Inflammation ( # 2016) DOI: 10.1007/s10753-016-0306-6
ORIGINAL ARTICLE
Resveratrol Protects against Titanium Particle-Induced Aseptic Loosening Through Reduction of Oxidative Stress and Inactivation of NF-κB Guotian Luo,1 Ziqing Li,1 Yu Wang,2 Haixing Wang,1 Ziji Zhang,1 Weishen Chen,1 Yangchun Zhang,1 Yinbo Xiao,1 Chaohong Li,3 Ying Guo,4,5 and Puyi Sheng1,5
Abstract—Aseptic implant loosening is closely associated with chronic inflammation induced by implant wear debris, and reactive oxygen species (ROS) play an important role in this process. Resveratrol, a plant compound, has been reported to act as an antioxidant in many inflammatory conditions; however, its protective effect and mechanism against wear particle-induced oxidative stress remain unknown. In this study, we evaluated resveratrol’s protective effects against wear particle-induced oxidative stress in RAW 264.7 macrophages. At non-toxic concentrations, resveratrol showed dose-dependent inhibition of nitric oxide (NO) production, ROS generation, and lipid peroxidation. It also downregulated the gene expression of oxidative enzymes, including inducible nitric oxide synthase (iNOS) and nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (NOX)-1 and NOX-2, and promoted the gene expression and activities of antioxidant enzymes, including catalase (CAT), superoxide dismutase (SOD), glutathione reductase (GR), and glutathione peroxidase (GPx). This protective effect against wear particle-induced oxidative stress was accompanied by a reduction of gene expression and release of tumor necrosis factor-α (TNF-α), and decreased gene expression and phosphorylation of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB). These findings demonstrate that resveratrol can inhibit wear particle-induced oxidative stress in macrophages, and may exert its antioxidant effect and protect against aseptic implant loosening. KEY WORDS: aseptic loosening; chronic inflammation; oxidative stress; reactive oxygen species (ROS); resveratrol.
Guotian Luo and Ziqing Li contributed equally to this work. 1
Department of Joint Surgery, The First Affiliated Hospital, Sun Yat-sen University, NO. 58, Zhongshan Rd. 2, Guangzhou, 510080, People’s Republic of China 2 Allergy Center, Otorhinolaryngology Hospital, The First Affiliated Hospital, Sun Yat-sen University, Guangzhou, China 3 Department of Histology and Embryology, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, China 4 Department of Endocrinology, Sun Yat-sen Memorial Hospital, Sun Yatsen University, NO. 107, Yan Jiang Xi Road, Guangzhou, 510120, People’s Republic of China 5 To whom correspondence should be addressed to Ying Guo at Department of Endocrinology, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, NO. 107, Yan Jiang Xi Road, Guangzhou, 510120, People’s Republic of China. E-mail: [email protected]; and Puyi Sheng at Department of Joint Surgery, The First Affiliated Hospital, Sun Yat-sen University, NO. 58, Zhongshan Rd. 2, Guangzhou, 510080, People’s Republic of China. E-mail: [email protected]
INTRODUCTION Aseptic implant loosening is one of the major longterm complications after total joint arthroplasty, and the most common cause for revision surgery [1, 2]. There is abundant evidence to show that periprosthetic osteolysis and aseptic loosening are mainly driven by macrophage-induced inflammation due to implant wear debris generated from repetitive movements between joint prosthesis components [3, 4]. The macrophages activated by wear particles secrete various pro-inflammatory cytokines such as tumor necrosis factor (TNF)-α, interleukin 1β (IL-1β), and IL-6, and lead to an increase in osteoclastogenesis and a decrease in osteoblast formation and function. These changes promote bone resorption and inhibit bone formation, ultimately causing periprosthetic osteolysis and aseptic loosening [5–7].
0360-3997/16/0000-0001/0 # 2016 Springer Science+Business Media New York
Luo, Li, Wang, Wang, Zhang, Chen, Zhang, Xiao, Li, Guo, and Sheng Inflammatory processes are closely linked to oxidative stress, an imbalance condition between the formation and degradation of oxidants, including reactive nitrogen species (RNS, e.g., nitric oxide (NO)) and reactive oxygen species (ROS), such as superoxide anion (O 2 − ), hydrogen peroxide (H 2 O 2 ), and hydroxyl radical (OH) [8, 9]. ROS/RNS generation is regulated by oxidative enzymes including nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (NOX) and nitric oxide synthase (iNOS), and antioxidant enzymes including catalase (CAT), glutathione peroxidase (GPx), glutathione reductase (GR), and superoxide dismutase (SOD) [10–12]. Significantly increased iNOS expression and nitrotyrosine accumulation have been reported in periprosthetic tissues of patients with aseptic implant loosening [13, 14]. In periprosthetic tissue of patients with aseptic loosening, oxidized glutathione and malondialdehyde (MDA) levels, two indicators of oxidative stress, increased compared to those in controls [15]. In our previous study, NOX-1 and NOX-2 expression was higher in aseptically loosened periprosthetic tissue than in control tissue [16, 17]. Furthermore, dysregulated ROS-related enzymes were found in the synovial fluid of patients with aseptic loosening [18]. In in vitro studies, ROS/RNS overproduction has been observed in various wear particle-exposed cell types [19–22]. Thus, ROS/RNS and ROS/RNS-induced oxidative stress play major roles in aseptic implant loosening, leading to prosthesis failure. Resveratrol is a polyphenol found in a variety of dietary sources such as grape, berries, and peanuts, and numerous studies, ranging from cell culture to animal model studies, have shown its health benefits, which include antioxidant, anti-inflammatory, and antitumor effects [23]. Its bone-protective effects are also well demonstrated. Resveratrol treatment improves osteoblast formation and function and inhibits osteoclastogenesis [24, 25]. On the basis of these findings, we hypothesized that resveratrol may inhibit periprosthetic osteolysis and aseptic loosening induced by implant wear particles, and that the protective effect may be exerted via the suppression of oxidative stress. To test this hypothesis, we used a living cell system of titanium (Ti) particle-exposed RAW 264.7 macrophages as an aseptic implant-loosening model to determine whether resveratrol modulates oxidative stress and inhibits aseptic loosening.
MATERIALS AND METHODS Preparation of Ti Particles Commercially pure Ti particles were purchased from Alfa Aesar (Ward Hill, MA, USA). Particle size was measured using scanning electron microscope, and the mean particle diameter was 2.6 ± 1.9 μm (Fig. 1), with 90 % of the particles having a diameter smaller than 3.6 μm. For endotoxin removal, Ti particles were sterilized by baking at 180 °C for 6 h, followed by treatment with 70 % ethanol for 48 h at room temperature as described previously [16, 26]. The particles were reconstituted at a concentration of 10 mg/ml in sterile phosphate-buffered saline (PBS) and diluted to 0.1 mg/ml. The particles were tested using a commercial Limulus assay kit (Chromogenic End-point TAL with a Diazo cou-pling kit, Xiamen Houshiji, Fujian, China) to rule out endotoxin contamination. Particles with endotoxin levels lower than 0.1 EU/ml were considered uncontaminated. Only endotoxin-free particles were used in the study. Isolation and Treatment of Murine Peritoneal Macrophages Female C57BL/6J mice aged 6 weeks were obtained from the Laboratory Animal Services Centre of Guangdong Province and were kept in a specific pathogen-free condition. All animal experimentations were performed with the approval of the Institutional Animal Care and Use Committee of Sun Yat-sen University, Guangzhou, China, and conducted following the institutional guidelines of Sun Yat-sen University. The isolation of murine peritoneal macrophages was performed according to previous publication [27] with a slight modification. Briefly, mice were each injected with 1 ml of 3 % sterile thioglycolate broth into the peritoneum to elicit an inflammatory response and recruit peritoneal macrophages. Five days later, mice were sacrificed by cervical dislocation and sterilized with 70 % alcohol; the peritoneal cavity was then rinsed with 5 ml pre-cold PBS, and peritoneal fluid was collected. Subsequently, the collected cells within fluid were centrifuged in 50-ml tubes for 10 min at 1000 rpm, 4 °C, discarded supernatant and resuspended cell pellet with RPMI 1640 medium (Gibco, Life Technologies, CA, USA) containing 10 % fetal calf serum (Gibco, Life Technologies, CA, USA) and 1 % antibiotics (Gibco, Life Technologies, CA, USA). After that, the cells were plated in 6-well plates with a density of 2 × 106 cells/ml and cultured a 5 % CO2 incubator at 37 °C. After 2 h for the adherence of macrophages, non-adherent cells were
Resveratrol Protects against Titanium
Fig. 1. Scanning electron micrograph of titanium particles used in the experiments (×6000).
removed and washed with warm PBS three times. Thereafter, the adhering macrophages were pre-treated with various concentrations of resveratrol for 4 h before incubation with Ti particles (0.1 mg/ml) for 12 h in serum-free RPMI 1640 medium. Cell Culture and Treatment RAW 264.7 macrophages (ATCC, MD, USA) were grown in high-glucose Dulbecco’s Modified Eagle’s Medium (DMEM; Gibco, Life Technologies, CA, USA) with 10 % fetal calf serum (Gibco, Life Technologies, CA, USA) in a 5 % CO2 incubator at 37 °C and subcultured every 48 h after gentle scraping. Resveratrol (SigmaAldrich) was solubilized in dimethyl sulfoxide (DMSO) at 20 mM and stored at −20 °C. Before use, resveratrol was reconstituted to a different concentration in DMEM. Cells were plated in 6-well plates at a density of 2 × 106 cells per well and incubated overnight. Thereafter, they were pre-treated with various concentrations of resveratrol for 4 h before incubation with Ti particles (0.1 mg/ml) for 12 h (for PCR and oxidative stress-associated assays) and for 15, 30, or 60 min (for Western blotting analysis). Cytotoxicity Analysis Resveratrol’s cytotoxic effect of on RAW 264.7 macrophages was detected using the WST-1 assay (Roche). Briefly, cells were plated at a density of 5 × 104 cells/well into 96-well plates. After incubating for 24 h, cells were treated with different concentrations of resveratrol (0– 160 μM) for 24 h. Before measurement, 10 μl of WST-1 was added to each well and gently mixed, followed by incubation for 4 h at 37 °C. Thereafter, absorbance was
measured at 450 nm with a reference wavelength at 620 nm. NO Production NO concentration in the supernatant was measured using a commercial assay kit according to the manufacturer’s protocol (Beyotime, China). Absorbance was measured at 540 nm and calibrated with a calibration curve to determine the NO content in the supernatant. Measurement of Intracellular ROS ROS production in RAW 264.7 macrophages was measured using a fluorescence probe, 2′,7′dichlorodihydrofluorescein diacetate (H 2 DCFDA; Invitrogen). After stimulation, the cells were collected and resuspended in DMEM containing 10 μM H2DCFDA and incubated for 30 min at 37 °C in darkness. After washing with PBS twice, fluorescence intensity was then measured by flow cytometry (exCitation wavelength, 488 nm; emission wavelength, 525 nm; Beckman CytoFLEX). Fifty thousand macrophages were analyzed for each sample. Data were analyzed using FlowJo (TreeStar, USA). Lipid Peroxidation MDA, an indicator of lipid peroxidation, was examined using a commercial assay kit (Beyotime, China) according to the manufacturer’s protocol. Absorbance was measured at 532 nm and calibrated with a calibration curve to determine the MDA content. The results are shown as nanomole per milligrams protein.
