Neuroscience Letters 557 (2013) 129–134

Contents lists available at ScienceDirect

Neuroscience Letters journal homepage: www.elsevier.com/locate/neulet

Restoration of spatial memory dysfunction of human APP transgenic mice by transplantation of neuronal precursors derived from human iPS cells Naruyoshi Fujiwara, Jun Shimizu, Kenji Takai, Nagisa Arimitsu, Asako Saito, Takao Kono, Tasuku Umehara, Yuji Ueda, Sueshige Wakisaka, Tomoko Suzuki, Noboru Suzuki ∗ Department of Immunology and Medicine, St. Marianna University School of Medicine, Kawasaki, Japan

h i g h l i g h t s • • • •

Amyloid precursor protein transgenic mice show substantial memory dysfunction. Neurons with cholinergic neuron phenotype were generated from hiPS cells. After grafting, human cholinergic/GABAergic neurons were found in mouse hippocampus. Spatial memory in PDAPP mice improved significantly after grafting.

a r t i c l e

i n f o

Article history: Received 16 June 2013 Received in revised form 3 October 2013 Accepted 17 October 2013 Keywords: Neuron regeneration Human iPS cells Cholinergic neuron GABAergic neuron Retinoic acid PDAPP mouse

a b s t r a c t PDGF promoter driven amyloid precursor protein (PDAPP) transgenic mice were accompanied by age dependent amyloid ␤ deposition and progressive spatial memory dysfunction which emerges within a few months of age. We conducted transplantation of neuronal precursors of cholinergic neuron phenotype which were derived from human iPS (hiPS) cells into bilateral hippocampus of PDAPP mice. We first generated neuronal precursors with cholinergic neuron phenotype from hiPS cells by culturing them with retinoic acid (RA), sonic hedgehog (SHH) and noggin-Fc (NOG). Spatial memory function of PDAPP mice was significantly impaired compared to that of nontransgenic littermates at age 8 weeks. After neuronal precursor transplantation, subsequent memory dysfunction of PDAPP mice was significantly improved, compared to that of vehicle injected PDAPP mice. We observed choline acetyltransferase (ChAT) positive cholinergic human neurons and vesicle GABA transporter (VGAT) positive GABAergic human neurons in PDAPP mouse hippocampus 45 days after the transplantation. Neuronal precursors with cholinergic neuron phenotype derived from hiPS cells survived in PDAPP mouse hippocampus and their spatial memory loss was improved. hiPS cells may become applicable for the treatment of patients with dementia. © 2013 Published by Elsevier Ireland Ltd.

1. Introduction

Abbreviations: A␤, amyloid ␤ protein; APP, amyloid precursor protein; ChAT, choline acetyltransferase; DG, dentate gyrus; EB, embryoid bodies; FN, fibronectin; iPS, inducible pluripotent stem; MEF, mouse embryonic fibroblasts; MWM, Morris water maze; NCAM, neural cell adhesion molecule; NFM, neurofilament middle chain; NOG, noggin-Fc; PBS, phosphate buffered saline; PDAPP, PDGF promoter driven amyloid precursor protein; RA, retinoic acid; SHH, sonic hedgehog; VGAT, vesicular GABA transporter. ∗ Corresponding author at: Department of Immunology and Medicine, St. Marianna University School of Medicine, Sugao 2-16-1, Miyamae-ku, Kawasaki 2168511, Japan. Tel.: +81 44 977 8111; fax: +81 44 975 3315. E-mail address: [email protected] (N. Suzuki). 0304-3940/$ – see front matter © 2013 Published by Elsevier Ireland Ltd. http://dx.doi.org/10.1016/j.neulet.2013.10.043

There are several transgenic mouse models of dementia, which are generated based on the amyloid and tau hypotheses. Human amyloid ␤ (A␤) protein, human amyloid precursor protein (APP) and human tau protein transgenic models were produced to search new treatments for dementia patients. These models did not show all features of human dementia but cognitive deficits and senile plaques were observed in almost all models [11]. PDGF promoter driven amyloid precursor protein (PDAPP) transgenic mouse was the oldest and most widely used mouse model of human dementia. They over-expressed mutated human APP (APPV717F ) and showed age dependent A␤ deposition [9]. PDAPP mouse displayed progressive synaptic loss [19], reduction

