Biomaterials 35 (2014) 8621e8634

Contents lists available at ScienceDirect

Biomaterials journal homepage: www.elsevier.com/locate/biomaterials

Restoration of chemosensitivity by multifunctional micelles mediated by P-gp siRNA to reverse MDR Jie Shen a, b, Qiwen Wang a, c, Qida Hu d, Yongbing Li a, b, Guping Tang a, b, **, Paul K. Chu b, * a

Institute of Chemical Biology and Pharmaceutical Chemistry, Zhejiang University, Hangzhou 310028, PR China Department of Physics & Materials Science, City University of Hong Kong, Tat Chee Avenue, Kowloon, Hong Kong, China c Department of Cardiology, The First Affiliated Hospital, Zhejiang University, School of Medicine, Hangzhou 310003, PR China d Department of Hepatobiliary and Pancreatic Surgery, The Second Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou 310009, PR China b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 9 June 2014 Accepted 17 June 2014 Available online 4 July 2014

One of the main obstacles in tumor therapy is multiple drug resistance (MDR) and an underlying mechanism of MDR is up-regulation of the transmembrane ATP-binding cassette (ABC) transporter proteins, especially P-glycoprotein (P-gp). In the synergistic treatment of siRNA and anti-cancer drug doxorubicin, it is crucial that both the siRNA and doxorubicin are simultaneously delivered to the tumor cells and the siRNA can fleetly down-regulate P-g before doxorubicin inactivates the P-gp and is pumped out. Herein, a type of micelles comprising a polycationic PEI-CyD shell to condense the siRNA and hydrophobic core to package doxorubicin is reported. The structure of the polymer is determined by 1H NMR, FT-IR, DSC, and XRD and the micelles are characterized by DLS, 2D-NOESY NMR, and TEM to study the self-assembly of the micelles with siRNA and drugs. In vitro studies demonstrate controlled release and temporal enhancement of the therapeutic efficacy of P-gp siRNA and doxorubicin. Release of siRNA down-regulates the mRNA and protein levels of P-gp in the MCF-7/ADR cell lines effectively and the accumulated doxorubicin facilitates apoptosis of the cells to reverse MDR. Moreover, in vivo research reveals that the siRNA and doxorubicin loaded micelles induce tumor cell apoptosis and inhibit the growth of MDR tumor. The western blotting and RT-PCR results illustrate that the synergistic treatment of siRNA and doxorubicin leads to efficient reduction of the P-gp expression as well as cell apoptotic induction in MDR tumors at a small dosage of 0.5 mg/kg. The micelles have large clinical potential in drug/RNAi synergistic treatment via restoration of the chemosensitivity in MDR cancer therapy. © 2014 Elsevier Ltd. All rights reserved.

Keywords: MDR Micelles siRNA Doxorubicin

1. Introduction Chemotherapy is one of the preferred techniques in cancer treatment but its success is often limited because of the phenomenon of multiple drug resistance (MDR). MDR is related to the resistance of tumor cells to many chemotherapy drugs with different structures and cellular targets. There are at least two underlying molecular mechanisms responsible for MDR. The first one is detoxification as well as inactivation of apoptosis pathways with parallel activation of anti-apoptotic cellular defense modalities, whereas the second one is the transport of drugs including decreased drug influx and increased drug efflux [1]. ATP-binding

* Corresponding author. Tel.: þ852 34427724; fax: þ852 34420542. ** Corresponding author. Tel./fax: 86 571 88273284. E-mail addresses: [email protected] (G. Tang), [email protected] (P.K. Chu). http://dx.doi.org/10.1016/j.biomaterials.2014.06.035 0142-9612/© 2014 Elsevier Ltd. All rights reserved.

cassette (ABC) transporters are a kind of transmembrane proteins which transport a wide variety of substrates across extra- and intracellular membranes including drugs. P-glycoprotein (P-gp) known as multidrug resistance protein 1 (MDR1) or ATP-binding cassette sub-family B member 1 (ABCB1) is a well-characterized ABC-transporter and found to over-express in many human cancers such as breast carcinoma and leukemia leading to a MDR [2,3]. Nowadays, the combination of RNA interference (RNAi) technology and chemotherapy is widely used to overcome MDR. RNAi is generally mediated by short hairpin RNAs (shRNA) or small interfering RNAs (siRNA) and the shRNA is expressed after nuclear delivery of shRNA-expressing plasmid DNA (pDNA). In comparison, siRNA delivery avoids the process of nuclear delivery and siRNA functions directly in the cytosol [4e8]. To achieve simultaneous delivery of nucleic acid and anti-cancer drugs, functional vehicles are widely used. Vectors such as polymers, liposomes, peptides, and mesoporous silica have been reported to deliver genes and/or drugs [9e14]. In particular, many