Luo, Li, Wang, Wang, Zhang, Chen, Zhang, Xiao, Li, Guo, and Sheng Quantitative Real-Time PCR Total RNA was extracted with TriPure Isolation Reagent (Roche, USA), and complementary DNA (cDNA) synthesis was performed with 1 μg of RNA using Transcriptor First Strand cDNA Synthesis Kit (Roche, USA). Quantitative real-time PCR was performed with KAPA SYBR® FAST qPCR Master Mix (Kapa Biosystems, USA). The specific primer sequences are described in Table 1. PCR amplification was performed in CFX96 (Bio-Rad). Relative levels of gene expression were analyzed using the 2−△△CT method by using GAPDH as an endogenous control.
Measurement of SOD, CAT, and GR Activities The enzymatic activities of SOD, CAT, and GR were measured using commercial assay kits (Beyotime, China) according to the manufacturer’s protocol. Enzymatic activities were expressed as unit per milligrams protein. The SOD activity assay was based on SOD’s ability to inhibit the photochemical reduction of nitroblue tetrazolium (NBT) via O2− generated by the xanthine/xanthine oxidase system [28]. One unit of SOD activity was defined as the amount of enzyme required to inhibit 50 % NBT reduction monitored at 560 nm. The CAT activity assay was based on CAT’s ability to degrade H2O2 [29]. One unit of CAT activity was considered as the amount of enzyme required to scavenge 1 μmol H2O2 in 1 min per milligrams protein at pH 7.0 at 25 °C. The GR activity assay was based on the decrease in absorbance caused by NADPH oxidation at 340 nm [30]. One unit of enzymatic activity was defined as the amount
of enzyme required to oxidize 1 μmol NADPH at pH 7.0 at room temperature. Western Blotting Western blotting was performed as previously described with a slight modification [16]. Briefly, cells were prepared in lysis buffer containing protease inhibitor and phosphatase inhibitors. After centrifugation, protein concentration in the supernatant was measured using Bio-Rad protein assay system. Heat-denatured proteins were electrophoresed on 8 % SDS-PAGE, followed by transfer onto nitrocellulose membranes. The membranes were blocked in 5 % skim milk for 30 min at room temperature and incubated overnight at 4 °C with primary antibodies against p-NF-κB-p65 (1:1000) and NF-κB-p65 (1:1000; Cell Signal Tech), and then incubated with horseradish peroxidase-conjugated anti-rabbit IgG (1:3000; Jackson Immunoresearch) as the secondary antibody for 2 h at room temperature. Bound antibodies were detected using enhanced chemiluminescence reagents (GE Healthcare, Buckinghamshire, UK) and visualized using a detection system (ImageQuant LAS 4000 mini, GE Healthcare, Buckinghamshire, UK). Results were analyzed using Image J software. Statistical Analysis All experimental data are from at least three independent experiments performed in triplicate and presented as the mean ± SD. Data analysis was performed using GraphPad Prism version 6 (GraphPad software, San Diego, CA) with one-way analysis of variance (ANOVA) or
Table 1. Primer Sequences for Quantitative Real-Time PCR Gene
Forward primer
Reverse primer
Gapdh Inos Nox-1 Nox-2 Cu/Zn Sod Mn Sod Gpx Gr Cat Tnf-α Nf-κb
ACTTTGTCAAGCTCATTTCC ACATCGACCCGTCCACAGTAT GGTTGGGGCTGAACATTTTTC AGCAGTTGATGGACCCTTTG AACCAGTTGTGTTGTCAGGAC TGGACAAACCTGAGCCCTAAG AGTCCACCGTGTATGCCTTCT GCGTGAATGTTGGATGTGTACC GGAGTCTTCGTCCCGAGTCT CCCTCACACTCAGATCATCTTCT TCAATGGCTACACAGGACCA
TGCAGCGAACTTTATTGATG CAGAGGGGTAGGCTTGTCTC TCGACACACAGGAATCAGGAT TACCAGACAGACTTGAGAATGGAG CCACCATGTTTCTTAGAGTGAGG CCCAAAGTCACGCTTGATAGC GAGACGCGACATTCTCAATGA GTTGCATAGCCGTGGATAATTTC CGGTCTTGTAATGGAACTTGC GCTACGACGTGGGCTACAG TCGCTTCTTCACACACTGGAT
Gapdh glyceraldehyde-3-phosphate dehydrogenase, Inos inducible nitric oxide synthase, Nox-1 nicotinamide adenine dinucleotide phosphate oxidase–1, Nox-2 nicotinamide adenine dinucleotide phosphate oxidase–2, Cu/Zn Sod superoxide dismutase 1, Mn Sod superoxide dismutase 2, Gpx glutathione peroxidase, Gr Glutathione reductase, Cat catalase, Tnf-α tumor necrosis factor-alpha, Nf-κb nuclear factor kappa B
Resveratrol Protects against Titanium Student’s t test. P < 0.05 was considered statistically significant.
Resveratrol Inhibits the mRNA Expression of Oxidative Enzymes
RESULTS
The messenger RNA (mRNA) expression of iNOS, NOX-1, and NOX-2 markedly improved in the Ti-only group (Fig. 4a–c). Resveratrol pretreatment significantly attenuated the mRNA expression of oxidative enzymes in a dose-dependent manner.
Effects of Resveratrol on RAW 264.7 Macrophage Cell Viability At 80 and 160 μM, resveratrol showed a significant toxic effect on RAW 264.7 macrophages compared to the effects of the control after incubation for 24 h (Fig. 2). In the following experiments, cells were incubated with various concentrations of resveratrol (10, 20, and 40 μM) for 4 h before stimulation with Ti particles. Resveratrol Reduced Wear Particles-Induced Oxidative Stress As shown in Fig. 3a, NO production in supernatant increased significantly with the stimulation of Ti particles, and this increase could be attenuated by resveratrol in a dose-dependent manner. Compared with the control group, the Ti-only group showed significantly increased MDA production. However, MDA content decreased markedly upon pretreatment with 10, 20, and 40 μM resveratrol (Fig. 3b). In addition, compared to the control group, the Ti-only group showed significantly increased ROS generation (Fig. 3c, d); resveratrol showed dose-dependent attenuation of ROS generation.
Resveratrol Improves mRNA Expression and Activities of Anti-Oxidative Enzymes Compared to the control group, the Ti-only group showed a negligible decrease in the mRNA expression of Cu/Zn SOD and a significant decrease in the expression of Mn SOD and GPx (Fig. 5a–e). Interestingly, the mRNA expression of GR and CAT increased significantly. Pretreatment with 10, 20, and 40 μM resveratrol significantly improved the mRNA expression of Cu/Zn SOD, Mn SOD, and CAT compared to the expression in the Ti-only group; however, it did not significantly alter the mRNA expression of GPx and GR relative to that in the Ti-only group. Compared with the control group, in RAW 264.7 macrophages, the Ti-only group showed significantly lower SOD and CAT activities and nonsignificant upregulation of GR activity. Resveratrol pretreatment significantly increased SOD, CAT, and GR activities. In murine peritoneal macrophages, Ti stimulation also showed significantly lower SOD and CAT activities and non-significant upregulation of GR activity. Resveratrol pretreatment significantly increased SOD and CAT activities in a dose-dependent manner, while pretreatment with resveratrol at 40 μM increased GR activity significantly (Table 2). Resveratrol Inhibited Gene Expression and Release of TNF-α and Suppressed NF-κB Activation
Fig. 2. Effects of resveratrol treatment on RAW 264.7 macrophage cell viability. RAW 264.7 macrophages were cultured in 96-well plates and treated with different concentrations of resveratrol (0–160 μM) for 24 h, and cell viability were measured. *P < 0.05 vs. the control group.
The Ti-only group showed significantly increased tumor necrosis factor-α (TNF-α) mRNA expression and release in the supernatant, an effect that was suppressed by resveratrol pretreatment in a dosedependent manner (Fig. 6a, b). The mRNA expression and phosphorylation of nuclear factor kappalight-chain-enhancer of activated B cells (NF-κB) increased significantly in the Ti-only group, and the addition of resveratrol attenuated this effect (Fig. 6c, d).
Luo, Li, Wang, Wang, Zhang, Chen, Zhang, Xiao, Li, Guo, and Sheng
Fig. 3. Resveratrol reduced NO production, lipid peroxidation, and ROS generation. RAW 264.7 macrophages cultured in 6-well plates for at least 12 h, followed by pretreatment with or without 10, 20, or 40 μM resveratrol, and stimulation with Ti particles (0.1 mg/ml) or LPS (1 μg/ml) as a positive control. Supernatants were collected for measurement of NO production (a), and cells were harvested for measurement of MDA (b) and ROS generation (c and d). Mean ± SD values of at least three replicates are shown. *P < 0.05 vs. the control group, #P < 0.05 vs. the Ti-only group.
