The EMBO Journal vol.10 no.2 pp.407-417, 1991

Retrotransposon-induced overexpression of a homeobox gene causes defects in eye morphogenesis in Drosophila

Soichi Tanda and Victor G.Corces Department of Biology, The Johns Hopkins University, Baltimore, MD 21218, USA Communicated by D.J.Finnegan

Insertion of the tom transposable element into various Drosophila ananassae genes results in dominant phenotypes that affect eye morphology. One of these genes encoded by the Om(JD) locus was isolated by transposon tagging. The Om(JD) gene encodes a 2.7 kb transcript that is expressed in every stage of development. The deduced Om(JD) protein is 606 amino acids long and contains two glutamine/histidine, two alanine-rich and one histidine/proline repeats, as well as a homeodomain located near the carboxy terminus. Tom-induced alleles of Om(JD) show a 1.7-fold increased accumulation of Om(lD) RNA in whole individuals during late larval- early pupal stages of development, whereas expression of this transcript is 7-fold higher in the eye-antenna imaginal disc of mutant versus wild-type flies. D.melanogaster flies transformed with the Om(JD) coding region under the control of the hsp70 promoter display an eye phenotype similar to that of Om(JD) when expression of the homeobox protein encoded by the chimeric gene is induced by temperature elevation at the end of the third instar period. These results suggest that the eye-specific mutant phenotype caused by the insertion of the tom retrotransposon in the Om(JD) locus may be a consequence of the tissue-specific induction of the expression of this gene by sequences present in the transposable element. Key words: Drosophilaleye development/homeobox/retrotransposon

Introduction The Om hypermutability system of Drosophila ananassae gives rise to spontaneous mutations that affect almost exclusively eye morphogenesis (Hinton, 1984). These semidominant and non-pleiotropic Om mutants arise exclusively in oocytes and they map to at least 25 different euchromatic loci (Hinton, 1984, 1988). Om alleles have been shown to be associated with the insertion of the tom retrotransposon at or in close proximity to the cytogenetic location of the mutation (Shrimpton et al., 1986; Tanda et al., 1989). Thus, the high specificity in the type of mutant phenotypes induced by the tom element constitutes an interesting paradigm to study the mechanisms of transposable element-induced mutagenesis. Two simple mechanisms can be put forward to account for the almost exclusive effect on eye morphogenesis that results from the insertion of the tom retrotransposon. One possibility is that the location of de novo ( Oxford University Press

insertions of the tom element is highly selective, such that this transposon only moves into regulatory regions that control the expression of a family of genes involved in eye development. This seems highly unlikely given the finding that the tom element inserts into the simple sequence TATAT (Tanda et al., 1988) which should be present in many sites in the genome, and that many tom elements are found silent in Om mutant stocks (Shrimpton et al., 1986; S.Tanda, unpublished). A second alternative is that the tom element inserts more or less randomly and the specificity in its mutagenic action could be determined by selective effects of sequences present in the element on adjacent genes. For example, transcriptional regulatory sequences, such as tissuespecific transcriptional enhancers, present in tom could increase the expression of genes located nearby in certain tissues such as the eye imaginal discs, thus accounting for both the dominant characteristics and the specificity of the phenotype. The remarkable specificity of the Om hypermutability system has allowed the identification of -25 different genes. Tom-induced mutations in these genes show various degrees of eye morphogenetic defects (Hinton, 1984; Tanda et al., 1989), suggesting that they may be involved in different steps of the cascade of events leading to the differentiation of the eye. In addition, genetic interactions between various tominduced mutations result in enhancement or suppression of the mutant phenotypes (Hinton, 1988; Tanda et al., 1989), suggesting that these interactions may take place at the protein level and therefore Om mutations may affect individual members of a morphogenetic pathway. The study of these genes might then provide a direct and logical approach to identify factors that control eye development. Especially interesting for this purpose among the collection of tom-induced mutations is the Om(JD) locus, located in the X chromosome between forked and Beadex in D.ananassae. The cytogenetic location of Om(JD) is analogous to that of the Bar locus in D. melanogaster (Lindsley and Zimm, 1985); in addition, both mutations show similar dominant eye phenotypes, and revertants of dominant alleles of Om(ID) and the Bar allele BarMl show the characteristic podfoot phenotype (Schalet, 1969; Tanda et al., 1989), suggesting that Om(ID) might be the equivalent of Bar in D. ananassae. Mutations at Om(ID) are reversed by tom-induced alleles at the unlinked locus Om(lK)Su, which do not show a mutant phenotype but act as dominant suppressors of the Om (ID) phenotype, i.e. Om(JK)Su/Om(JD) flies have wild-type eyes. Recessive mutations at Om(JK)Su show a furrowed eye phenotype (Hinton, 1988), similar to that of the D.melanogaster furrowed gene (Lindsley and Zimm, 1985), suggesting a possible involvement of this gene in eye development. The exclusive recessive eye phenotype of Om(JK)Su and its interaction with Om(JD) lends additional support to the possibility of involvement of the later gene in eye morphogenesis. 407