8622

J. Shen et al. / Biomaterials 35 (2014) 8621e8634

multifunctional micelles have been developed for intelligent targeted delivery of nucleic acid and drugs [1,15e17]. The functions of drugs and DNA/RNA loading, passive and active cancer targeting, cell membrane translocation, reduction, and pH sensitive release are integrated in the micelles. Consequently, multifunctional polymeric micelles can provide delivery of drugs and genes to the cellular and molecular targets in tumor therapy. However, in order to achieve the combination of a chemotherapeutic drug with P-gp siRNA to reverse MDR, the prerequisite is a carrier which releases the siRNA earlier than the chemotherapeutic drug so that P-gp is inactivated and the drug is subsequently inhibited from being pumped out [18]. In this work, a type of self-assembled micelles comprising the hydrophilic end of b-cyclodextrin-poly-ethylenimine (PEI-CyD) and hydrophobic end of cholesterol is reported. The hydrophobic core is capable of encapsulating the P-gp substrate doxorubicin (DOX) and meanwhile, the outer PEI-CyD is condensed with siRNA by electrostatic interaction. This double layer structure allows sequential release of siRNA and drug to increase the drug concentration in cytosol and restore the sensitivity of doxorubicin in the MDR cells. The physicochemical properties such as morphology, size, as well as release properties are determined and the ability and synergistic therapeutic effects of codelivering DOX and siRNA to MDR tumor cells are assessed in vitro and in vivo. 2. Materials and methods 2.1. Materials Polyethyleneimine (branched PEI, MW 600 Da and 25 KD), b-cyclodextrin (bCyD, MW 1135), 1,10-carbonyldiimidazole (CDI, MW 162.15), dimethyl sulfoxide (DMSO, 99.5%), [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (MTT, MW 218.1), triethylamine (TEA, 99%), and cholesterol chloroformate (MW 449.11) were obtained from Sigma (St. Louis, MO, USA). Doxorubicin hydrochloride (DOX$HCl, MW 543.52) was purchased from Haida Pharmaceutical Co., Ltd. (Hangzhou, Zhejiang, China) and DAPI was bought from the Beyotime Institute of Biotechnology (Haimen, Jiangsu, China). The negative control siRNA (siNC) and siRNA targeting green fluorescent protein (GFP-22) were purchased from Qiagen (Dusseldorf, Germany) and fluorescein-tagged negative-control siRNA (FAM-siRNA) was purchased from Biomics Biotechnologies Co., Ltd. (Nantong, Jiangsu, China). All the siRNAs and shRNA targeting ABCB1 (MDR1) were obtained from Genechem Co., Ltd. (Shanghai, China), including siRNA-1: GAACACATTGGAAGGAAAT (targeting sequence); siRNA-2: ACAGAATAGTAACTTGTTT (targeting sequence); siRNA-3: TCATCGTTTGTCTACAGTT (targeting sequence). The FITC-labeled P-gp antibody was supplied by eBioscience (San Diego, CA, USA). 2.2. Cells and animals Two types of human breast cancer cells, MCF-7 and MCF-7/ADR, were acquired from the American Type Culture Collection (ATCC, MD, USA) and the GFP expression MCF-7 cells (MCF-7/GFP) were provided by Prof. Jun Wang (University of Science and Technology of China, Hefei, China). The MCF-7 was cultured in the RPMI 1640 culture medium supplemented with 10% fetal bovine serum (FBS) in a humidified incubator at 37  C and 5% CO2. The MCF-7/GFP and MCF-7/ADR (DOX-resistant MCF-7 cell line) were cultured in Dulbecco's modified eagle medium (DMEM) with 10% fetal bovine serum (FBS) and MCF-7/ADR was maintained with free DOX at 500 ng/mL. Athymic female mice (BALB/c strain) (3e4 weeks old，12e14 g) were purchased from the Zhejiang Chinese Medical University and maintained in a pathogen-free environment under controlled humidity and temperature. The animal experiments were performed in accordance with the CAPN (China Animal Protection Law). 2.3. Synthesis and characterization of PEI-CyD-Cholesterol (PCC) The PEI-CyD (PC) backbone was synthesized as described previously [19] and synthesis of PCC is described in the following [20]. 120 mg of PC were stirred on ice in a mixture of 15 mL of anhydrous methylene chloride and 200 mL of triethylamine (TEA) for 30 min. Cholesterol chloroformate (6 mg, 12 mg, 24 mg) was dissolved in 5 mL of anhydrous ice-cold methylene chloride and then slowly added to the PC solution. The solution was stirred overnight on ice. The resulting product was dried on a rotary evaporator and then dissolved in distilled water. The solution was extracted with methylene chloride to remove the unreacted cholesterol chloroformate, filtered, and freeze-dried. The 1H nuclear magnetic resonance (1H NMR) spectra were recorded on a Unity Inova 400 spectrometer at 400 MHz. The polymers were dissolved in 0.5 mL of D2O and 1H NMR was performed on the Varian 400 MHz spectrometer for 32 scans at room temperature.

The chemical structure of the polymers was determined by Fourier-transform infrared spectroscopy (FT-IR, Varian, Excalibur™, USA), X-ray powder diffraction (MAX 2550/PC, Rigaku, JAPAN), and thermogravimetric analysis (SDT Q600 Thermogravimetric Analyzer, USA). 2.4. Characterization of PCC micelles The critical micelle concentration (CMC) was determined using pyrene as a fluorescence probe [21]. The samples were prepared by adding a known amount of pyrene in acetone to a series of 10 mL vials and then removing the acetone by evaporation. Various concentrations of PCC ranging from 1  104 to 1 mg/mL were added to each vial and the final pyrene concentration was 0.6 mM. The solutions were incubated overnight at room temperature in darkness to allow equilibration. The fluorescence excitation spectra of pyrene were recorded from 300 to 360 nm using a fluorescence spectrophotometer (RF-5301PC, Shimadzu, Japan) with an emission wavelength of 395 nm. The intensity ratios of I339/I334 from the excitation spectra were plotted against the polymer concentration to determine the CMC. The particle size and zeta potential of the free PCC micelles and PCC/plasmid complex were analyzed at 25  C by dynamic light scattering (DLS) on the Zetasizer 3000 (Malvern Instruments, Worcestershire, UK). Gel electrophoresis was performed at room temperature in the TAE buffer in 1% (w/w) agarose gel at 80 V for 40 min. The complexes of PCCs and plasmid at various w/w ratios were separately electrophoresed in the agarose gel with the naked DNA serving as a reference. The plasmid was visualized by a UV (254 nm) illuminator. The DOX-loaded micelles were prepared by the emulsion method. Briefly, 2.5 mg of DOX$HCl were dissolved in 2 mL of chloroform with 3.0 equivalent of TEA to remove the hydrochloric acid [22]. The oil phase was slowly injected into 20 mL of a stirred aqueous solution of 7.5 mg PCC. The mixture was stirred overnight in darkness and open atmosphere conditions at 25  C allowing the chloroform to evaporate. The solution was filtered by 0.45 mm filters and freeze-dried to obtain the DOX-loaded PCC micelles. The drug loading content was measured by a UV-vis spectrophotometer (UV2800, Hitachi, Japan). 2.5 mg of the freeze-dried PCC/DOX micelles were dissolved in 25 mL of DMSO and were assessed at l ¼ 482 nm. The calibration curve was established under the same conditions. The drug loading content (LC) of PCC/DOX micelles for DOX was calculated by the following formula: LC ¼ mass of DOX encapsulated in micelles=mass of micelles  100%: The 2D-NOESY NMR spectra of the PCC/DOX micelles were acquired on a Bruker AVANCE III 500 spectrometer (Bruker, Ettlingen, Germany) at room temperature using D2O as the solvent. The morphology of the free PCC micelles, PCC/plasmid complex, DOX-loaded micelles, and PCC/DOX/plasmid was examined by transmission electron microscopy (TEM, HT-7700, Hitachi, Japan). And the morphology of PCC/DOX/siRNA was imaged by confocal microscopy. Briefly, PCC/DOX/siRNA was prepared by mixing PCC/DOX micelle with FAM-NC for about 30 min. Then 10 mL of the sample was first immobilized by mixing with 10 mL of 2% low melting point agarose on a standard glass slide. When the agarose gel solidified, the confocal images were immediately collected using Zeiss LSM software on a Zeiss LSM 510 inverted microscope equipped with a 100 apochromatic oil objective. Volocity 3D Image Analysis Software (PerkinElmer) was used for three dimensional reconstructions. The in vitro release behavior of the DOX-loaded micelles was monitored as follows. 1 mg of PCC/DOX or PCC/DOX with plasmid complex (w/w ¼ 10) was dissolved in 2 mL of PBS at pH values of 5.0 and 7.4 and sealed in dialysis bags (MCWO 8000e14,000). The solutions were dialyzed against 25 mL of PBS at 37  C under stirring at 100 rpm on an orbital shaker. At defined time points, 2 mL of the medium were taken out and replenished with an equal volume of the fresh medium. The amount of DOX released was measured by fluorescence spectrophotometer (RF5301PC, Shimadzu, Japan) at an emission wavelength of 558 nm and excitation wavelength of 502 nm. The standard curves at different pH values were also established. 2.5. In vitro biological characterization of PCC The cytotoxicity of the PCC was evaluated by the MTT assay using MCF-7 and MCF-7/ADR cells. Generally, the cells were seeded on a 96-well tissue culture plate at a density of 1  104 cells/well in 200 mL of 1640 or DMEM medium containing 10% serum for 18 h separately. The medium was replaced with 200 mL of serum-free one containing serial dilutions of polymer solutions for 4 h. The solutions were then replaced with 100 mL of the serum-free medium containing 0.5 mg/mL MTT and incubated for another 4 h. Finally, each well was replaced with 100 mL of DMSO and measured spectrophotometrically on an ELISA plate reader (Model 550, Bio-Rad) at a wavelength 570 nm. The relative cell growth (%) related to control cells cultured in the media without the polymer was calculated by the following formula: V% ¼ ð½Aexperimental  ½AblankÞ=ð½Acontrol  ½AblankÞ  100%: The cellular uptake and distribution of micelles were examined by confocal microscopy using the MCF-7 and MCF-7/ADR cell lines. The cells were seeded on 24well plates and grown for 18 h. The medium was changed to serum-free 1640 or

