral transport medium [Dulbecco’s Modified Eagle Medium (DMEM) with 100 U/ml penicillin (Zhongnuo Pharmaceutical, Shijiazhuang, China); 100 mg/ml streptomycin (North China Pharmaceutical, Shijiazhuang, China); 2,000 U/ml amphotericin B (Sanland-chem International, Xiamen, China)] and viral transport medium was stored at 80˚C until further processing. The final diagnosis was obtained from the discharge letter, and was made on the basis of both chest radiograph and clinical findings.

and Oligo 6.0) and synthesized by Invitrogen Life Technologies (Table I). All of the primer pairs were include in each PCR. The multiplex PCR used has been described previously [Templeton et al., 2004; Fan et al., 2007]. Nucleic acid preparation was performed using AxyPrep Body Fluid Viral DNA/ RNA Miniprep Kit (Axygen, Shantou, Guangdong, China) according to the manufacturer’s instructions. Briefly, individual NPA samples (200 ml) were mixed with an equal volume of viral lysis buffer and incubated for 5 min at room temperature. After adding 75 ml protein precipitation buffer, the mixture was centrifuged at 12,000g for 5 min. The supernatants were collected and mixed with 300 ml isopropanol þ 1% acetic acid. The mixture was loaded on to a Miniprep column and centrifuged at 6,000g for 1 min, followed by sequential washings with 500 ml washing buffer and 800 ml of desalting buffer. Nucleic acids were eluted with 60 ml TE buffer, quantified, and stored at 80˚C. Multiplex PCR involves reverse transcription of genomes from RNA viruses (FluA and B, PIV1 and 3, RSV, HRV, hMPV), followed by PCR amplification of the corresponding cDNA, and direct PCR amplification of genomes from DNA viruses (ADV, WUPyV, and HBoV). The respiratory viruses were confirmed by resolving PCR products on 1% agarose gels to confirm amplification of the predicted DNA. Sequencing was performed using a Beckman CEQ-8000 instrument and the identity of the PCR product sequences was confirmed using both BLAST and NCBI databases. Each PCR product was identified by size of the band following agarose gel electrophoresis and confirmed by DNA sequencing. Statistical Analysis Data were analyzed using statistical software (SPSS, version 13.0). For statistical analyses, the chisquared test was applied. A P-value of less than 0.05 was considered significant.

Viral Detection

RESULTS

Primers used for multiplex PCR amplification of respiratory viruses were selected based on the sequences available in GenBank. The primers were selected using Primer Express software (Primer 5.0

Absolute and Relative Virus Frequency From October 2007 to August 2011, nasopharyngeal aspirate specimens from 1,980 patients were

TABLE I. Primers Used Multiplex PCR Detection Virus FluA FluB PIV1 PIV3 RSV HRV ADV HBoV hMPV WUPyV

Forward primer sequence (50 –30 )

Reverse primer sequence (50 –30 )

Product size (bp)

AAGGGCTTTCACCGAAGAGG GGGATATACGTAATGTGTTGT CAGACGGCATATCTCCTCTGG CTGGGCTTCATCAGTAGAGA TTTCCACAATATYTAAGTGTCAA CGGTAATTTTGTACGCCAGTTT ATGTATTCCTTTTTCCGAAACTTCCA GCAAACCCATCACTCTCAATGC AACCGTGTACTAAGTGATGCACTC TGTTACAAATAGCTGCAGGTC

CCCATTCTCATTACTGCTTC GCACTGCCTGCTGTACACTT GGTATGAGAAATTACCGGGT GATCTGTTGGTCACCACAAGA TCATCWCCATACTTTTCTGTTA GAAACACGGACACCCAAAGTAG GCCACATGGTGCGATCGCA GCTCTCTCCTCCCAGTGACAT CATTGTTTGACCG(A)GCC(A)CCA(G)TAA GCATAATGGGGAGTACC