130

N. Fujiwara et al. / Neuroscience Letters 557 (2013) 129–134

in size of the hippocampus and spatial memory dysfunction from a few months of age [6], and is useful as a mouse model of dementia. Human iPS (hiPS) cells were generated by Yamanaka et al. from human fibroblasts [23]. Their use in research toward clinical application is free from several problems of graft rejection and ethical issues. In this study, we tried to generate neurons with cholinergic neuron phenotype from hiPS cells mimicking embryonic development of neurons. We transplanted the cells into the bilateral hippocampus of PDAPP mice and found that their spatial memory function improved significantly. 2. Materials and methods

mouse anti-human Neural cell adhesion molecule (hNCAM, Santa Cruz Biotechnology, Dallas, TX), rabbit anti-Choline acetyltransferase (ChAT, Millipore), rabbit anti-vesicular GABA transporter (VGAT, Millipore) and mouse anti-human Nuclei (hNuc) (Abnova, Taipei City, Taiwan) antibodies. We used anti-hNCAM antibody to detect human neurons in the recipient mouse brain. Omission of primary antibodies was made as a control for all staining. In the immunocytochemistry, we counted at least 200 cells in each experiment to calculate the number of cells expressing neural cell associated proteins in vitro. Each percentage of neuron associated protein positive cells in immunofluorescence study was expressed as mean and standard error of the mean (s.e.m.) of at least three independent experiments (n ≥ 3).

2.1. Cell culture and neural differentiation

2.6. Morris water maze test

The hiPS cell lines, 201B7 and 253G1 (RIKEN, Tsukuba, Japan), were used in this study. Both cell lines gave essentially the same results in this study. Thus the results obtained using 253G1 were presented. The hiPS cell lines were maintained according to RIKEN cell preparation manual. We developed embryoid bodies (EB) from undifferentiated hiPS cells by 4-day floating culture (from day 0 to day 4). Then EB were cultured on fibronectin (FN)-coated dishes (BD Biosciences, San Diego, CA) on day 4. From day 5, we cultured the cells in differentiation medium consisted of DMEM/F12 with N2 supplement. We added 1 ␮M retinoic acid (RA) (Sigma, Tokyo, Japan), 10 ␮M noggin-Fc (NOG) (R&D systems) and 10 nM sonic hedgehog (SHH) (R&D systems) in the dishes twice (on days 5 and 7).

We conducted the Morris water maze (MWM) test once before transplantation (1st trial started at day −6) and twice after transplantation (2nd and 3rd trials started at day 22 and 48, respectively) to assess mouse spatial memory function [17]. A 98-cm diameter pool was filled with opaque-colored, temperature-controlled water (25 ± 1 ◦ C). A plastic target platform (diameter 15 cm) was placed at the center of one of 4 quadrants of the pool and was submerged 1.5 cm under the water surface. Mice were pre-trained to swim and reach the target platform on the first day of each trial. Mice were trained to memorize the relationship between target platform positions and the spatial cues for the subsequent 4 days (hidden test). Mouse spatial memory function was evaluated by the average escape latency (time required to reach the target platform) of serial 4 tasks in each hidden test of 4 sequential experimental days. Animal movement was digitally recorded by an automated tracking system and analyzed using Image J WM (O’Hara & Co., Ltd., Tokyo, Japan) which was modified based on the public domain Image J program (NIH).

2.2. Animals PDAPP mice were provided by National Institutes of Health (NIH, PDAPP LINE109). All experimental procedures were performed in accordance with Guide for the Care and Use of Laboratory Animals, 8th edition (National Research Council) and were approved by the local Animal Care Committee (Animal Care and Use Committee, St. Marianna University School of Medicine). 2.3. Transplantation We transplanted the neuronal precursors into the 10-week-old PDAPP mice at day 8 (see Fig. 1A). Burr holes were made in the bilateral parietal bones at the location of 2.4 mm posterior and 2.0 mm lateral to the bregma. 2 ␮l/each side of cell suspension (2.0 × 105 cells, n = 15) and vehicle (n = 16) were injected into the bilateral hippocampus through center of the burr hole and 1.25 mm depth from the dura mater. Immunosuppressants were administered as previously described [12]. 2.4. RT-PCR Total RNA extraction, cDNA synthesis and PCR amplification followed the methods as described [14]. The sequences of primers were human ␤-actin (661 bp), sense: tgacggggtcacccacactgtgcccatcta and antisense: ctagaagcattgcggtggacgatggaggg; nestin (177 bp), sense: agacttccctcagctttcagg and antisense: gcctggaggaattcttggtt; neurofilament-M (NFM, 209 bp), sense: tagcacatttgcaggaagca and antisense: cggccaattcctctgtaatg. 2.5. Immunofluorescence staining Immunofluorescence staining was conducted as reported previously [5,14]. The fixed cells and brain tissues were stained with mouse anti-Nestin (Millipore, Billerica, MA), mouse anti␤III-tubulin (Promega, Madison, WI), rabbit anti-NFM (Millipore),