J. Shen et al. / Biomaterials 35 (2014) 8621e8634 DMEM containing micelles pre-mixed with 0.3 mg of FAM-NC (DOX at a concentration of 2.5 mg/mL). At the designed time points, the cells were rinsed with PBS, fixed with fresh 4% paraformaldehyde, and treated with DAPI for 10 min. The confocal images were acquired on a scanning laser confocal microscope (Leica SPE). 2.6. Inhibition of ABCB1 expression by the micelle/siRNA complex The silence efficiency of siRNA-1/-2/-3 was determined by flow cytometric analysis using the immunofluorescence method [23]. The MCF-7/ADR cells were incubated on 24-well plates as described above. 0.33 mg siRNA-1/-2/-3 or siNC were mixed with PCC micelle at a w/w ratio of 10 for 30 min and then the cells were incubated with the siRNA/micelle complex solution for 4 h and grown for additional 24 h. The FITC-labeled P-gp antibody was added to the cells according to the established protocol (eBioscience, CA, USA). The cells were washed by PBS, trypsinized, and suspended in PBS and the amount of P-gp in cells was quantified by a flow cytometer (BeckmaneCoulter, USA) using the FL-1 detection channel. The mean

8623

fluorescence of the FL1 population (an indicative of P-gp amount in all cells) was normalized against the mean fluorescence of the control and used as %P-gp expression. In the green fluorescent protein (GFP) silencing study, GFP-expressing MCF7 cells (MCF-7/GFP) were used as a model. The siRNA complex formation and delivery to cells were performed as described above utilizing GFP specific siRNA (GFP22) and negative control (siNC) [24]. GFP silencing was assessed by flow cytometry after cell fixation and the Geo mean was used to calculate the decrease in green fluorescence of GFP. The DOX accumulation in MCF-7/ADR cells was first shown by in vitro cellular assay [25]. The MCF-7/ADR cells were seeded on 24-well plate at a density of 5  104 in DMEM medium containing 10% FBS for 18 h. The medium was then replaced by 1 mL of DMEM (serum free), free DOX, PCC/DOX, PCC/DOX/siRNA, and PCC/DOX/ shRNA-plasmid and incubated for 4 h at a DOX concentration of 100 mg/mL. After the medium was taken out, the cells were washed and replenished with 1 mL of fresh DMEM (containing serum) at defined time points. The fluorescence intensity of

Scheme 1. Schematic illustration of combination of siRNA and DOX using a multifunctional micelle.

8624

J. Shen et al. / Biomaterials 35 (2014) 8621e8634

DOX in the medium was measured by fluorescence spectrophotometry (RF-5301PC, Shimadzu, Japan) and DOX accumulation was also detected by confocal microscopy [26]. The cells were incubated with the serum-free medium containing the PCC/ DOX/siRNA complex (0.33 mg siRNA, DOX concentration was 2.5 mg/mL) or PCC/DOX, rinsed, fixed, and stained at indicated time points. Moreover, the cells with the same treatment were washed, trypsinized, and collected for flow cytometric analysis after incubation for 24 h. Quantitative reverse transcription (RT)-PCR was used in the analysis of the MCF7 and MCF-7/ADR cell lines expression of genes encoding P-gp and apoptosis-related proteins such as Bcl-2 and Bax. The cells were treated with the PCC/DOX/siRNA complex, PCC/DOX, and free DOX as described above, respectively. The medium was replaced by fresh DMEM containing 10% FBS after incubation for 4 h and the cells were incubated for another 48 h, collected to extract mRNA, and reverse-transcribed into cDNA. The following pairs of primers were used (50 e30 ): ABCB1 d AACGGAAGCCAGAACATTCC (sense), AGGCTTCCTGTGGCAAAGAG (antisense); Bcl-2 d GTGGAGGAGCTCTTCAGGGA (sense), AGGCACCCAGGGTGATGCAA (antisense); Bax d GGCCCACCAGCTCTGAGCAGA (sense), GCCACGTGGGCGTCCCAAAGT (antisense); GAPDH (internal standard) d AAGGTCGGAGTCAACGGATTT (sense), AGATGATGACCCTTTTGGCTC (antisense). The PCR parameters consisted of 5 min of Taq activation at 95  C, followed by 32 cycles of 95  C  30 s, 56  C  45 s, and 72  C  45 s.