171 489 307 585 155 501 248 404 191 217

J. Med. Virol. DOI 10.1002/jmv

Respiratory Virus Infections

collected; 150 of these patients admitted to pediatric intensive care units (PICU). Of the children diagnosed, 1,087 (54.9%) were positive for at least one virus, while none of the 82 healthy controls were positive. The positive specimens included the following viruses: RSV (446); FluA (386); HRV (315); hHBoV (135); PIV3 (119); PIV1 (82); ADV (66); WUPyV (53); hMPV (52); and FluB (29) (Fig. 1, Table II). Of the 1,087 patients with positive specimens, 107 (9.8%) were admitted to a pediatric intensive care unit with RSV (54) being the most prevalent (Tables II and III). Viral Co-Infections Co-infection with at least two of the viral pathogens under study, was observed in 325 of the 1,980 patients (16.4% of the total number of cases); two pathogens were detected in 234 samples (11.8%), three pathogens in 68 samples (3.4%), four pathogens in 17 samples (0.9%), and six samples (0.3%) contained five viral pathogens. The most common pathogens in co-infected samples were PIV1 (68.5%), PIV3 (60%), FluB (58.6%), WUPyV (54.9%), FluA (52.1%), and HBoV (50.4%) (Table IV). Correlation of Specific Viruses With Age Distribution The age distribution of the patients from whom the viruses were detected was identical to the age distribution of the population sampled. Although RSV infection was detected in 26.5% of children, the frequency of RSV-positive samples decreased with increasing age. Among children in the first 6 months of life, RSV was the most common virus detected,

1251 TABLE II. Viruses Detected by Multiplex PCR From 1,980 NPA Specimens: October 2007 to August 2011

Virus RSV FluA HRV HBoV PIV3 PIV1 ADV WUPyV hMPV FluB

Positive cases

Positive constituent ratio (%)

PICU cases

PICU constituent ratio

446 386 315 135 119 82 66 53 52 29

41.03 35.51 28.98 12.42 10.95 7.54 6.07 4.88 4.78 2.67

54 8 50 5 4 2 10 2 2 3

12.11 2.07 15.87 3.70 3.36 2.44 15.15 3.77 3.85 10.34

infecting 30.5% (160/524) children (Table V). Only 19.6% of children older than 6 months of age were RSV positive (x2 ¼ 26.2, P < 0.05). While the percentage of FluA infected children rose from 18.6% to 22.9% after reaching the age of 3, the differences were not statistically significant. Similarly, no statistically significantly age group differences were observed in ADV, PIV1, PIV3, HBoV, hMPV, FluB, or WUPyV-infected individuals. Seasonal Distribution of Viruses The virus detection rate was not distributed equally during different seasons (Fig. 2). RSV was detected mostly during the spring and winter, while ADV was primarily detected in the summer. HRV was detected in all seasons but detected mostly during the end of the winter and the beginning of spring. HBoV and WUPyV were detected primarily during the spring and summer, while PIV3, FluA, PIV1, FluB, and hMPV were primarily detected in the spring. Clinical Characteristics of Patients With Viral Infection The clinical symptoms and diagnosis of the patients with viral infection are shown in Tables VI and VII. Bronchopneumonia was the most common diagnosis TABLE III. General Ward Versus PICU Admissions The general ward

Fig. 1. Identification of viral isolates by PCR analysis. M, molecular marker; lane 1, FluA, FluB, PIV1, PIV3 positive; lane 2, FluA positive; lane 3, FluB positive; lane 4, PIV1 positive; lane 5, PIV3 positive; lane 6, no template control; lane 7, RSV, HRV positive; lane 8, RSV positive; lane 9, HRV positive; lane 10, no template control; lane 11, hMPV positive; lane 12, no template control; lane 13, ADV, HBoV positive; lane 14, ADV positive; lane 15, HBoV positive; lane 16, no template control. The samples tested are from patients.

No. of samples Positive samples Total RSV FluA HRV HBoV PIV3 PIV1 ADV WUPyV hMPV FluB

PICU

1,830

150

980 392 (21.4%) 378 (20.65%) 265 (14.48%) 130 (7.10%) 115 (6.28%) 80 (4.37%) 56 (3.06%) 51 (2.79%) 50 (2.73%) 26 (1.42%)

107 54 (36%) 8 (5.33%) 50 (33%) 5 (3.33%) 4 (2.67%) 2 (1.33%) 10 (6.67%) 2 (1.33%) 2 (1.33%) 3 (2%)

x2

P-value

16.88 20.74 36.83 3.1 3.21 3.22 5.43 0.64 0.58 0.046

0.05 0.05 >0.05 >0.05

(%)

The boldness is to emphasize these results are meaningful.

J. Med. Virol. DOI 10.1002/jmv

1252

Cai et al.