DISCUSSION Chronic oxidative stress plays an important role in the pathologic process of periprosthetic osteolysis, resulting in aseptic implant loosening [8, 14, 15, 31]. Currently, revision surgery for aseptic loosening is costly and technically demanding for surgeon, and effective non-surgical biological treatment options are required [6]. Numerous studies have focused on resveratrol as a potential antioxidant in chronic inflammation [23–25]. Here, we demonstrated that resveratrol protects against periprosthetic osteolysis and aseptic loosening.
NO is an important intracellular messenger involved in many physiological and pathological processes, including inflammation and pathogen elimination [32]. However, overproduction of NO can cause reaction with superoxide to produce the damaging oxidant, causing oxidative stress and cell damage [9]. In this study, Ti particles could significantly increase NO production in macrophages and this increase could be significantly reduced by resveratrol (Fig. 3a). Expression of MDA, an indicator of lipid peroxidation, was higher in the periprosthetic tissue of patients with aseptic loosening [15]. Significantly increased MDA levels were observed in the Ti-only group, and the increase could be attenuated by resveratrol (Fig. 3b). ROS are a
Resveratrol Protects against Titanium
Fig. 4. Resveratrol decreased gene expression of oxidative enzymes. RAW 264.7 macrophages were cultured in 6-well plates for at least 12 h, followed by pretreatment with or without resveratrol at various concentrations, and Ti particle (0.1 mg/ml) stimulation. RNA was extracted for q-PCR. Resveratrol decreased iNOS, NOX-1, and NOX-2 gene expression. Results represent mean ± SD values of three replicates performed in triplicate. *P < 0.05 vs. the control group, #P < 0.05 vs. the Ti-only group.
natural byproduct of the normal metabolism of oxygen and play an important role in cell signaling and homeostasis [33]. However, overproduction of ROS is associated with oxidative stress leading to oxidative damage [8, 9]. Our study showed that macrophage exposure to Ti particles could significantly increase ROS generation; this finding
is consistent with that of a previous study in which cells in periprosthetic tissue and metal corrosion induced ROS formation [21]. The increase in ROS generation could be attenuated by resveratrol (Fig. 3c, d). These findings suggest that resveratrol can inhibit ROS generation, and the increase in MDA levels may be caused by ROS
Fig. 5. Resveratrol increased gene expression of antioxidant enzymes. RAW 264.7 macrophages were cultured in 6-well plates for at least 12 h, followed by pretreatment with or without resveratrol at various concentrations, and Ti particle (0.1 mg/ml) stimulation. RNA was extracted for q-PCR. Resveratrol increased Cu/Zn SOD, Mn SOD, GPx, GR, and CAT gene expression. Results represent mean ± SD values of three replicates performed in triplicate. *P < 0.05 vs. the control group, #P < 0.05 vs. the Ti-only group; ns not significant, compared with the Ti-only group.
Luo, Li, Wang, Wang, Zhang, Chen, Zhang, Xiao, Li, Guo, and Sheng Table 2. Resveratrol Enhanced Enzymatic Activity During Ti Particle Stimulation Group
RAW 264.7 macrophages
Murine peritoneal macrophages
SOD (U/mg protein) CAT (U/mg protein) GR (U/mg protein) SOD (U/mg protein) CAT (U/mg protein) GR (U/mg protein) Control Ti (0.1 mg/ml) Ti + RSV (10 μM) Ti + RSV (20 μM) Ti + RSV (40 μM)
21.88 ± 0.14 20.30 ± 0.40* 30.08 ± 0.88# 30.06 ± 1.60# 34.36 ± 1.57#
34.35 ± 1.48 24.47 ± 0.36* 27.99 ± 0.87# 29.84 ± 1.49# 37.85 ± 1.08#
2.054 ± 0.03 2.227 ± 0.06 2.323 ± 0.03# 2.474 ± 0.02# 2.716 ± 0.04#
17.57 ± 0.21 16.58 ± 0.35* 18.28 ± 0.34# 19.41 ± 0.04# 22.03 ± 0.20#
22.00 ± 0.66 18.19 ± 0.14* 19.59 ± 0.29# 20.80 ± 0.29# 28.33 ± 0.24#
1.535 ± 0.13 1.896 ± 0.08 1.979 ± 0.12 2.096 ± 0.17 2.580 ± 0.21#
Results represent mean ± SD values of three replicates assayed in triplicate *P < 0.05 vs. the control group; #P < 0.05 vs. the Ti-only group
overproduction. In other words, the fact that resveratrol can diminish lipid peroxidation further supports the finding that resveratrol is capable of scavenging ROS. To determine the mechanisms underlying resveratrol’s protective effect against Ti particle-induced oxidative stress, we evaluated the mRNA expression of oxidative enzymes, including iNOS, NOX-1, and NOX-2. iNOS is one of the three major NOS isoforms, and inhibition of excessive iNOS-derived NO production can inhibit oxidative stress [34]. High iNOS expression in periprosthetic tissues of patients with aseptic loosening has been reported [14]. In this study, resveratrol attenuated the increased iNOS gene expression induced by Ti particles (Fig. 4a), which was consistent with the observed inhibition of NO production. These data suggest that the protection of resveratrol against Ti particle-induced oxidative stress in macrophages may involve decreasing NO production via a decrease of iNOS. NOX enzymes are integral membrane proteins and the main source of ROS in immune cells [10, 31, 35]. We previously found that NOX-1 and NOX-2 were highly expressed in aseptically loosened interface membranes and Ti particle-stimulated macrophages [16]. In this study, NOX-1 and NOX-2 gene expression increased in Ti particle-stimulated macrophages, and was attenuated by resveratrol (Fig. 4b, c). Besides detection of oxidative enzymes, we also measured mRNA level and activity of specific antioxidant enzymes. SOD, CAT, GPx, and GR are important antioxidant enzymes in ROS scavenging. SOD catalyzes the dismutation of the O2− radical into ordinary molecular oxygen (O2) or H2O2, and CAT can catalyze H2O2 decomposition into water and oxygen. GPx has peroxidase activity and protects the organism from oxidative damage. GR catalyzes the reduction of the disulfide form glutathione (GSSG) to the sulfhydryl form glutathione (GSH), which is a critical molecule against oxidative stress and in maintaining the reducing state of the cell [36, 37]. A decrease in antioxidant enzymes in
tissues surrounding implants in rabbits has been reported [37]. Our results showed that resveratrol could improve the gene expression of Cu/Zn SOD, Mn SOD, and CAT, but did not significantly alter the expression of GPx and GR (Fig. 5a–e), and resveratrol pretreatment significantly improved SOD, CAT, and GR activities in RAW 264.7 macrophages. In murine peritoneal macrophages, we found the resveratrol pretreatment significantly improved SOD and CAT activities, while GR activity only increased significantly at a concentration of 40 μM (Table 2). Thus, the downregulation of oxidative enzyme activity and increase of antioxidant enzyme activity may be responsible for resveratrol’s protective effect against Ti particle-induced oxidative stress in macrophages. To further demonstrate the mechanistic basis of resveratrol’s protective effect against Ti particle-induced oxidative stress, its effects on TNF-α and NF-κB were also explored. Current view suggests that periprosthetic osteolysis occurs owing to chronic secretion of inflammatory cytokines such as TNF-α and IL-1β, which play important roles in osteoclast differentiation, bone resorption by mature osteoclasts, and osteoclast survival [4, 38, 39]. Here, we found that TNF-α mRNA expression and release in supernatant was upregulated after stimulation with Ti particles, and attenuated by resveratrol (Fig. 6a, b). NF-κB is a transcription factor that regulates the expression of various genes, which participate in immune and inflammatory responses, including iNOS and TNF-α [34, 40]. The protective mechanisms of many antioxidants are based on their capacities for NF-κB inactivation, as some studies have reported that ROS generation is the central pathway in NF-κB activation [40]. As shown in Fig. 6c, d, Ti particle-stimulated macrophages showed enhanced NFκB gene expression and phosphorylation, and that resveratrol pretreatment significantly inhibited these effects. Our findings suggest that inhibition of NF-κB activation is consistent with reduced NO, MDA, and ROS levels, and
Resveratrol Protects against Titanium
Fig. 6. Resveratrol inhibited gene expression and release of TNF-α and suppressed NF-κB activation. RAW 264.7 macrophages were cultured in 6-well plates for at least 12 h, followed by pretreatment with or without resveratrol at various concentrations, and Ti particle (0.1 mg/ml) stimulation. RNA was extracted for q-PCR, and supernatants were collected for TNF-α release determination (a–c). Resveratrol attenuated the increased TNF-α and NF-κB gene expression and TNF-α release. Results represent mean ± SD values of three replicates performed in triplicate (d). RAW 264.7 macrophages were cultured in a dish for adherence for at least 12 h; the medium was then replaced with serum-free DEME for 12 h, followed by pretreatment with or without 40 μM resveratrol, and Ti particle (0.1 mg/ml) stimulation. Cells were harvested at 15, 30, and 60 min Ti particle stimulation. Resveratrol decreased NF-κB phosphorylation. Mean ± SD values of three replicates are shown. *P < 0.05 vs. the control group, #P < 0.05 vs. the Ti-only group.
these reductions may occur via downregulation of oxidative enzyme activity and upregulation of antioxidant enzyme activity. Considering that NF-κB is a redox-sensitive transcriptional factor and an important participant in antioxidant enzyme activity [41], we conclude that inhibition of NF-κB activation may be responsible for resveratrol’s protective effect against oxidative stress. In conclusion, the results of the present study demonstrate that wear particles can induce oxidative stress, via dysregulation of oxidative stress-associated enzymes and NF-κB activation, and this process will be involved in periprosthetic osteolysis and aseptic implant loosening. Resveratrol protects Ti particle-activated macrophages from oxidative stress through reduction of NO production, ROS generation, and lipid peroxidation. It also decreases
oxidative enzyme activity and increases antioxidant enzyme activity. This protective effect against oxidative stress also involves downregulation of the gene expression and phosphorylation of NF-κB. Our findings demonstrate that resveratrol may have applications as an antioxidant in Ti particle-induced oxidative stress, and may be a nonsurgical biological treatment option for aseptic implant loosening. However, resveratrol does not completely inhibit NF-κB phosphorylation and TNF-α release caused by stimulation with Ti particles, as well as ROS generation, which suggests that other pathways may be involved in Ti particle-induced oxidative stress. Our further studies in animal models will focus on resveratrol’s protective effects against ROS generated by other pathways.