The relative gene expression values were determined using the BandScan4.3 software and the data presenting the MDR1, Bcl-2, and Bax expression were normalized to the housekeeping gene GAPDH as the endogenous reference. In the western blotting analysis, the cell proteins were extracted after the same treatment as RT-PCR and the total protein was quantified by the BCA protein assay kit (Promega, USA). An equal amount of protein was separated on the SDS-PAGE, transferred onto the nitro-cellulose membrane, blocked, and incubated overnight with monoclonal antibodies against P-gp, Bcl-2 and Bax. After washing, the membrane was incubated with the HRP-conjugated secondary antibody for 2 h at room temperature. The bands were visualized using the Westzol enhanced chemiluminescence kit (Intron, Sungnam, Korea) and the expression was normalized to the housekeeping gene expression. 2.7. In vivo tumor therapy The MCF-7 and MCF-7/ADR cells were inoculated subcutaneously at an injection volume of 0.1 mL containing 5  106 and 1  107 cells at the abdominal of BALB/c nude mice, respectively. The mice were assigned to four groups and treated with the PCC/DOX/siRNA complex, PCC/DOX, free DOX, and PBS at 0.5 mg/kg equivalent DOX and 6.5 mg of siRNA-3 via intra-tumor injection when the tumor

Fig. 1. (a) Synthesis route of PEI-CyD-cholesterol (PCC). (b) 1H NMR spectra of PCCs in D2O. (c) Fluorescence intensity I339/I334 of PCCs.

J. Shen et al. / Biomaterials 35 (2014) 8621e8634

8625

Table 1 Physicochemical parameters of PCCs.

PCC-1 PCC-2 PCC-3

Graft degree (%)

CMC (mg/ml)

Size (nm)

Zeta-potential (mV)

Drug loading content (w/w, %)

5.2 ± 1.1% 7.9 ± 2.3% 18.6 ± 3.3%

0.040 ± 0.001 0.039 ± 0.001 0.033 þ 0.002

242.2 ± 23.4 213.8 ± 60.3 232.3 ± 22.6

28.4 ± 1.53 23.3 ± 0.53 28.3 ± 1.96

5.43 ± 1.28 7.44 ± 2.15 12.83 ± 2.04

grew to a diameter of around 5 mm. Each treatment group was composed of eight mice (n ¼ 8) for antitumor therapy and three mice (n ¼ 3) for RT-PCR and western blotting analysis. The treatment was performed twice a week for 2 weeks and tumor growth was also monitored by calipers twice a week. The tumor volume (V) was calculated by the following formula: tumor volume V (mm3) ¼ p/6  length (mm)  width (mm)2. Relative Tumor Volume (RTV) ¼ V0/Vd. In the RT-PCR and western blotting analysis,

the mice from each group were sacrificed 48 h after the last injection. Their tumors were extracted and the other approach was the same as described above. 2.8. Statistical analysis The data were expressed as means ± standard deviation. The statistical significance (p < 0.05) was evaluated by the Student t-test or one-way analysis of variance

Fig. 2. (a) XRD patterns of cholesterol chloroformate, PC and PCC. (b) FT-IR spectra of cholesterol chloroformate, PC and PCC. (c) Differential scanning calorimetry (DSC) curves of cholesterol chloroformate, PC and PCC.

8626

J. Shen et al. / Biomaterials 35 (2014) 8621e8634

Fig. 3. (a) TEM images of PCC micelle, PCC/plasmid complex at w/w ratio of 10, DOX-loaded PCC micelle, and DOX-loaded PCC micelle mixed with plasmid at w/w ratio of 10. (b) Particle size of PCC/plasmid complexes at different w/w ratios. (c) Release of DOX from PCC micelle and PCC/plasmid complex at pH value of 5.0 and 7.4. Data are shown as mean ± SD (n ¼ 3).

(ANOVA) followed by Bonferroni's post hoc test. In all the tests, the statistical significance was set at p < 0.05.

3. Results 3.1. Formation and characterization of PCC micelles The functions of the PCC micelles formed with DOX and siRNA are to release siRNA, down-regulate P-gp firstly to inhibit the multiple drug resistance (MDR), and then restore doxorubicin chemosensitivity when it is released thereafter (Scheme 1). The amphiphilic polycationic PCC is synthesized in two steps using PEI (Mw ¼ 600 Da), b-CyD, and cholesterol chloroformate. The copolymer PC is synthesized and conjugated with cholesterol chloroformate via amide linkage (Fig. 1a). According to the 1H NMR spectrum of PCC (Fig. 1b.), PCC is successfully synthesized. The multiple peaks at d 2.3e2.8 ppm are attributed to the protons of eCH2-CH2-N in PEI 600. The protons at d 4.8 ppm are associated with the H (c) in b-CyD and those at d 3.0e4.0 ppm are associated with the methoxyl groups of b-CyD. The weak and multiple peaks at d 0.7e1.3 ppm are methyl, methylene, and methane in cholesterol [20,27]. Based on the peak area of H (c) in b-CyD (d 4.8 ppm) and protons in cholesterol (H (a), H (b)), the graft ratio of cholesterol in the polymer is estimated and listed in Table 1. To assess the feasibility of co-delivery of drug and siRNA by the polymer, several physicochemical properties are determined. The

Fig. 4. 2D-NOESY NMR spectrum of PCC/DOX in D2O.

J. Shen et al. / Biomaterials 35 (2014) 8621e8634

8627

Fig. 5. Fluorescent confocal microscopic images of PCC/DOX/siRNA. The FAM-siRNA is shown in green and the drug DOX is shown in red (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.).

critical micelle concentration (CMC) of PCC in distilled water is determined to be between 0.03 mg/mL and 0.04 mg/mL (Fig. 1c.), indicating that the micelles are self-assembled in water. PCC-3 has a smaller CMC due to the larger hydrophobic interaction in the system (Table 1). The zeta-potential and average hydrodynamic diameter are shown in Table 1, demonstrating that regardless of the grafting degree, there are few significant differences among the three polymers. The structure is determined by XRD, FT-IR and DSC and Fig. 2 shows the difference between cholesterol, PC, and synthesized PCC. XRD is used to confirm the crystal structure. As cholesterol is conjugated with PC, the crystal structure of cholesterol chloroformate disappears from PCC. There are a few differences between PC and PCC confirming the presence of cholesterol in PCC (Fig. 2a). In the FT-IR spectra, the carbonyl band at 1776 cm1 in Fig. 2b arises from the stretching vibration of C]O in cholesterol chloroformate. After conjugation, a new carbonyl band appears at 1633 cm1, confirming the presence of newly formed acylamino in PCC. The stretching vibration at ~1705 cm1 suggests the existence of ester carbonyl and acylamino in PC. The DSC curves provide additional evidence of the formation of PCC and the degradation temperature of PCC is about 10  C lower than that of PC (Fig. 2c). In the gene binding capability study, migration in agarose gel is shown in Fig. S1. The results show that PCC-1, PCC-2, and PCC-3 can fully retard migration of plasmid in the agarose gel at w/w ratios of 0.88, 1.04 and 1.36, respectively. Obviously, when cholesterol is