2.7. Statistical analysis All statistical analysis was performed using Statcel3 software [25]. Differences between data were assessed by using the repeated measures analysis of variance (MANOVA). 3. Results 3.1. Induction of cholinergic neurons from hiPS cells We generated neuronal precursors with cholinergic neuron phenotype mimicking the forebrain development in embryos. We conducted preliminary experiments where several cell culture conditions were tested for inducing cholinergic neurons and we found that the culture condition shown in Fig. 1A was one of the most suitable procedures. We developed EB from undifferentiated hiPS cells by 4-day floating culture (from day 0 to day 4). Then EB were cultured on FN-coated dishes on day 4. We added RA (1 ␮M), NOG (10 ␮M) and SHH (10 nM) twice (at day 5 and day 7) and cultured for up to 11 days (from day 8 to day 19) for in vitro characterization. Under these conditions, approximately 78% of cultured cells at day 8 were hNCAM positive by flow cytometric analysis (Fig. 1B). The cells at day 8 expressed mRNA of ChAT, ␤III-tubulin, nestin, NFM and VGAT by RT-PCR (data not shown). Immunocytochemistry was performed at day 8 and 19 and control cells at day 5 (before adding RA, NOG and SHH) were stained simultaneously. The cells expressed Nestin at day 8 (97.3 ± 1.2%, Fig. 1D), and its expression decreased on day 19 (5.9 ± 5.0%, Fig. 1E). They expressed ␤III-tubulin (24.5 ± 9.1%, Fig. 1G), ChAT (34.7 ± 9.1%, Fig. 1 J) and NFM (18.0 ± 7.5%, data not shown) at day 8. At day 19, ␤III-tubulin (94.7 ± 0.3%, Fig. 1H), ChAT (82.9 ± 4.4%, Fig. 1 K), NFM

N. Fujiwara et al. / Neuroscience Letters 557 (2013) 129–134

131

Fig. 1. Neural cell induction and characterization. (A) Schematic representation of neural induction from hiPS cells and their transplantation. Undifferentiated hiPS cells were maintained on mouse embryonic fibroblasts (MEF) and we developed EB from the undifferentiated hiPS cells by 4-day-floating culture (from day 0 to day 4). EB were cultured in FN-coated dishes for 4 days (from day 4 to day 8). At day 5 and day 7, RA, NOG and SHH (3 factors) were added to the culture dishes. The cells were disaggregated into single cell suspensions at day 8 for cell transplantation. The aliquots of the same cell suspensions were further cultured for subsequent characterization. They were stained with several anti-neuron associated protein antibodies on day 8 and 19. As a control, cells at day 5 (before adding RA, NOG and SHH) were similarly stained. A half of PDAPP mice received transplantation of hiPS derived neuronal precursors at day 8. The remaining half served as control, having injection of PBS instead of neural cells, and designated vehicle injected PDAPP mice. Immunohistochemistry was conducted at day 11 (3 days after transplantation) and day 53. Morris water maze tests were conducted once before and twice after transplantation. (B) Flow cytometric analysis of hNCAM expression on the cells at day 8, which were used as neural grafts. Under these conditions, approximately 78% of transplanted cells were hNCAM positive in this experiment. (C–N) We stained Nestin, ␤III-tubulin, ChAT, VGAT at day 8 and day 19 to confirm their neural differentiation in vitro. Cells at day 5 (before adding 3 factors) were similarly stained (B, E, H, K). (C–E) Anti-Nestin staining (red), counterstained with DAPI (blue). (F–H) anti-␤III-tubulin staining (red), counterstained with DAPI (blue). (I–K) Anti-ChAT (red), counterstained with DAPI (blue). (L–N) Anti-VGAT (red), counterstained with DAPI (blue). The cells expressed Nestin at day 8 (97.3 ± 1.2%, panel D), and its expression decreased on day 19 (5.9 ± 5.0%, panel E). The cells expressed ␤III-tubulin (24.5 ± 9.1%, panel G), ChAT (34.7 ± 9.1%, panel J) and NFM (18.0 ± 7.5%, data not shown) at day 8. The number of ␤III-tubulin (94.7 ± 0.3%, panel H), ChAT (82.9 ± 4.4%, panel K) and NFM (88.0 ± 12.0%, data not shown) expressing cells increased at day 19. A few cells (