Luo, Li, Wang, Wang, Zhang, Chen, Zhang, Xiao, Li, Guo, and Sheng ACKNOWLEDGMENTS This work is supported by the grants from the National Natural Science Foundation of China (no. 81171710) and the International Cooperation of Science and Technology of Guangdong Province, China (no. 2013B051000040).
COMPLIANCE WITH ETHICAL STANDARDS Conflict of Interest. The authors declare that they have no competing interests.
REFERENCES 1. Thiele, K., C. Perka, G. Matziolis, H.O. Mayr, M. Sostheim, and R. Hube. 2015. Current failure mechanisms after knee arthroplasty have changed: polyethylene wear is less common in revision surgery. Journal of Bone and Joint Surgery (American) 97: 715–720. 2. Pivec, R., A.J. Johnson, S.C. Mears, and M.A. Mont. 2012. Hip arthroplasty. Lancet 380: 1768–1777. 3. Yang, F., W. Wu, L. Cao, Y. Huang, Z.N. Zhu, T.T. Tang, et al. 2011. Pathways of macrophage apoptosis within the interface membrane in aseptic loosening of prostheses. Biomaterials 32: 9159–9167. 4. Ingham, E., and J. Fisher. 2005. The role of macrophages in osteolysis of total joint replacement. Biomaterials 26: 1271–1286. 5. Pajarinen, J., V.P. Kouri, E. Jamsen, T.F. Li, J. Mandelin, and Y.T. Konttinen. 2013. The response of macrophages to titanium particles is determined by macrophage polarization. Acta Biomaterialia 9: 9229–9240. 6. Pajarinen, J., Y. Tamaki, J.K. Antonios, T.H. Lin, T. Sato, Z.Y. Yao, et al. 2015. Modulation of mouse macrophage polarization in vitro using IL-4 delivery by osmotic pumps. Journal of Biomedical Materials Research. Part A 103: 1339–1345. 7. O’Neill, S.C., J.M. Queally, B.M. Devitt, P.P. Doran, and J.M. O’Byrne. 2013. The role of osteoblasts in peri-prosthetic osteolysis. Bone & Joint Journal 95B: 1022–1026. 8. Kinov, P., A. Tzoncheva, and P. Tivchev. 2010. Evidence linking elevated oxidative stress and aseptic loosening of hip arthroplasty. Comptes rendus de l'Academie Bulgare des Sciences 63: 1231–1238. 9. Brown, G.C. 2001. Regulation of mitochondrial respiration by nitric oxide inhibition of cytochrome c oxidase. BBA Bioenergetics 1504: 46–57. 10. Lambeth, J.D. 2004. Nox enzymes and the biology of reactive oxygen. Nature Reviews Immunology 4: 181–189. 11. Mates, J.M. 2001. Effects of antioxidant enzymes in the molecular control of reactive oxygen species toxicology (vol 153, pg 83, 2000). Toxicology 163: 219–219. 12. Maitra, U., N. Singh, L. Gan, L. Ringwood, and L.W. Li. 2009. IRAK-1 contributes to lipopolysaccharide-induced reactive oxygen species generation in macrophages by inducing NOX-1 transcription and Rac1 activation and suppressing the expression of antioxidative enzymes. Journal of Biological Chemistry 284: 35403–35411.
13. Steinbeck, M.J., L.J. Jablonowski, J. Parvizi, and T.A. Freeman. 2014. The role of oxidative stress in aseptic loosening of total hip arthroplasties. Journal of Arthroplasty 29: 843–849. 14. Suh, K.T., J.W. Chang, and J.S. Jung. 2002. The role of inducible nitric oxide synthase in aseptic loosening after total hip arthroplasty. Journal of Bone and Joint Surgery (British) 84B: 753–757. 15. Kinov, P., A. Leithner, R. Radl, K. Bodo, G.A. Khoschsorur, K. Schauenstein, et al. 2006. Role of free radicals in aseptic loosening of hip arthroplasty. Journal of Orthopaedic Research 24: 55–62. 16. Chen, W.S., Z.Q. Li, Y. Guo, Y.H. Zhou, Z.J. Zhang, Y.C. Zhang, et al. 2015. Wear particles promote reactive oxygen species-mediated inflammation via the nicotinamide adenine dinucleotide phosphate oxidase pathway in macrophages surrounding loosened implants. Cellular Physiology and Biochemistry 35: 1857–1867. 17. Chen, W.S., Z.Q. Li, Y. Guo, Y.H. Zhou, Y.C. Zhang, G.T. Luo, et al. 2015. Wear particles impair antimicrobial activity via suppression of reactive oxygen species generation and ERK1/2 phosphorylation in activated macrophages. Inflammation 38: 1289–1296. 18. Peng, K.T., W.H. Hsu, H.N. Shih, C.W. Hsieh, T.W. Huang, R.W.W. Hsu, et al. 2011. The role of reactive oxygen species scavenging enzymes in the development of septic loosening after total hip replacement. Journal of Bone and Joint Surgery (British) 93B: 1201–1209. 19. Hallab, N.J., and J.J. Jacobs. 2009. Biologic effects of implant debris. Bulletin of the NYU Hospital for Joint Diseases 67: 182–188. 20. Raghunathan, V.K., M. Devey, S. Hawkins, L. Hails, S.A. Davis, S. Mann, et al. 2013. Influence of particle size and reactive oxygen species on cobalt chrome nanoparticle-mediated genotoxicity. Biomaterials 34: 3559–3570. 21. Tsaryk, R., K. Peters, S. Barth, R.E. Unger, D. Scharnweber, and C.J. Kirkpatrick. 2013. The role of oxidative stress in pro-inflammatory activation of human endothelial cells on Ti6Al4V alloy. Biomaterials 34: 8075–8085. 22. Samelko, L., M.S. Caicedo, S.J. Lim, C. Della-Valle, J. Jacobs, and N.J. Hallab. 2013. Cobalt-alloy implant debris induce HIF-1 alpha hypoxia associated responses: a mechanism for metal-specific orthopedic implant failure. PloS One 8(6): e67127. doi:10.1371/ journal.pone.0067127. 23. Pirola, L., and S. Frojdo. 2008. Resveratrol: one molecule, many targets. IUBMB Life 60: 323–332. 24. He, X., G. Andersson, U. Lindgren, and Y. Li. 2010. Resveratrol prevents RANKL-induced osteoclast differentiation of murine osteoclast progenitor RAW 264.7 cells through inhibition of ROS production. Biochemical and Biophysical Research Communications 401: 356–362. 25. Mizutani, K., K. Ikeda, Y. Kawai, and Y. Yamori. 2000. Resveratrol attenuates ovariectomy-induced hypertension and bone loss in strokeprone spontaneously hypertensive rats. Journal of Nutritional Science and Vitaminology 46: 78–83. 26. Takagi, M., S. Santavirta, H. Ida, M. Ishii, I. Takei, S. Niissalo, et al. 2001. High-turnover periprosthetic bone remodeling and immature bone formation around loose cemented total hip joints. Journal of Bone and Mineral Research 16: 79–88. 27. Layoun, A., M. Samba, and M.M. Santos. 2015. Isolation of murine peritoneal macrophages to carry out gene expression analysis upon Toll-like receptors stimulation. Journal of Visualized Experiments (98): e52749. doi:10.3791/52749. 28. Sun, Y., L.W. Oberley, and Y. Li. 1988. A simple method for clinical assay of superoxide dismutase. Clinical Chemistry 34: 497–500. 29. Aebi, H. 1984. Catalase in vitro. Methods in Enzymology 105: 121–126. 30. Ozmen, I., and O.I. Kufrevioglu. 2004. Effects of antiemetic drugs on glucose 6-phosphate dehydrogenase and some antioxidant enzymes. Pharmacological Research 50: 499–504.
Resveratrol Protects against Titanium 31. Schroder, K. 2015. NADPH oxidases in bone homeostasis and osteoporosis. Cellular and Molecular Life Sciences 72: 25–38. 32. Hou, Y.C., A. Janczuk, and P.G. Wang. 1999. Current trends in the development of nitric oxide donors. Current Pharmaceutical Design 5: 417–441. 33. Devasagayam, T.P., J.C. Tilak, K.K. Boloor, K.S. Sane, S.S. Ghaskadbi, and R.D. Lele. 2004. Free radicals and antioxidants in human health: current status and future prospects. Journal of the Association of Physicians of India 52: 794–804. 34. Chung, I.S., J.A. Kim, J.A. Kim, H.S. Choi, J.J. Lee, M. Yang, et al. 2013. Reactive oxygen species by isoflurane mediates inhibition of nuclear factor kappa B activation in lipopolysaccharide-induced acute inflammation of the lung. Anesthesia and Analgesia 116: 327–335. 35. Lambeth, J.D., and A.S. Neish. 2014. Nox enzymes and new thinking on reactive oxygen: a double-edged sword revisited. Annual Review of Pathology Mechanisms 9: 119–145. 36. Deponte, M. 1830. Glutathione catalysis and the reaction mechanisms of glutathione-dependent enzymes. BBA General Subjects 2013: 3217–3266.
37. Ozmen, I., M. Naziroglu, and R. Okutan. 2006. Comparative study of antioxidant enzymes in tissues surrounding implant in rabbits. Cell Biochemistry and Function 24: 275–281. 38. Merkel, K.D., J.M. Erdmann, K.P. McHugh, Y. Abu-Amer, F.P. Ross, and S.L. Teitelbaum. 1999. Tumor necrosis factor-alpha mediates orthopedic implant osteolysis. American Journal of Pathology 154: 203–210. 39. Fuller, K., C. Murphy, B. Kirstein, S.W. Fox, and T.J. Chambers. 2002. TNFa potently activates osteoclasts, through a direct action independent of and strongly synergistic with RANKL. Endocrinology 143: 1108–1118. 40. Rangasamy, T., J. Guo, W.A. Mitzner, J. Roman, A. Singh, A.D. Fryer, et al. 2005. Disruption of Nrf2 enhances susceptibility to severe airway inflammation and asthma in mice. Journal of Experimental Medicine 202: 47–59. 41. Schuliga, M. 2015. NF-kappa B signaling in chronic inflammatory airway disease. Biomolecules 5: 1266–1283.