grafted, the amino groups react and decrease and the data demonstrate that the plasmid binding ability depends on the amount of amino groups. The in vitro cytotoxicity is investigated to ensure the biocompatibility of the polymer (Fig. S2). All PCCs exhibit a low cytotoxicity in both MCF-7 and MCF-7/ADR cells. In our previous study, backbone PC shows excellent biocompatibility both in vitro and in vivo [28,29]. After cholesterol is grafted, the cytotoxicity of the micelles is the same or slightly smaller than that of PC. This may benefit from the characteristics of cholesterol, a lipid molecule existing widely in animal tissues. It is an essential structural component of animal cell membranes required to establish the proper membrane permeability and fluidity. Therefore, the introduction of cholesterol increases the membrane compatibility of the polymer and mitigates the cytotoxicity slightly. In the designed micelle system, cholesterol and DOX constitute the core due to the hydrophobic interaction. The DOX-loaded micelles are prepared by the emulsion method and the drug loading capacity of PCC with different grafted degree is displayed in Table 1. The loading capacity of PCC-3 micelles which have a higher cholesterol graft degree is larger than the others. Therefore, considering the physicochemical properties and cytotoxicity, PCC with the largest graft degree (PCC-3) is the optimal one to form a stable and functional micelle vector. Fig. 3a and b provides the visual morphological evidence and particle size about the formation of PCC-3 micelles. As shown in

8628

J. Shen et al. / Biomaterials 35 (2014) 8621e8634

Fig. 6. Fluorescent confocal microscopic images of in vitro cellular uptake of MCF-7 and MCF-7/ADR cell lines treated with free FAM-siRNA, free DOX, PCC/FAM-siRNA complex, DOX-loaded PCC micelle, PCC/DOX/FAM-siRNA for 4 h and 24 h, where the FAM-siRNA is shown in green, the drug DOX is shown in red, and the DAPI nuclear stain is shown in blue (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.).

Fig. 3a, the polymer PCC-3 mixed with either plasmid or drug results in a size increase and the TEM image of PCC/DOX shows different densities in the core and shell. However, these differences in density are not found from the photograph of PCC/DOX/plasmid as the introduction of plasmid provides electrostatic interaction in the shell and compacts the micelle. This PCC-3 forms a stable complex with plasmid in the aqueous solution at the w/w of 10 (Fig. 3b). The in vitro drug release behavior of either DOX or gene/DOX containing PCC micelles is verified and compared in aqueous solutions at pH of 7.4 and 5.0. As shown in Fig. 3c, DOX exhibits

pH-dependent dissociation which shows a smaller release rate at the blood pH (pH ¼ 7.4) and larger rate at lower pH (pH ¼ 5.0) in the lysosomal environment. The gene/DOX double-loaded micelles exhibit a hysteretic release behavior in comparison with the micelles loaded DOX. The accumulative release rate of the PCC/DOX/plasmid micelle at 48 h is similar to that of the PCC/ DOX micelle at 12 h at a pH of 5.0. It can be explained by that when the gene and cationic polymer are twinned at the outer layer of the micelle, they cover the core compactly and delay the release of DOX.

J. Shen et al. / Biomaterials 35 (2014) 8621e8634

8629

Fig. 7. (a,b) Silence efficiency of siRNA-1/-2/-3 determined by flow cytometer analysis using the immunofluorescence method. (c,d) Down-regulation of green fluorescent protein (GFP) determined by flow cytometry in MCF-7/GFP cells treated with the PCC/GFP-22 complex at different w/w ratios.

The 2D-NOESY NMR spectrum confirms the interaction between the drug and cholesterol core in the PCC/DOX micelle. From the spectrum (Fig. 4), the signals of the methyl, methylene and methane in cholesterol are correlated with the protons of doxorubicin at d 3.0e4.0 ppm. The confocal image of PCC/DOX/siRNA also provides evidence about the 3D morphology of drug/gene codelivery micelle. The subglobular micelle in Fig. 5 shows a 3D structure of PCC/DOX/siRNA. The red DOX distributes in the centre of the micelle and green siRNA is around (white circle). 3.2. Synergistic effects of P-gp siRNA and DOX in vitro In the attempt to visualize the distribution of siRNA and drug after incubating for different time durations, cellular uptake of PCC3/DOX/FAM-siRNA is performed and imaged (DOX: red; FAMsiRNA: green; nucleus: blue). Fig. 6 suggests that the complex micelle is able to co-deliver the drug and siRNA to one cell efficiently in comparison to free DOX or siRNA. Moreover, the drug and siRNA delivered by the micelle simultaneously remain in the cells for over 24 h during incubation giving rise to cooperative effects on the cancer cells. To select an optimal siRNA from the three siRNAs, the FITClabeled P-gp antibody is used to quantify the amount of P-gp on the cell membrane based on the antigeneantibody reaction [23]. The suppression of P-gp by the three different siRNAs is shown in

Fig. 7a and b. The siRNA-3 is the best among the three siRNAs and the GFP silencing assay is used to obtain the optimal condition in RNA interference. According to Fig. 7c and d, the expression of GFP at 48 h is lower than that at 24 h and the most efficient w/w ratio is 10. The combination of DOX and siRNA-3 is initially reflected by the drug accumulation (Fig. 8). The DOX amount in the medium of siRNA and shRNA-plasmid mediated MCF-7/ADR cell is a little smaller than PCC/DOX, indicating the RNAi successfully silences the ABCB1 gene and avoids DOX from being pumped out by P-gp. In the first two days, in contrast to the cells incubated with shRNAplasmid, a slighter efflux of DOX in MCF-7/ADR induced by siRNA is achieved from the faster and direct effect of siRNA in the cytosol (Fig. 8a). In the confocal microscopic results (Fig. 8b), the siRNA treated MCF-7/ADR cells show stronger red fluorescence than the cells in the absence of siRNA. The quantity of DOX accumulation at 24 h is estimated by flow cytometry (Fig. S3). The mean fluorescence from the DOX-positive MCF-7/ADR cells treated with PCC/ DOX or PCC/DOX/siRNA are 25.54 and 28.41, respectively. The data are consistent with the confocal microscopy images in Fig. 8b, demonstrating that the siRNA coordinated with DOX enhances the drug concentration in cells. To obtain further insights into the synergistic effects of the micelle co-delivering DOX and siRNA-3, the mRNA and protein level of P-gp, Bcl-2 and Bax are assessed after incubation for 48 h