TABLE IV. Pathogen Frequency in Co-Infected Samples Virus RSV FluA HRV HBoV PIV3 PIV1 ADV WUPyV hMPV FluB

Positive samples

Co-infected samples

Frequency (%)

446 386 315 135 119 82 31 53 52 29

218 201 154 68 71 57 66 29 19 17

48.95 52.12 49.08 50.37 60 68.51 48.21 54.90 36.54 58.62

for RSV, FluA, HRV, PIV3, PIV1, ADV, and WUPyV infection. HBoV and hMPV infection was more commonly associated with capillary bronchitis than bronchopneumonia. Fever, panting, and cough comprised the majority of clinical symptoms. Interestingly, two patients, one infected with WUPyV and one infected with HBoV, were diagnosed with severe encephalitis. In addition, two other patients, one infected with hMPV and one infected with HBoV, were diagnosed with respiratory failure. DISCUSSION Acute respiratory tract infections are a persistent and significant public health problem. Worldwide, they cause a greater burden of disease than human immunodeficiency virus infection, malaria, cancer, or heart attacks. It has been postulated that they cause more illness and death than any other infection, and there has been little change in mortality due to acute respiratory tract infection for more than five decades [Mizgerd, 2006; Hasan et al., 2014]. Furthermore, respiratory infections are the most lethal of diseases in developing countries [Perdue et al., 2011]. This study describes the simultaneous detection of multiple respiratory pathogens with different clinical manifestations of acute respiratory tract infection in hospitalized children. An epidemiological investigation of ten viruses was conducted over 46 months. At least one viral pathogen was detected in 54.9% (1,087/1,980) of the nasopharyngeal aspirate specimens, a rate comparable to other studies (35–78%)

Fig. 2. Seasonal distributions of individual viruses. Respiratory viruses were isolated over four seasons with their prevalence expressed as a percentage of the total.

[Bharaj et al., 2009; Sung et al., 2009; Bukhari and Elhazmi, 2013; Drieghe et al., 2014; Hasan et al., 2014]. This large number of specimens provided the study with an adequate database with which to make meaningful conclusions regarding the relative frequencies and seasonal distributions of the viruses detected and the statistical power to infer clinical correlations. Two or more pathogens were detected in 16.4% of the children, with some pathogens, such as HRV, WUPyV, and HBoV, being frequently identified as co-infections while others, including RSV and hMPV were more commonly detected as single infections. Co-infection was not associated with increased disease severity, an observation corroborated by other analyses [Canducci et al., 2008]. Patients with respiratory viral infection usually develop clinical symptoms, including fever, cough, panting, and shortness of breath. Such infections can lead to the development of bronchial pneumonia, bronchiolitis, and upper respiratory tract infection [Sung et al., 2009; Broor et al., 2013]. The study found fever and cough to be the most common clinical symptoms. Bronchopneumonia was the most common diagnosis for RSV, FluA, HRV, PIV3, PIV1, ADV, and WUPyV infection while capillary bronchitis was the most common diagnosis for HBoV and hMPV infection. The most common pathogen detected in the study was RSV. RSV is the most common cause of childhood pneumonia worldwide [Zhang et al., 2010]. In the study, 36% of RSV-positive children were admitted to the pediatric intensive care unit, while 21.4%

TABLE V. Age Group Correlation and Viral Infection

Age 6 years Total

Patients infected with each virus

Samples

Positive samples (%)

RSV

HRV

FluA

ADV

PIV3

PIV1

HBoV

hMPV

FluB

WUPyV

Total

524 466 616 262 112 1,980

85.11 82.83 88.31 84.35 76.78 85

160 103 134 34 15 446

77 75 108 37 18 315

91 80 128 64 23 386

16 17 17 8 8 66

26 31 43 16 3 119

17 21 26 12 6 82

27 32 50 17 9 135

12 10 15 15 0 52

7 6 5 8 3 29

13 11 18 10 1 53

446 386 544 221 86 1,683

J. Med. Virol. DOI 10.1002/jmv

Respiratory Virus Infections

1253 TABLE VI. Clinical Diagnosis of Patients With Virus

Virus

Number

RSV FluA HRV HBOV PIV3 PIV1 ADV WUPyV hMPV FluB Total

BPN

446 386 315 135 119 82 66 53 52 29 1,683

205 154 158 40 61 40 36 25 18 8 753

(45.9) (39.89) (50.16) (29.62) (51.26) (48.78) (54.54) (47.17) (34.61) (27.59) (44.74)

Bronchiolitis 40 77 35 23 22 25 13 10 8 10 273

URTI

(8.96) (30.05) (11.11) (17.03) (18.49) (30.48) (19.69) (18.87) (15.38) (34.48) (16.22)