ORIGINAL ARTICLE
Resveratrol Protects against Titanium Particle-Induced Aseptic Loosening Through Reduction of Oxidative Stress and Inactivation of NF-κB Guotian Luo,1 Ziqing Li,1 Yu Wang,2 Haixing Wang,1 Ziji Zhang,1 Weishen Chen,1 Yangchun Zhang,1 Yinbo Xiao,1 Chaohong Li,3 Ying Guo,4,5 and Puyi Sheng1,5
Abstract—Aseptic implant loosening is closely associated with chronic inflammation induced by implant wear debris, and reactive oxygen species (ROS) play an important role in this process. Resveratrol, a plant compound, has been reported to act as an antioxidant in many inflammatory conditions; however, its protective effect and mechanism against wear particle-induced oxidative stress remain unknown. In this study, we evaluated resveratrol’s protective effects against wear particle-induced oxidative stress in RAW 264.7 macrophages. At non-toxic concentrations, resveratrol showed dose-dependent inhibition of nitric oxide (NO) production, ROS generation, and lipid peroxidation. It also downregulated the gene expression of oxidative enzymes, including inducible nitric oxide synthase (iNOS) and nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (NOX)-1 and NOX-2, and promoted the gene expression and activities of antioxidant enzymes, including catalase (CAT), superoxide dismutase (SOD), glutathione reductase (GR), and glutathione peroxidase (GPx). This protective effect against wear particle-induced oxidative stress was accompanied by a reduction of gene expression and release of tumor necrosis factor-α (TNF-α), and decreased gene expression and phosphorylation of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB). These findings demonstrate that resveratrol can inhibit wear particle-induced oxidative stress in macrophages, and may exert its antioxidant effect and protect against aseptic implant loosening. KEY WORDS: aseptic loosening; chronic inflammation; oxidative stress; reactive oxygen species (ROS); resveratrol.
Guotian Luo and Ziqing Li contributed equally to this work. 1
Department of Joint Surgery, The First Affiliated Hospital, Sun Yat-sen University, NO. 58, Zhongshan Rd. 2, Guangzhou, 510080, People’s Republic of China 2 Allergy Center, Otorhinolaryngology Hospital, The First Affiliated Hospital, Sun Yat-sen University, Guangzhou, China 3 Department of Histology and Embryology, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, China 4 Department of Endocrinology, Sun Yat-sen Memorial Hospital, Sun Yatsen University, NO. 107, Yan Jiang Xi Road, Guangzhou, 510120, People’s Republic of China 5 To whom correspondence should be addressed to Ying Guo at Department of Endocrinology, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, NO. 107, Yan Jiang Xi Road, Guangzhou, 510120, People’s Republic of China. E-mail: [email protected]; and Puyi Sheng at Department of Joint Surgery, The First Affiliated Hospital, Sun Yat-sen University, NO. 58, Zhongshan Rd. 2, Guangzhou, 510080, People’s Republic of China. E-mail: [email protected]
INTRODUCTION Aseptic implant loosening is one of the major longterm complications after total joint arthroplasty, and the most common cause for revision surgery [1, 2]. There is abundant evidence to show that periprosthetic osteolysis and aseptic loosening are mainly driven by macrophage-induced inflammation due to implant wear debris generated from repetitive movements between joint prosthesis components [3, 4]. The macrophages activated by wear particles secrete various pro-inflammatory cytokines such as tumor necrosis factor (TNF)-α, interleukin 1β (IL-1β), and IL-6, and lead to an increase in osteoclastogenesis and a decrease in osteoblast formation and function. These changes promote bone resorption and inhibit bone formation, ultimately causing periprosthetic osteolysis and aseptic loosening [5–7].
0360-3997/16/0000-0001/0 # 2016 Springer Science+Business Media New York
Luo, Li, Wang, Wang, Zhang, Chen, Zhang, Xiao, Li, Guo, and Sheng Inflammatory processes are closely linked to oxidative stress, an imbalance condition between the formation and degradation of oxidants, including reactive nitrogen species (RNS, e.g., nitric oxide (NO)) and reactive oxygen species (ROS), such as superoxide anion (O 2 − ), hydrogen peroxide (H 2 O 2 ), and hydroxyl radical (OH) [8, 9]. ROS/RNS generation is regulated by oxidative enzymes including nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (NOX) and nitric oxide synthase (iNOS), and antioxidant enzymes including catalase (CAT), glutathione peroxidase (GPx), glutathione reductase (GR), and superoxide dismutase (SOD) [10–12]. Significantly increased iNOS expression and nitrotyrosine accumulation have been reported in periprosthetic tissues of patients with aseptic implant loosening [13, 14]. In periprosthetic tissue of patients with aseptic loosening, oxidized glutathione and malondialdehyde (MDA) levels, two indicators of oxidative stress, increased compared to those in controls [15]. In our previous study, NOX-1 and NOX-2 expression was higher in aseptically loosened periprosthetic tissue than in control tissue [16, 17]. Furthermore, dysregulated ROS-related enzymes were found in the synovial fluid of patients with aseptic loosening [18]. In in vitro studies, ROS/RNS overproduction has been observed in various wear particle-exposed cell types [19–22]. Thus, ROS/RNS and ROS/RNS-induced oxidative stress play major roles in aseptic implant loosening, leading to prosthesis failure. Resveratrol is a polyphenol found in a variety of dietary sources such as grape, berries, and peanuts, and numerous studies, ranging from cell culture to animal model studies, have shown its health benefits, which include antioxidant, anti-inflammatory, and antitumor effects [23]. Its bone-protective effects are also well demonstrated. Resveratrol treatment improves osteoblast formation and function and inhibits osteoclastogenesis [24, 25]. On the basis of these findings, we hypothesized that resveratrol may inhibit periprosthetic osteolysis and aseptic loosening induced by implant wear particles, and that the protective effect may be exerted via the suppression of oxidative stress. To test this hypothesis, we used a living cell system of titanium (Ti) particle-exposed RAW 264.7 macrophages as an aseptic implant-loosening model to determine whether resveratrol modulates oxidative stress and inhibits aseptic loosening.
MATERIALS AND METHODS Preparation of Ti Particles Commercially pure Ti particles were purchased from Alfa Aesar (Ward Hill, MA, USA). Particle size was measured using scanning electron microscope, and the mean particle diameter was 2.6 ± 1.9 μm (Fig. 1), with 90 % of the particles having a diameter smaller than 3.6 μm. For endotoxin removal, Ti particles were sterilized by baking at 180 °C for 6 h, followed by treatment with 70 % ethanol for 48 h at room temperature as described previously [16, 26]. The particles were reconstituted at a concentration of 10 mg/ml in sterile phosphate-buffered saline (PBS) and diluted to 0.1 mg/ml. The particles were tested using a commercial Limulus assay kit (Chromogenic End-point TAL with a Diazo cou-pling kit, Xiamen Houshiji, Fujian, China) to rule out endotoxin contamination. Particles with endotoxin levels lower than 0.1 EU/ml were considered uncontaminated. Only endotoxin-free particles were used in the study. Isolation and Treatment of Murine Peritoneal Macrophages Female C57BL/6J mice aged 6 weeks were obtained from the Laboratory Animal Services Centre of Guangdong Province and were kept in a specific pathogen-free condition. All animal experimentations were performed with the approval of the Institutional Animal Care and Use Committee of Sun Yat-sen University, Guangzhou, China, and conducted following the institutional guidelines of Sun Yat-sen University. The isolation of murine peritoneal macrophages was performed according to previous publication [27] with a slight modification. Briefly, mice were each injected with 1 ml of 3 % sterile thioglycolate broth into the peritoneum to elicit an inflammatory response and recruit peritoneal macrophages. Five days later, mice were sacrificed by cervical dislocation and sterilized with 70 % alcohol; the peritoneal cavity was then rinsed with 5 ml pre-cold PBS, and peritoneal fluid was collected. Subsequently, the collected cells within fluid were centrifuged in 50-ml tubes for 10 min at 1000 rpm, 4 °C, discarded supernatant and resuspended cell pellet with RPMI 1640 medium (Gibco, Life Technologies, CA, USA) containing 10 % fetal calf serum (Gibco, Life Technologies, CA, USA) and 1 % antibiotics (Gibco, Life Technologies, CA, USA). After that, the cells were plated in 6-well plates with a density of 2 × 106 cells/ml and cultured a 5 % CO2 incubator at 37 °C. After 2 h for the adherence of macrophages, non-adherent cells were
Resveratrol Protects against Titanium
Fig. 1. Scanning electron micrograph of titanium particles used in the experiments (×6000).
removed and washed with warm PBS three times. Thereafter, the adhering macrophages were pre-treated with various concentrations of resveratrol for 4 h before incubation with Ti particles (0.1 mg/ml) for 12 h in serum-free RPMI 1640 medium. Cell Culture and Treatment RAW 264.7 macrophages (ATCC, MD, USA) were grown in high-glucose Dulbecco’s Modified Eagle’s Medium (DMEM; Gibco, Life Technologies, CA, USA) with 10 % fetal calf serum (Gibco, Life Technologies, CA, USA) in a 5 % CO2 incubator at 37 °C and subcultured every 48 h after gentle scraping. Resveratrol (SigmaAldrich) was solubilized in dimethyl sulfoxide (DMSO) at 20 mM and stored at −20 °C. Before use, resveratrol was reconstituted to a different concentration in DMEM. Cells were plated in 6-well plates at a density of 2 × 106 cells per well and incubated overnight. Thereafter, they were pre-treated with various concentrations of resveratrol for 4 h before incubation with Ti particles (0.1 mg/ml) for 12 h (for PCR and oxidative stress-associated assays) and for 15, 30, or 60 min (for Western blotting analysis). Cytotoxicity Analysis Resveratrol’s cytotoxic effect of on RAW 264.7 macrophages was detected using the WST-1 assay (Roche). Briefly, cells were plated at a density of 5 × 104 cells/well into 96-well plates. After incubating for 24 h, cells were treated with different concentrations of resveratrol (0– 160 μM) for 24 h. Before measurement, 10 μl of WST-1 was added to each well and gently mixed, followed by incubation for 4 h at 37 °C. Thereafter, absorbance was
measured at 450 nm with a reference wavelength at 620 nm. NO Production NO concentration in the supernatant was measured using a commercial assay kit according to the manufacturer’s protocol (Beyotime, China). Absorbance was measured at 540 nm and calibrated with a calibration curve to determine the NO content in the supernatant. Measurement of Intracellular ROS ROS production in RAW 264.7 macrophages was measured using a fluorescence probe, 2′,7′dichlorodihydrofluorescein diacetate (H 2 DCFDA; Invitrogen). After stimulation, the cells were collected and resuspended in DMEM containing 10 μM H2DCFDA and incubated for 30 min at 37 °C in darkness. After washing with PBS twice, fluorescence intensity was then measured by flow cytometry (exCitation wavelength, 488 nm; emission wavelength, 525 nm; Beckman CytoFLEX). Fifty thousand macrophages were analyzed for each sample. Data were analyzed using FlowJo (TreeStar, USA). Lipid Peroxidation MDA, an indicator of lipid peroxidation, was examined using a commercial assay kit (Beyotime, China) according to the manufacturer’s protocol. Absorbance was measured at 532 nm and calibrated with a calibration curve to determine the MDA content. The results are shown as nanomole per milligrams protein.