8630

J. Shen et al. / Biomaterials 35 (2014) 8621e8634

Fig. 9 presents the results of western blotting and RT-PCR. The p-gp in the MCF-7/ADR cells is over-expressed in comparison with the MCF-7 cell line because MCF-7/ADR is a kind of MDR cells. The treatment of cells with micelles in the absence of siRNA does not lead to P-gp suppression. The protein and mRNA level of ABCB1 are reduced in both the MCF-7 and MCF-7/ADR cells by treatment of PCC/siRNA and PCC/DOX/siRNA due to gene-silencing mediated by siRNA. The protein and mRNA levels of Bcl-2 and Bax are separately decreased and increased, resulting in decreasing Bcl-2/Bax ratios when the cells are fed with DOX-loaded micelles. 3.3. In vivo MDR tumor therapy Whether or not the synergistic effects translate into MDR tumor growth inhibition in vivo is investigated. Mice bearing MCF-7 and MCF-7/ADR xenografts are treated with the PCC/DOX/siRNA and various other formulations by intratumoral injection twice a week for 2 weeks. The four mice groups are tested, including PBS, free DOX, PCC/DOX and PCC/DOX/siRNA complex. A representative mouse in each group is pictured at day 0 and 7 and three mice are for WB and RT-PCR. The PCC/DOX/siRNA treated group shows the most effective inhibition in tumor growth (Fig. 10). At a DOX dosage of 0.5 mg/kg, free DOX has few suppression of MDR tumor. However, the PCC/DOX/siRNA complex (DOX dosage of 0.5 mg/kg) sufficiently inhibits the tumor growth at day 10 (Fig. 10b). As the MCF7 tumor grows faster than MCF-7/ADR tumor, the PBS treated mice bearing MCF-7 xenografts show rapid death at day 17. The survival rates of mice bearing the MCF-7 and MCF-7/ADR tumors treated with PCC/DOX/siRNA are 100%, but a small dose of DOX stimulates the growth of drug resistance tumor so that the free DOX group exhibits a small quantity of death (Fig. S4). The results of WB and RT-PCR are similar to the in vitro data, revealing the same mechanism of siRNA and DOX combination in vivo (Fig. 11.). Briefly, the siRNA interferes with the expression of P-gp leading to an enhancement in the drug sensitivity in the tumor cells. As shown in Fig. 11a, the expression of P-gp in the MCF-7/ ADR tumor is much higher than that in the MCF-7 tumor. The group mediated by siRNA shows the most obvious changes in both MDR and apoptosis-related proteins. 4. Discussion In our previous research, polycationic PEI-CyD (PC) is shown to possess the functions of drug, plasmid, and RNA delivery [30e32]. In this work, the PC is first used as a hydrophilic group and conjugated with cholesterol. The PEI-CyD-cholesterol (PCC) micelle is self-assembled by a hydrophobic core and cationic shell in an aqueous solution. The cholesterol core encapsulates the lipid-soluble drug and the cationic shell interacts with the negatively charged siRNA due to the positive charge of PEI. The CyD exposed on the surface improves the biocompatibility of this micelle. To select a stable and functional PCC, polymers with different graft degree of cholesterol are synthesized and characterized. CMC is an important parameter of an amphiphilic copolymer in the formation of coreeshell structured micelles. PCC-3 with a lower CMC of 0.033 mg/mL (Table 1) can self-assemble more stably in solutions than PCC-1 and PCC-2. The positive charge and suitable size of the polymers are prerequisites to delivering gene across the cell membrane. As shown in Table 1, the particle size of these three PCCs is around 250 nm which is suitable for endocytosis. Benefitting from the positive charge of PEI, the gene binding capability of polymers has a w/w ratio of about 1. In addition, the cytotoxicity of all three polymers is similar. Overall, by considering the higher

Fig. 8. DOX accumulation in MCF-7/ADR cells in the present of siMDR1. (a) Red fluorescence intensity changes of the medium in the presence of free DOX, PCC/DOX, PCC/ DOX/siRNA, and PCC/DOX/shRNA-plasmid (at 100 mg/mL equivalent DOX concentration). Data are shown as mean ± SD (n ¼ 3). (b) Fluorescent confocal microscopic images of MCF-7/ADR cells incubated with PCC/DOX and PCC/DOX/siRNA for 12, 24, and 48 h.

stability, similar gene binding capability, and cytotoxicity, PCC-3 is an optimal polymer to achieve the co-delivery of drug and gene. We then investigate if the drug/gene co-delivery micelle can achieve the release behavior as designed. Fig. 3c shows the difference in the drug release between the gene-loading and normal particles. The hysteretic release of DOX in the gene encapsulated micelle is explained by the electrostatic interaction of cationic PEI-CyD and negative charged gene. It enables better accumulation of DOX after siRNA release. The structure is also determined by TEM, 2D-NOESY NMR, and confocal microscopy. As shown in Fig. 4, the signals of cholesterol and DOX are well correlated, indicating the formation of hydrophobic core. According to the TEM image (Fig. 3a), the size increases and density changes after co-delivering drug and gene. Afterwards, the confocal image provides visible evidence about the 3D structure of the drug/gene co-delivery micelle. A hydrophobic core comprising DOX is obviously presented and green siRNA is distributed around the core (Fig. 5). Based on the results obtained from the structural and release behavior studies, we verify the synergistic functions of siRNA and DOX. Functional siRNA is used to silence the expression of P-gp, the most common and important protein involved in ATP-dependent efflux of drugs. The P-gp has a broad substrate family of drugs such as anthracyclines, taxanes, vinca alkaloids, and epipodophyllo toxin [33]. DOX, a nonselective class I anthracycline, is an effective substrate of P-gp. Thus, the hypothesized mechanism is that the micelle delivered to the cells releases the surface siRNA and knocks

J. Shen et al. / Biomaterials 35 (2014) 8621e8634

8631

Fig. 9. (a) Representative P-gp, Bcl-2 and Bax protein expression determined by Western blot analysis in MCF-7 and MCF-7/ADR cell lines at 48 h. (b) Analysis of light intensities of P-gp, Bcl-2 and Bax protein expression in MCF-7 and MCF-7/ADR from Western blot results. (c) Expression of P-gp, Bcl-2 and Bax mRNA in MCF-7 and MCF-7/ADR determined by quantitative real-time PCR at 48 h. The data are shown as mean ± SD (n ¼ 3) and *p < 0.05 versus the control.