27 38 47 16 24 15 3 5 5 9 189

Capillary bronchitis

(6.05) (9.84) (14.92) (11.85) (20.17) (18.29) (4.54) (9.43) (9.61) (31.03) (11.22)

130 96 40 48 12 1 12 8 19 1 349

(29.14) (24.87) (12.70) (35.56) (10.08) (1.22) (18.18) (15.1) (36.54) (3.45) (20.74)

Laryngitis 44 (9.86) 21 (5.4) 35 (11.11) 8 (5.92) 0 1 (1.22) 2 (3.03) 5 (9.43) 2 (3.85) 1 (3.45) 119 (7.07)

BPN, bronchopneumonia; URTI, upper respiratory tract infection.

were admitted to the general ward setting. Immunity to RSV infection is not permanent with repeated infections throughout life being common. Furthermore, there is no effective vaccine and anti-viral treatment is not clinically indicated nor effective [Zhang et al., 2010]. RSV is particularly prevalent in infants below the age of 6 months [Reiche and Schweiger, 2009; Moore et al., 2013], an observation that our study corroborated. Infections with FluA and HRV were also common and there were no age-specific differences between groups. For FluA infection, a small percentage of children required pediatric intensive care unit support. However, the incidence of influenza pediatric intensive care unit admissions decreased significantly compared with the general ward admissions. Conversely, the incidence of HRV in pediatric intensive care unit admissions increased significantly when compared with the general ward admissions. Adenovirus infections are associated with different clinical syndromes. The majority of adenovirus infections result in tonsillopharyngitis and respiratory illness, particularly in children [Lu et al., 2013]. Furthermore, ADV are responsible for up to 10% of lower respiratory tract infections in children [Arden et al., 2006; Moura et al., 2007; Albarbi et al., 2012; Qurei et al., 2012]. In this study, a lower rate of ADV infection was found, as well as a difference between

pediatric intensive care unit admissions and general ward admissions, even though ADV infections are being increasingly recognized as a cause of severe disease [Lynch et al., 2011]. This study identified increased detections with emerging viruses including HBoV, WUPyV, and hMPV. WU polyomavirus (WUPyV) was identified from lower respiratory tract samples in 2007 [Gaynor et al., 2007]. The prevalence rate of WUPyV infection varies from 0.4% to 13.9% among patients and asymptomatic individuals [Rao et al., 2011; Okada et al., 2013]. In this study, WUPyV infection rate was 2.7%. Previous studies have found that individuals with WUPyV infection are commonly co-infected with other viruses [Gaynor et al., 2007; Neske et al., 2008; Debiaggi et al., 2012]. In the current study, 29 of 53 patients with WUPyV infection were co-infected with at least one other virus. Human bocavirus (HBoV) was first described in September 2005 [Allander et al., 2005]. The proportion of respiratory specimens from symptomatic hospitalized children that contain HBoV sequences has ranged from 1.5% to 19% [Allander et al., 2007; Deerojanawong et al., 2013; Levican et al., 2013]. In this study, the HBoV infection rate was 6.8%. According to the literature, HBoV DNA-positive acute respiratory tract infections occur in children across a range of months, with the peak season varying from

TABLE VII. Clinical Symptoms and X-Ray Results From Infected Patients X-ray results Virus RSV FluA HRV HBoV PIV3 PIV1 ADV WUPyV hMPV FluB

Number 446 386 315 135 119 82 66 53 52 29

Fever 312 307 288 114 97 77 66 30 31 23

(69.95) (79.53) (91.43) (84.44) (81.51) (93.90) (100) (56.60) (59.61) (79.31)

Cough 446 380 267 103 109 75 57 52 40 28

Shortness of breath

Panting

(100) 145 (31.51) 215 (48.21) (98.44) 104 (26.94) 113 (29.27) (84.76) 123 (39.05) 196 (62.22) (76.30) 96 (71.11) 101 (74.81) (91.60) 46 (38.65) 25 (21.01) (91.46) 5 (6.10) 8 (9.76) (86.36) 17 (25.76) 12 (18.18) (98.11) 27 (50.94) 28 (52.83) (76.92) 23 (44.23) 25 (48.08) (96.55) 15 (51.72) 9 (31.03)

Gastroenteritis 10 12 17 9 8 10 4 5 6 3

(2.24) (3.11) (5.40) (6.67) (6.72) (12.20) (6.06) (9.43) (11.54) (10.34)