Luo, Li, Wang, Wang, Zhang, Chen, Zhang, Xiao, Li, Guo, and Sheng Quantitative Real-Time PCR Total RNA was extracted with TriPure Isolation Reagent (Roche, USA), and complementary DNA (cDNA) synthesis was performed with 1 μg of RNA using Transcriptor First Strand cDNA Synthesis Kit (Roche, USA). Quantitative real-time PCR was performed with KAPA SYBR® FAST qPCR Master Mix (Kapa Biosystems, USA). The specific primer sequences are described in Table 1. PCR amplification was performed in CFX96 (Bio-Rad). Relative levels of gene expression were analyzed using the 2−△△CT method by using GAPDH as an endogenous control.
Measurement of SOD, CAT, and GR Activities The enzymatic activities of SOD, CAT, and GR were measured using commercial assay kits (Beyotime, China) according to the manufacturer’s protocol. Enzymatic activities were expressed as unit per milligrams protein. The SOD activity assay was based on SOD’s ability to inhibit the photochemical reduction of nitroblue tetrazolium (NBT) via O2− generated by the xanthine/xanthine oxidase system [28]. One unit of SOD activity was defined as the amount of enzyme required to inhibit 50 % NBT reduction monitored at 560 nm. The CAT activity assay was based on CAT’s ability to degrade H2O2 [29]. One unit of CAT activity was considered as the amount of enzyme required to scavenge 1 μmol H2O2 in 1 min per milligrams protein at pH 7.0 at 25 °C. The GR activity assay was based on the decrease in absorbance caused by NADPH oxidation at 340 nm [30]. One unit of enzymatic activity was defined as the amount
of enzyme required to oxidize 1 μmol NADPH at pH 7.0 at room temperature. Western Blotting Western blotting was performed as previously described with a slight modification [16]. Briefly, cells were prepared in lysis buffer containing protease inhibitor and phosphatase inhibitors. After centrifugation, protein concentration in the supernatant was measured using Bio-Rad protein assay system. Heat-denatured proteins were electrophoresed on 8 % SDS-PAGE, followed by transfer onto nitrocellulose membranes. The membranes were blocked in 5 % skim milk for 30 min at room temperature and incubated overnight at 4 °C with primary antibodies against p-NF-κB-p65 (1:1000) and NF-κB-p65 (1:1000; Cell Signal Tech), and then incubated with horseradish peroxidase-conjugated anti-rabbit IgG (1:3000; Jackson Immunoresearch) as the secondary antibody for 2 h at room temperature. Bound antibodies were detected using enhanced chemiluminescence reagents (GE Healthcare, Buckinghamshire, UK) and visualized using a detection system (ImageQuant LAS 4000 mini, GE Healthcare, Buckinghamshire, UK). Results were analyzed using Image J software. Statistical Analysis All experimental data are from at least three independent experiments performed in triplicate and presented as the mean ± SD. Data analysis was performed using GraphPad Prism version 6 (GraphPad software, San Diego, CA) with one-way analysis of variance (ANOVA) or
Table 1. Primer Sequences for Quantitative Real-Time PCR Gene
Forward primer
Reverse primer
Gapdh Inos Nox-1 Nox-2 Cu/Zn Sod Mn Sod Gpx Gr Cat Tnf-α Nf-κb
ACTTTGTCAAGCTCATTTCC ACATCGACCCGTCCACAGTAT GGTTGGGGCTGAACATTTTTC AGCAGTTGATGGACCCTTTG AACCAGTTGTGTTGTCAGGAC TGGACAAACCTGAGCCCTAAG AGTCCACCGTGTATGCCTTCT GCGTGAATGTTGGATGTGTACC GGAGTCTTCGTCCCGAGTCT CCCTCACACTCAGATCATCTTCT TCAATGGCTACACAGGACCA
TGCAGCGAACTTTATTGATG CAGAGGGGTAGGCTTGTCTC TCGACACACAGGAATCAGGAT TACCAGACAGACTTGAGAATGGAG CCACCATGTTTCTTAGAGTGAGG CCCAAAGTCACGCTTGATAGC GAGACGCGACATTCTCAATGA GTTGCATAGCCGTGGATAATTTC CGGTCTTGTAATGGAACTTGC GCTACGACGTGGGCTACAG TCGCTTCTTCACACACTGGAT
Gapdh glyceraldehyde-3-phosphate dehydrogenase, Inos inducible nitric oxide synthase, Nox-1 nicotinamide adenine dinucleotide phosphate oxidase–1, Nox-2 nicotinamide adenine dinucleotide phosphate oxidase–2, Cu/Zn Sod superoxide dismutase 1, Mn Sod superoxide dismutase 2, Gpx glutathione peroxidase, Gr Glutathione reductase, Cat catalase, Tnf-α tumor necrosis factor-alpha, Nf-κb nuclear factor kappa B
Resveratrol Protects against Titanium Student’s t test. P < 0.05 was considered statistically significant.
Resveratrol Inhibits the mRNA Expression of Oxidative Enzymes
RESULTS
The messenger RNA (mRNA) expression of iNOS, NOX-1, and NOX-2 markedly improved in the Ti-only group (Fig. 4a–c). Resveratrol pretreatment significantly attenuated the mRNA expression of oxidative enzymes in a dose-dependent manner.
Effects of Resveratrol on RAW 264.7 Macrophage Cell Viability At 80 and 160 μM, resveratrol showed a significant toxic effect on RAW 264.7 macrophages compared to the effects of the control after incubation for 24 h (Fig. 2). In the following experiments, cells were incubated with various concentrations of resveratrol (10, 20, and 40 μM) for 4 h before stimulation with Ti particles. Resveratrol Reduced Wear Particles-Induced Oxidative Stress As shown in Fig. 3a, NO production in supernatant increased significantly with the stimulation of Ti particles, and this increase could be attenuated by resveratrol in a dose-dependent manner. Compared with the control group, the Ti-only group showed significantly increased MDA production. However, MDA content decreased markedly upon pretreatment with 10, 20, and 40 μM resveratrol (Fig. 3b). In addition, compared to the control group, the Ti-only group showed significantly increased ROS generation (Fig. 3c, d); resveratrol showed dose-dependent attenuation of ROS generation.
Resveratrol Improves mRNA Expression and Activities of Anti-Oxidative Enzymes Compared to the control group, the Ti-only group showed a negligible decrease in the mRNA expression of Cu/Zn SOD and a significant decrease in the expression of Mn SOD and GPx (Fig. 5a–e). Interestingly, the mRNA expression of GR and CAT increased significantly. Pretreatment with 10, 20, and 40 μM resveratrol significantly improved the mRNA expression of Cu/Zn SOD, Mn SOD, and CAT compared to the expression in the Ti-only group; however, it did not significantly alter the mRNA expression of GPx and GR relative to that in the Ti-only group. Compared with the control group, in RAW 264.7 macrophages, the Ti-only group showed significantly lower SOD and CAT activities and nonsignificant upregulation of GR activity. Resveratrol pretreatment significantly increased SOD, CAT, and GR activities. In murine peritoneal macrophages, Ti stimulation also showed significantly lower SOD and CAT activities and non-significant upregulation of GR activity. Resveratrol pretreatment significantly increased SOD and CAT activities in a dose-dependent manner, while pretreatment with resveratrol at 40 μM increased GR activity significantly (Table 2). Resveratrol Inhibited Gene Expression and Release of TNF-α and Suppressed NF-κB Activation
Fig. 2. Effects of resveratrol treatment on RAW 264.7 macrophage cell viability. RAW 264.7 macrophages were cultured in 96-well plates and treated with different concentrations of resveratrol (0–160 μM) for 24 h, and cell viability were measured. *P < 0.05 vs. the control group.
The Ti-only group showed significantly increased tumor necrosis factor-α (TNF-α) mRNA expression and release in the supernatant, an effect that was suppressed by resveratrol pretreatment in a dosedependent manner (Fig. 6a, b). The mRNA expression and phosphorylation of nuclear factor kappalight-chain-enhancer of activated B cells (NF-κB) increased significantly in the Ti-only group, and the addition of resveratrol attenuated this effect (Fig. 6c, d).
Luo, Li, Wang, Wang, Zhang, Chen, Zhang, Xiao, Li, Guo, and Sheng
Fig. 3. Resveratrol reduced NO production, lipid peroxidation, and ROS generation. RAW 264.7 macrophages cultured in 6-well plates for at least 12 h, followed by pretreatment with or without 10, 20, or 40 μM resveratrol, and stimulation with Ti particles (0.1 mg/ml) or LPS (1 μg/ml) as a positive control. Supernatants were collected for measurement of NO production (a), and cells were harvested for measurement of MDA (b) and ROS generation (c and d). Mean ± SD values of at least three replicates are shown. *P < 0.05 vs. the control group, #P < 0.05 vs. the Ti-only group.