8632

J. Shen et al. / Biomaterials 35 (2014) 8621e8634

Fig. 10. Antitumoral therapeutic effects of PBS, free DOX, PCC/DOX, PCC/DOX/siRNA complexes in tumor-bearing BALB/c: (a) Images of in vivo tumor growth. (b) Relative tumor volume (RTV) with increasing time.

down the expression of P-gp. DOX then accumulates at an enhanced concentration resulting in restoration of chemosensitivity and damaging the cell. We then examine the DOX concentration in cytoplasm after mediated by PCC/DOX/siRNA. The images shown in Fig. 8b suggest that DOX accumulates in the cell longer when siRNA is present. Fig. 8a shows the difference between free DOX and encapsulated DOX in the culture medium, demonstrating that endocytosis of polymer particle can avoid efflux of drugs. A small difference between siRNA and shRNA is found from Fig. 8a maybe because of the different mechanisms of siRNA and shRNA as mentioned above. More studies are carried out to confirm the synergistic therapy and restoration of chemosensitivity. The in vitro and in vivo results of WB and RT-PCR reveal the process of restoration of chemosensitivity (Figs. 9 and 11). DOX binds to DNA-associated enzymes and can intercalate the base pairs of the DNA double helix. By binding to multiple molecular targets such as topoisomerase enzymes I and II, many cytotoxic effects occur resulting in DNA damage. The apoptosis pathway is triggered when the attempt to repair the breaks in DNA fails [34]. The Bcl-2 and Bax genes are the members of the Bcl-2 family of the regulatory proteins that regulate cell apoptosis. The Bcl-2 gene has been identified as a cause of resistance to cancer treatment because of the antiapoptotic activity of Bcl-2 protein, and Bax promotes apoptosis by competing with Bcl-2 [35,36]. Therefore, the Bcl-2/Bax ratio is identified as a rheostat that determines the susceptibility to cell apoptosis [37].

Overall, DOX leads to cell apoptosis and then Bcl-2 and Bax are detected as indicators of apoptotic response. We compare the protein and mRNA levels of Bcl-2 and Bax of cells fed with DOXloaded micelles and discover that although PCC/DOX also increases the concentration of DOX (Fig. 8a), introduction of siRNA is more important to the restoration of the DOX sensitivity (Figs. 9 and 11). The P-gp is down-regulated as a result of siRNA silencing. Briefly, when siRNA is delivered to the cytoplasm, it is activated by binding to the RNA induced silencing complex (RISC). An oligonucleotide is produced and binds to a specific sequence on the P-gp mRNA, causing cleavage and disposal of the P-gp mRNA [33]. Consequently, the synergistic use of PCC/DOX/siRNA yields the most obvious function of MDR reversal via the following process. The drug efflux pump, P-gp, is knocked down mediated by siRNA, DOX accumulates and functions in the DOX resistant cells, and cell apoptosis occurs. Afterwards, tumor therapy experiment shows the efficacy of PCC/DOX/siRNA again (Fig. 10). Therefore, this micelle system has large potential with regard to MDR reversal in chemotherapy. 5. Conclusion A multifunctional micelle is designed and produced to achieve combined delivery of drug and gene to reverse MDR. The micelles possess excellent ability in the in vitro study. The PCC/DOX/siRNA system can produce early release of siRNA to knock down the

J. Shen et al. / Biomaterials 35 (2014) 8621e8634

8633

Fig. 11. (a) Representative P-gp, Bcl-2 and Bax protein expression determined by Western blot analysis in MCF-7 and MCF-7/ADR tumors 48 h after last injection. (b) Analysis of light intensities of P-gp, Bcl-2 and Bax protein expression from Western blot results. (c) Expression of P-gp, Bcl-2 and Bax mRNA in tumors determined by quantitative real-time PCR 48 h after the last injection. The data are shown as mean ± SD (n ¼ 3) and *p < 0.05 versus the control.

8634

J. Shen et al. / Biomaterials 35 (2014) 8621e8634

ABCB1 gene and avoid DOX efflux. Hysteretic release of DOX increases the intracellular drug concentration. These two steps restore the chemosensitivity of DOX in the MDR cells and accomplish reversal of MDR. Consequently, the PCC/DOX/siRNA system results in large cell apoptosis in vitro. As apoptosis benefits tumor inhibition, in vivo experiments using MCF-7 and MCF-7/ADR tumor demonstrate that the micelles influence the relative proteins from the gene level and inhibit tumor growth. The drug/siRNA codelivery micelles are useful to combination therapy for MDR reversal. Acknowledgments This work was jointly supported by National Natural Science Foundation of China (Grant no. 21374098), National Program on Key Basic Research Project (2014CB931901), as well as Hong Kong Research Grants Council (RGC) General Research Funds (GRF) No. 112212. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.biomaterials.2014.06.035. References [1] Shapira A, Livney YD, Broxterman HJ, Assaraf YG. Nanomedicine for targeted cancer therapy: towards the overcoming of drug resistance. Drug Resist Updat 2011;14:150e63. [2] Gottesman MM, Fojo T, Bates SE. Multidrug resistance in cancer: role of ATPdependent transporters. Nat Rev Cancer 2002;2:48e58. [3] Lebedeva IV, Pande P, Patton WF. Sensitive and specific fluorescent probes for functional analysis of the three major types of mammalian ABC transporters. PLoS One 2011;6:e22429. [4] Stege A, Kruhn A, Lage H. Overcoming multidrug resistance by RNA interference. Methods Mol Biol 2010;596:447e65. [5] Hannon GJ. RNA interference. Nature 2002;418:244e51. [6] Wu H, Hait WN, Yang JM. Small interfering RNA-induced suppression of MDR1 (P-glycoprotein) restores sensitivity to multidrug-resistant cancer cells. Cancer Res 2003;63:1515e9. [7] Aagaard L, Rossi JJ. RNAi therapeutics: principles, prospects and challenges. Adv Drug Deliv Rev 2007;59:75e86. [8] Takahashi Y, Nishikawa M, Takakura Y. Nonviral vector-mediated RNA interference: its gene silencing characteristics and important factors to achieve RNAi-based gene therapy. Adv Drug Deliv Rev 2009;61:760e6. [9] Abbasi M, Lavasanifar A, Berthiaume LG, Weinfeld M, Uludag H. Cationic polymer-mediated small interfering RNA delivery for P-glycoprotein downregulation in tumor cells. Cancer 2010;116:5544e54. [10] Navarro G, Sawant RR, Biswas S, Essex S, Tros de Ilarduya C, Torchilin VP. Pglycoprotein silencing with siRNA delivered by DOPE-modified PEI overcomes doxorubicin resistance in breast cancer cells. Nanomedicine (Lond) 2012;7:65e78. [11] Saad M, Garbuzenko OB, Minko T. Co-delivery of siRNA and an anticancer drug for treatment of multidrug-resistant cancer. Nanomedicine (Lond) 2008;3:761e76. [12] Iyer AK, Singh A, Ganta S, Amiji MM. Role of integrated cancer nanomedicine in overcoming drug resistance. Adv Drug Deliv Rev 2013;65:1784e802. [13] Meng H, Mai WX, Zhang HY, Xue M, Xia T, Lin SJ, et al. Codelivery of an optimal drug/siRNA combination using mesoporous silica nanoparticles to overcome drug resistance in breast cancer in vitro and in vivo. ACS Nano 2013;7:994e1005. [14] Li J, Wang Y, Zhu Y, Oupicky D. Recent advances in delivery of drug-nucleic acid combinations for cancer treatment. J Control Release 2013;172:589e600.