BPN changed 205 154 149 44 59 40 40 28 19 10

Bronchitis changed

No assay

(45.9) 180 (40.36) 61 (13.68) (39.89) 173 (44.82) 59 (15.28) (47.30) 84 (26.98) 82 (26.03) (32.59) 63 (46.67) 28 (20.74) (49.58) 36 (30.25) 24 (20.17) (48.78) 26 (31.70) 16 (19.51) (60.60) 25 (37.88) 1 (1.51) (52.83) 18 (33.96) 7 (13.21) (36.54) 25 (48.08) 8 (15.38) (34.48) 11 (37.93) 8 (27.59) J. Med. Virol. DOI 10.1002/jmv

1254

Cai et al.

year to year [Ahn et al., 2014]. Most researchers reporting from regions with temperate climates have observed a higher occurrence of HBoV detections during the winter and spring months [Smuts and Hardie, 2006; Tran et al., 2013]. This study found a relatively high occurrence of HBoV in the late spring and early summer in this study, consistent with previous findings [Choi et al., 2006]. This study detected one or more additional viruses in 50.4% (68/ 135) of HBoV-positive samples. Such high percentages have been reported by most studies that have investigated co-infections [Fry et al., 2007]. Previous studies have found that most children with HBoV, WUPyV, or hMPV infection had mild or moderate disease but in our studies, four patients who were positive for these emerging viruses, developed progressive diseases such as severe encephalitis or respiratory failure. It is important to examine further the propensity of HBoV, WUPyV, or hMPV to cause severe disease and the pathogenic mechanisms underlying this phenomenon. CONCLUSIONS Viral infections of the respiratory tract and the subsequent complications from these infections lead to a significant burden on healthcare systems throughout the world. Current treatments are less than ideal making clinical research and public health surveillance critical. These regionally specific findings will provide data to pediatricians and general practitioners to aid in the selection of appropriate therapies and to prevent the abuse of antibiotics. This study highlighted the incidence of respiratory pathogens in children in South China. These findings may help in the diagnosis of viral infections of the respiratory tract, in children. However, further studies with a large number of patients will increase our understanding of the pathogenesis of respiratory tract viral infections. REFERENCES Ahn JG, Choi SY, Kim DS, Kim KH. 2014. Human bocavirus isolated from children with acute respiratory tract infections in Korea, 2010–2011. J Med Virol, Jan 4 [Epub ahead of print]. Alharbi S, Van Caeseele P, Consunji-Araneta R, Zoubeidi T, Fanella S, Souid AK, Alsuwaidi AR. 2012. Epidemiology of severe pediatric adenovirus lower respiratory tract infections in Manitoba, Canada, 1991–2005. BMC Infect Dis 13:12–55. Allander T, Jartti T, Gupta S, Niesters HG, Lehtinen P, Osterback R, Vuorinen T, Waris M, Bjerkner A, Tiveljung-Lindell A, van den Hoogen BG, Hyypia T, Ruuskanen O. 2007. Human bocavirus and acute wheezing in children. Clin Infect Dis 44:904–910. Allander T, Tammi MT, Eriksson M, Bjerkner A, Tiveljung-Lindell A, Andersson B. 2005. Cloning of a human parvovirus by molecular screening of respiratory tract samples. Proc Natl Acad Sci USA 102:12891–12896. Arden KE, McErlean P, Nissen MD, Sloots TP, Mackay IM. 2006. Frequent detection of human rhinoviruses, paramyxoviruses, coronaviruses, and bocavirus during acute respiratory tractinfections. J Med Virol 78:1232–1240. Bastien N, Chui N, Robinson JL, Lee BE, Dust K, Hart L, Li Y. 2007. Detection of human bocavirus in Canadian children in a 1year study. J Clin Microbiol 45:610–613.

J. Med. Virol. DOI 10.1002/jmv

Bharaj P, Sullender WM, Kabra SK, Mani K, Cherian J, Tyagi V, Chahar HS, Kaushik S, Broor S. 2009. Respiratory viral infections detected by multiplex PCR among pediatric patients with lower respiratory tract infections seen at an urban hospital in Delhi from 2005 to 2007. Virol J 6:89–100. Bierbaum S, Forster J, Berner R, Ru¨cker G, Rohde G, NeumannHaefelin D, Panning M, study CAPNETZ group. 2013. Detection of respiratory viruses using a multiplex real-time PCR assay in Germany, 2009/10. Arch Virol, Oct 15 [Epub ahead of print]. Broor S, Dawood FS, Pandey BG, Saha S, Gupta V, Krishnan A, Rai S, Singh P, Erdman D, Lal RB. 2013. Rates of respiratory virus-associated hospitalization in children aged