DISCUSSION Chronic oxidative stress plays an important role in the pathologic process of periprosthetic osteolysis, resulting in aseptic implant loosening [8, 14, 15, 31]. Currently, revision surgery for aseptic loosening is costly and technically demanding for surgeon, and effective non-surgical biological treatment options are required [6]. Numerous studies have focused on resveratrol as a potential antioxidant in chronic inflammation [23–25]. Here, we demonstrated that resveratrol protects against periprosthetic osteolysis and aseptic loosening.
NO is an important intracellular messenger involved in many physiological and pathological processes, including inflammation and pathogen elimination [32]. However, overproduction of NO can cause reaction with superoxide to produce the damaging oxidant, causing oxidative stress and cell damage [9]. In this study, Ti particles could significantly increase NO production in macrophages and this increase could be significantly reduced by resveratrol (Fig. 3a). Expression of MDA, an indicator of lipid peroxidation, was higher in the periprosthetic tissue of patients with aseptic loosening [15]. Significantly increased MDA levels were observed in the Ti-only group, and the increase could be attenuated by resveratrol (Fig. 3b). ROS are a
Resveratrol Protects against Titanium
Fig. 4. Resveratrol decreased gene expression of oxidative enzymes. RAW 264.7 macrophages were cultured in 6-well plates for at least 12 h, followed by pretreatment with or without resveratrol at various concentrations, and Ti particle (0.1 mg/ml) stimulation. RNA was extracted for q-PCR. Resveratrol decreased iNOS, NOX-1, and NOX-2 gene expression. Results represent mean ± SD values of three replicates performed in triplicate. *P < 0.05 vs. the control group, #P < 0.05 vs. the Ti-only group.
natural byproduct of the normal metabolism of oxygen and play an important role in cell signaling and homeostasis [33]. However, overproduction of ROS is associated with oxidative stress leading to oxidative damage [8, 9]. Our study showed that macrophage exposure to Ti particles could significantly increase ROS generation; this finding
is consistent with that of a previous study in which cells in periprosthetic tissue and metal corrosion induced ROS formation [21]. The increase in ROS generation could be attenuated by resveratrol (Fig. 3c, d). These findings suggest that resveratrol can inhibit ROS generation, and the increase in MDA levels may be caused by ROS
Fig. 5. Resveratrol increased gene expression of antioxidant enzymes. RAW 264.7 macrophages were cultured in 6-well plates for at least 12 h, followed by pretreatment with or without resveratrol at various concentrations, and Ti particle (0.1 mg/ml) stimulation. RNA was extracted for q-PCR. Resveratrol increased Cu/Zn SOD, Mn SOD, GPx, GR, and CAT gene expression. Results represent mean ± SD values of three replicates performed in triplicate. *P < 0.05 vs. the control group, #P < 0.05 vs. the Ti-only group; ns not significant, compared with the Ti-only group.
Luo, Li, Wang, Wang, Zhang, Chen, Zhang, Xiao, Li, Guo, and Sheng Table 2. Resveratrol Enhanced Enzymatic Activity During Ti Particle Stimulation Group
RAW 264.7 macrophages
Murine peritoneal macrophages
SOD (U/mg protein) CAT (U/mg protein) GR (U/mg protein) SOD (U/mg protein) CAT (U/mg protein) GR (U/mg protein) Control Ti (0.1 mg/ml) Ti + RSV (10 μM) Ti + RSV (20 μM) Ti + RSV (40 μM)
21.88 ± 0.14 20.30 ± 0.40* 30.08 ± 0.88# 30.06 ± 1.60# 34.36 ± 1.57#
34.35 ± 1.48 24.47 ± 0.36* 27.99 ± 0.87# 29.84 ± 1.49# 37.85 ± 1.08#
2.054 ± 0.03 2.227 ± 0.06 2.323 ± 0.03# 2.474 ± 0.02# 2.716 ± 0.04#
17.57 ± 0.21 16.58 ± 0.35* 18.28 ± 0.34# 19.41 ± 0.04# 22.03 ± 0.20#
22.00 ± 0.66 18.19 ± 0.14* 19.59 ± 0.29# 20.80 ± 0.29# 28.33 ± 0.24#
1.535 ± 0.13 1.896 ± 0.08 1.979 ± 0.12 2.096 ± 0.17 2.580 ± 0.21#
Results represent mean ± SD values of three replicates assayed in triplicate *P < 0.05 vs. the control group; #P < 0.05 vs. the Ti-only group
overproduction. In other words, the fact that resveratrol can diminish lipid peroxidation further supports the finding that resveratrol is capable of scavenging ROS. To determine the mechanisms underlying resveratrol’s protective effect against Ti particle-induced oxidative stress, we evaluated the mRNA expression of oxidative enzymes, including iNOS, NOX-1, and NOX-2. iNOS is one of the three major NOS isoforms, and inhibition of excessive iNOS-derived NO production can inhibit oxidative stress [34]. High iNOS expression in periprosthetic tissues of patients with aseptic loosening has been reported [14]. In this study, resveratrol attenuated the increased iNOS gene expression induced by Ti particles (Fig. 4a), which was consistent with the observed inhibition of NO production. These data suggest that the protection of resveratrol against Ti particle-induced oxidative stress in macrophages may involve decreasing NO production via a decrease of iNOS. NOX enzymes are integral membrane proteins and the main source of ROS in immune cells [10, 31, 35]. We previously found that NOX-1 and NOX-2 were highly expressed in aseptically loosened interface membranes and Ti particle-stimulated macrophages [16]. In this study, NOX-1 and NOX-2 gene expression increased in Ti particle-stimulated macrophages, and was attenuated by resveratrol (Fig. 4b, c). Besides detection of oxidative enzymes, we also measured mRNA level and activity of specific antioxidant enzymes. SOD, CAT, GPx, and GR are important antioxidant enzymes in ROS scavenging. SOD catalyzes the dismutation of the O2− radical into ordinary molecular oxygen (O2) or H2O2, and CAT can catalyze H2O2 decomposition into water and oxygen. GPx has peroxidase activity and protects the organism from oxidative damage. GR catalyzes the reduction of the disulfide form glutathione (GSSG) to the sulfhydryl form glutathione (GSH), which is a critical molecule against oxidative stress and in maintaining the reducing state of the cell [36, 37]. A decrease in antioxidant enzymes in
tissues surrounding implants in rabbits has been reported [37]. Our results showed that resveratrol could improve the gene expression of Cu/Zn SOD, Mn SOD, and CAT, but did not significantly alter the expression of GPx and GR (Fig. 5a–e), and resveratrol pretreatment significantly improved SOD, CAT, and GR activities in RAW 264.7 macrophages. In murine peritoneal macrophages, we found the resveratrol pretreatment significantly improved SOD and CAT activities, while GR activity only increased significantly at a concentration of 40 μM (Table 2). Thus, the downregulation of oxidative enzyme activity and increase of antioxidant enzyme activity may be responsible for resveratrol’s protective effect against Ti particle-induced oxidative stress in macrophages. To further demonstrate the mechanistic basis of resveratrol’s protective effect against Ti particle-induced oxidative stress, its effects on TNF-α and NF-κB were also explored. Current view suggests that periprosthetic osteolysis occurs owing to chronic secretion of inflammatory cytokines such as TNF-α and IL-1β, which play important roles in osteoclast differentiation, bone resorption by mature osteoclasts, and osteoclast survival [4, 38, 39]. Here, we found that TNF-α mRNA expression and release in supernatant was upregulated after stimulation with Ti particles, and attenuated by resveratrol (Fig. 6a, b). NF-κB is a transcription factor that regulates the expression of various genes, which participate in immune and inflammatory responses, including iNOS and TNF-α [34, 40]. The protective mechanisms of many antioxidants are based on their capacities for NF-κB inactivation, as some studies have reported that ROS generation is the central pathway in NF-κB activation [40]. As shown in Fig. 6c, d, Ti particle-stimulated macrophages showed enhanced NFκB gene expression and phosphorylation, and that resveratrol pretreatment significantly inhibited these effects. Our findings suggest that inhibition of NF-κB activation is consistent with reduced NO, MDA, and ROS levels, and
Resveratrol Protects against Titanium
Fig. 6. Resveratrol inhibited gene expression and release of TNF-α and suppressed NF-κB activation. RAW 264.7 macrophages were cultured in 6-well plates for at least 12 h, followed by pretreatment with or without resveratrol at various concentrations, and Ti particle (0.1 mg/ml) stimulation. RNA was extracted for q-PCR, and supernatants were collected for TNF-α release determination (a–c). Resveratrol attenuated the increased TNF-α and NF-κB gene expression and TNF-α release. Results represent mean ± SD values of three replicates performed in triplicate (d). RAW 264.7 macrophages were cultured in a dish for adherence for at least 12 h; the medium was then replaced with serum-free DEME for 12 h, followed by pretreatment with or without 40 μM resveratrol, and Ti particle (0.1 mg/ml) stimulation. Cells were harvested at 15, 30, and 60 min Ti particle stimulation. Resveratrol decreased NF-κB phosphorylation. Mean ± SD values of three replicates are shown. *P < 0.05 vs. the control group, #P < 0.05 vs. the Ti-only group.
these reductions may occur via downregulation of oxidative enzyme activity and upregulation of antioxidant enzyme activity. Considering that NF-κB is a redox-sensitive transcriptional factor and an important participant in antioxidant enzyme activity [41], we conclude that inhibition of NF-κB activation may be responsible for resveratrol’s protective effect against oxidative stress. In conclusion, the results of the present study demonstrate that wear particles can induce oxidative stress, via dysregulation of oxidative stress-associated enzymes and NF-κB activation, and this process will be involved in periprosthetic osteolysis and aseptic implant loosening. Resveratrol protects Ti particle-activated macrophages from oxidative stress through reduction of NO production, ROS generation, and lipid peroxidation. It also decreases
oxidative enzyme activity and increases antioxidant enzyme activity. This protective effect against oxidative stress also involves downregulation of the gene expression and phosphorylation of NF-κB. Our findings demonstrate that resveratrol may have applications as an antioxidant in Ti particle-induced oxidative stress, and may be a nonsurgical biological treatment option for aseptic implant loosening. However, resveratrol does not completely inhibit NF-κB phosphorylation and TNF-α release caused by stimulation with Ti particles, as well as ROS generation, which suggests that other pathways may be involved in Ti particle-induced oxidative stress. Our further studies in animal models will focus on resveratrol’s protective effects against ROS generated by other pathways.