[15] Dai J, Lin S, Cheng D, Zou S, Shuai X. Interlayer-crosslinked micelle with partially hydrated core showing reduction and pH dual sensitivity for pinpointed intracellular drug release. Angew Chem Int Ed Engl 2011;50:9404e8. [16] Chen W, Yuan Y, Cheng D, Chen J, Wang L, Shuai X. Co-delivery of doxorubicin and siRNA with reduction and pH dually sensitive nanocarrier for synergistic cancer therapy. Small 2014;10. http://dx.doi.org/10.1002/smll.201303951. published online. [17] Xiong XB, Lavasanifar A. Traceable multifunctional micellar nanocarriers for cancer-targeted co-delivery of MDR-1 siRNA and doxorubicin. ACS Nano 2011;5:5202e13. [18] Duan X, Xiao J, Yin Q, Zhang Z, Yu H, Mao S, et al. Smart pH-sensitive and temporal-controlled polymeric micelles for effective combination therapy of doxorubicin and disulfiram. ACS Nano 2013;7:5858e69. [19] Tang GP, Guo HY, Alexis F, Wang X, Zeng S, Lim TM, et al. Low molecular weight polyethylenimines linked by beta-cyclodextrin for gene transfer into the nervous system. J Gene Med 2006;8:736e44. [20] Han S, Mahato RI, Kim SW. Water-soluble lipopolymer for gene delivery. Bioconjug Chem 2001;12:337e45. [21] Wilhelm M, Zhao CL, Wang YC, Xu RL, Winnik MA, Mura JL, et al. Poly(styreneethylene oxide) block copolymer micelle formation in water: a fluorescence probe study. Macromolecules 1991;24:1033e40. [22] Kataoka K, Matsumoto T, Yokoyama M, Okano T, Sakurai Y, Fukushima S, et al. Doxorubicin-loaded poly(ethylene glycol)-poly(beta-benzyl-L-aspartate) copolymer micelles: their pharmaceutical characteristics and biological significance. J Control Release 2000;64:143e53. [23] Abbasi M, Aliabadi HM, Moase EH, Lavasanifar A, Kaur K, Lai R, et al. siRNAmediated down-regulation of P-glycoprotein in a Xenograft tumor model in NOD-SCID mice. Pharm Res 2011;28:2516e29. [24] Landry B, Aliabadi HM, Samuel A, Gul-Uludag H, Jiang X, Kutsch O, et al. Effective non-viral delivery of siRNA to acute myeloid leukemia cells with lipid-substituted polyethylenimines. PLoS One 2012;7:e44197. [25] Mao Z, Cartier R, Hohl A, Farinacci M, Dorhoi A, Nguyen TL, et al. Cells as factories for humanized encapsulation. Nano Lett 2011;11:2152e6. [26] Ke CJ, Chiang WL, Liao ZX, Chen HL, Lai PS, Sun JS, et al. Real-time visualization of pH-responsive PLGA hollow particles containing a gas-generating agent targeted for acidic organelles for overcoming multi-drug resistance. Biomaterials 2013;34:1e10. [27] Liu L, Guo K, Lu J, Venkatraman SS, Luo D, Ng KC, et al. Biologically active core/ shell nanoparticles self-assembled from cholesterol-terminated PEG-TAT for drug delivery across the blood-brain barrier. Biomaterials 2008;29:1509e17. [28] Hu Q, Wang J, Shen J, Liu M, Jin X, Tang G, et al. Intracellular pathways and nuclear localization signal peptide-mediated gene transfection by cationic polymeric nanovectors. Biomaterials 2012;33:1135e45. [29] Jiang QY, Lai LH, Shen J, Wang QQ, Xu FJ, Tang GP. Gene delivery to tumor cells by cationic polymeric nanovectors coupled to folic acid and the cellpenetrating peptide octaarginine. Biomaterials 2011;32:7253e62. [30] Hu QL, Jiang QY, Jin X, Shen J, Wang K, Li YB, et al. Cationic microRNAdelivering nanovectors with bifunctional peptides for efficient treatment of PANC-1 xenograft model. Biomaterials 2013;34:2265e76. [31] Fan H, Hu QD, Xu FJ, Liang WQ, Tang GP, Yang WT. In vivo treatment of tumors using host-guest conjugated nanoparticles functionalized with doxorubicin and therapeutic gene pTRAIL. Biomaterials 2012;33:1428e36. [32] Hu Q, Li W, Hu X, Shen J, Jin X, Zhou J, et al. Synergistic treatment of ovarian cancer by co-delivery of survivin shRNA and paclitaxel via supramolecular micellar assembly. Biomaterials 2012;33:6580e91. [33] Abbasi M, Lavasanifar A, Uludag H. Recent attempts at RNAi-mediated Pglycoprotein downregulation for reversal of multidrug resistance in cancer. Med Res Rev 2013;33:33e53. [34] Tacar O, Sriamornsak P, Dass CR. Doxorubicin: an update on anticancer molecular action, toxicity and novel drug delivery systems. J Pharm Pharmacol 2013;65:157e70. [35] Cleary ML, Smith SD, Sklar J. Cloning and structural analysis of cDNAs for bcl-2 and a hybrid bcl-2/immunoglobulin transcript resulting from the t(14;18) translocation. Cell 1986;47:19e28. [36] Oltvai ZN, Milliman CL, Korsmeyer SJ. Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell 1993;74:609e19. [37] Korsmeyer SJ, Shutter JR, Veis DJ, Merry DE, Oltvai ZN. Bcl-2/Bax: a rheostat that regulates an anti-oxidant pathway and cell death. Semin Cancer Biol 1993;4:327e32.