Luo, Li, Wang, Wang, Zhang, Chen, Zhang, Xiao, Li, Guo, and Sheng ACKNOWLEDGMENTS This work is supported by the grants from the National Natural Science Foundation of China (no. 81171710) and the International Cooperation of Science and Technology of Guangdong Province, China (no. 2013B051000040).
COMPLIANCE WITH ETHICAL STANDARDS Conflict of Interest. The authors declare that they have no competing interests.
REFERENCES 1. Thiele, K., C. Perka, G. Matziolis, H.O. Mayr, M. Sostheim, and R. Hube. 2015. Current failure mechanisms after knee arthroplasty have changed: polyethylene wear is less common in revision surgery. Journal of Bone and Joint Surgery (American) 97: 715–720. 2. Pivec, R., A.J. Johnson, S.C. Mears, and M.A. Mont. 2012. Hip arthroplasty. Lancet 380: 1768–1777. 3. Yang, F., W. Wu, L. Cao, Y. Huang, Z.N. Zhu, T.T. Tang, et al. 2011. Pathways of macrophage apoptosis within the interface membrane in aseptic loosening of prostheses. Biomaterials 32: 9159–9167. 4. Ingham, E., and J. Fisher. 2005. The role of macrophages in osteolysis of total joint replacement. Biomaterials 26: 1271–1286. 5. Pajarinen, J., V.P. Kouri, E. Jamsen, T.F. Li, J. Mandelin, and Y.T. Konttinen. 2013. The response of macrophages to titanium particles is determined by macrophage polarization. Acta Biomaterialia 9: 9229–9240. 6. Pajarinen, J., Y. Tamaki, J.K. Antonios, T.H. Lin, T. Sato, Z.Y. Yao, et al. 2015. Modulation of mouse macrophage polarization in vitro using IL-4 delivery by osmotic pumps. Journal of Biomedical Materials Research. Part A 103: 1339–1345. 7. O’Neill, S.C., J.M. Queally, B.M. Devitt, P.P. Doran, and J.M. O’Byrne. 2013. The role of osteoblasts in peri-prosthetic osteolysis. Bone & Joint Journal 95B: 1022–1026. 8. Kinov, P., A. Tzoncheva, and P. Tivchev. 2010. Evidence linking elevated oxidative stress and aseptic loosening of hip arthroplasty. Comptes rendus de l'Academie Bulgare des Sciences 63: 1231–1238. 9. Brown, G.C. 2001. Regulation of mitochondrial respiration by nitric oxide inhibition of cytochrome c oxidase. BBA Bioenergetics 1504: 46–57. 10. Lambeth, J.D. 2004. Nox enzymes and the biology of reactive oxygen. Nature Reviews Immunology 4: 181–189. 11. Mates, J.M. 2001. Effects of antioxidant enzymes in the molecular control of reactive oxygen species toxicology (vol 153, pg 83, 2000). Toxicology 163: 219–219. 12. Maitra, U., N. Singh, L. Gan, L. Ringwood, and L.W. Li. 2009. IRAK-1 contributes to lipopolysaccharide-induced reactive oxygen species generation in macrophages by inducing NOX-1 transcription and Rac1 activation and suppressing the expression of antioxidative enzymes. Journal of Biological Chemistry 284: 35403–35411.
13. Steinbeck, M.J., L.J. Jablonowski, J. Parvizi, and T.A. Freeman. 2014. The role of oxidative stress in aseptic loosening of total hip arthroplasties. Journal of Arthroplasty 29: 843–849. 14. Suh, K.T., J.W. Chang, and J.S. Jung. 2002. The role of inducible nitric oxide synthase in aseptic loosening after total hip arthroplasty. Journal of Bone and Joint Surgery (British) 84B: 753–757. 15. Kinov, P., A. Leithner, R. Radl, K. Bodo, G.A. Khoschsorur, K. Schauenstein, et al. 2006. Role of free radicals in aseptic loosening of hip arthroplasty. Journal of Orthopaedic Research 24: 55–62. 16. Chen, W.S., Z.Q. Li, Y. Guo, Y.H. Zhou, Z.J. Zhang, Y.C. Zhang, et al. 2015. Wear particles promote reactive oxygen species-mediated inflammation via the nicotinamide adenine dinucleotide phosphate oxidase pathway in macrophages surrounding loosened implants. Cellular Physiology and Biochemistry 35: 1857–1867. 17. Chen, W.S., Z.Q. Li, Y. Guo, Y.H. Zhou, Y.C. Zhang, G.T. Luo, et al. 2015. Wear particles impair antimicrobial activity via suppression of reactive oxygen species generation and ERK1/2 phosphorylation in activated macrophages. Inflammation 38: 1289–1296. 18. Peng, K.T., W.H. Hsu, H.N. Shih, C.W. Hsieh, T.W. Huang, R.W.W. Hsu, et al. 2011. The role of reactive oxygen species scavenging enzymes in the development of septic loosening after total hip replacement. Journal of Bone and Joint Surgery (British) 93B: 1201–1209. 19. Hallab, N.J., and J.J. Jacobs. 2009. Biologic effects of implant debris. Bulletin of the NYU Hospital for Joint Diseases 67: 182–188. 20. Raghunathan, V.K., M. Devey, S. Hawkins, L. Hails, S.A. Davis, S. Mann, et al. 2013. Influence of particle size and reactive oxygen species on cobalt chrome nanoparticle-mediated genotoxicity. Biomaterials 34: 3559–3570. 21. Tsaryk, R., K. Peters, S. Barth, R.E. Unger, D. Scharnweber, and C.J. Kirkpatrick. 2013. The role of oxidative stress in pro-inflammatory activation of human endothelial cells on Ti6Al4V alloy. Biomaterials 34: 8075–8085. 22. Samelko, L., M.S. Caicedo, S.J. Lim, C. Della-Valle, J. Jacobs, and N.J. Hallab. 2013. Cobalt-alloy implant debris induce HIF-1 alpha hypoxia associated responses: a mechanism for metal-specific orthopedic implant failure. PloS One 8(6): e67127. doi:10.1371/ journal.pone.0067127. 23. Pirola, L., and S. Frojdo. 2008. Resveratrol: one molecule, many targets. IUBMB Life 60: 323–332. 24. He, X., G. Andersson, U. Lindgren, and Y. Li. 2010. Resveratrol prevents RANKL-induced osteoclast differentiation of murine osteoclast progenitor RAW 264.7 cells through inhibition of ROS production. Biochemical and Biophysical Research Communications 401: 356–362. 25. Mizutani, K., K. Ikeda, Y. Kawai, and Y. Yamori. 2000. Resveratrol attenuates ovariectomy-induced hypertension and bone loss in strokeprone spontaneously hypertensive rats. Journal of Nutritional Science and Vitaminology 46: 78–83. 26. Takagi, M., S. Santavirta, H. Ida, M. Ishii, I. Takei, S. Niissalo, et al. 2001. High-turnover periprosthetic bone remodeling and immature bone formation around loose cemented total hip joints. Journal of Bone and Mineral Research 16: 79–88. 27. Layoun, A., M. Samba, and M.M. Santos. 2015. Isolation of murine peritoneal macrophages to carry out gene expression analysis upon Toll-like receptors stimulation. Journal of Visualized Experiments (98): e52749. doi:10.3791/52749. 28. Sun, Y., L.W. Oberley, and Y. Li. 1988. A simple method for clinical assay of superoxide dismutase. Clinical Chemistry 34: 497–500. 29. Aebi, H. 1984. Catalase in vitro. Methods in Enzymology 105: 121–126. 30. Ozmen, I., and O.I. Kufrevioglu. 2004. Effects of antiemetic drugs on glucose 6-phosphate dehydrogenase and some antioxidant enzymes. Pharmacological Research 50: 499–504.
Resveratrol Protects against Titanium 31. Schroder, K. 2015. NADPH oxidases in bone homeostasis and osteoporosis. Cellular and Molecular Life Sciences 72: 25–38. 32. Hou, Y.C., A. Janczuk, and P.G. Wang. 1999. Current trends in the development of nitric oxide donors. Current Pharmaceutical Design 5: 417–441. 33. Devasagayam, T.P., J.C. Tilak, K.K. Boloor, K.S. Sane, S.S. Ghaskadbi, and R.D. Lele. 2004. Free radicals and antioxidants in human health: current status and future prospects. Journal of the Association of Physicians of India 52: 794–804. 34. Chung, I.S., J.A. Kim, J.A. Kim, H.S. Choi, J.J. Lee, M. Yang, et al. 2013. Reactive oxygen species by isoflurane mediates inhibition of nuclear factor kappa B activation in lipopolysaccharide-induced acute inflammation of the lung. Anesthesia and Analgesia 116: 327–335. 35. Lambeth, J.D., and A.S. Neish. 2014. Nox enzymes and new thinking on reactive oxygen: a double-edged sword revisited. Annual Review of Pathology Mechanisms 9: 119–145. 36. Deponte, M. 1830. Glutathione catalysis and the reaction mechanisms of glutathione-dependent enzymes. BBA General Subjects 2013: 3217–3266.
37. Ozmen, I., M. Naziroglu, and R. Okutan. 2006. Comparative study of antioxidant enzymes in tissues surrounding implant in rabbits. Cell Biochemistry and Function 24: 275–281. 38. Merkel, K.D., J.M. Erdmann, K.P. McHugh, Y. Abu-Amer, F.P. Ross, and S.L. Teitelbaum. 1999. Tumor necrosis factor-alpha mediates orthopedic implant osteolysis. American Journal of Pathology 154: 203–210. 39. Fuller, K., C. Murphy, B. Kirstein, S.W. Fox, and T.J. Chambers. 2002. TNFa potently activates osteoclasts, through a direct action independent of and strongly synergistic with RANKL. Endocrinology 143: 1108–1118. 40. Rangasamy, T., J. Guo, W.A. Mitzner, J. Roman, A. Singh, A.D. Fryer, et al. 2005. Disruption of Nrf2 enhances susceptibility to severe airway inflammation and asthma in mice. Journal of Experimental Medicine 202: 47–59. 41. Schuliga, M. 2015. NF-kappa B signaling in chronic inflammatory airway disease. Biomolecules 5: 1266–1283.