S.Tanda and V.G.Corces

tom element in every Om(JD) allele examined [Figure 1; see Tanda et al. (1989) for a description of the location of the tom element in other Om(]D) alleles]. In addition, the recessive allele Om(ID)9R64 is associated with a euchromatic inversion with a breakpoint located immediately adjacent to the 3' end of the 2.7 kb transcript (Figure 1; see below for additional information). Further evidence suggesting that Om(JD) encodes the 2.7 kb transcript is supported by the finding that the accumulation of this RNA is affected by both dominant and recessive mutations at the Om(JD) locus. For example, the recessive mutant Om(JD)73RI was obtained by reversion of the dominant Om(JD) phenotype; this revertant is embryonic lethal as homozygous, although some escapers live to the pharate adult stage and they, as well as heterozygous flies, have normal eyes (Tanda et al., 1989). These homozygous escapers fail to accumulate detectable levels of the 2.7 kb transcript (Figure 2b), supporting the contention that this RNA corresponds to Om(JD). Levels of this transcript are also affected by tom-induced Om alleles. The semidominant phenotype of these alleles suggests that the neomorphic function may be the result of the synthesis of an altered protein or aberrant expression of the normal RNA. The latter possibility is more likely in view of the finding that Om(JD) alleles contain tom insertions outside of the coding region of the gene (see below), suggesting that the mutant phenotype may be due to ectopic or high levels of expression of the Om(JD) RNA. In agreement with this hypothesis, Om(JD) alleles accumulate higher than normal levels of the 2.7 kb transcript. Figure 3 shows a Northern analysis of poly(A)+ RNA obtained from late larvae -early pupae of the parental ca; px stock, the Om(JD)5b allele, and the Om(JD)9R25 partial revertant. We compared the amounts of this 2.7 kb transcript in wild-type, mutant and revertant flies at the middle and late third instars, and early pupae, the time of development during which the morphogenetic furrow passes across eye imaginal discs (Figure 3). Since ras2 is expressed

The Om(ID) locus has been cloned by transposon tagging and the location of the gene has been mapped to an 18 kb interval by analysis of spontaneous and -y-ray induced revertants (Tanda et al., 1989). Here we present evidence indicating that the Om(JD) gene encodes a homeobox protein, and suggesting that the dominant tom-induced phenotype may arise as a consequence of the overexpression of this protein in the eye-antenna imaginal disc under the influence of specific sequences present in the tom element.

Results The OmrlD) locus encodes a 2.7 kb transcript that is more abundant in mutant than wild-type flies

The approximate location of the Om(JD) coding region has been defined by genomic Southern analysis of tom-induced Om(ID) mutants and revertants associated with chromosomal rearrangements (Tanda et al., 1989). The Om(JD) coding region was mapped to an 18 kb DNA segment contained between the distal breakpoint in the revertant Om(JD)73RI and the tom insertion site in Om(JD)9 (Figure 1). To determine more precisely the location of the Om(JD) transcription unit, we carried out Northern analysis of poly(A)+ RNA obtained from various stages of development, using as hybridization probes several DNA fragments contained within the 18 kb region. Several transcripts were found to be homologous to sequences in this area, although due to the repetitive nature of some of these sequences, the origin and precise location of all these transcripts was not determined in detail. One of these RNAs, a 2.7 kb transcript, is expressed in every developmental stage of D. ananassae, albeit accumulation levels are higher in embryos, pupae and adults, and lower in larvae (Figure 2a). This RNA was assigned to the Om(JD) gene based on several criteria. This transcript is located immediately adjacent to the insertion sites of the

..,/

, '//"7,b 'V"

-000

f )

I."

,i

I

do

..

:

)

P.)'.

:::

mI //// JI"

~ I

.1

i

":'

/

---

il

(

-1

I

I

I1/'I 1-

Ij

.

Ili

I-i

i11

IFmull!.JjE :11:ft! i [M! a ftlitl"I" TITF,,t . diIJIT&im T

liIIftdI I.,

Centromer-e 5

I

.1

*I i i'I I

I 11

I1I LLI.LTelomnere -

I1 1111I IiI 11 Ii I

1

L

k-b .

i

Fig. 1. Structure of the Om(JD) locus. The restriction map of the Om locus in the parental stock ca; px is depicted (Tanda et al., 1989). The insertion site of the tom retrotransposon in the Om(JD)9 allele is indicated; arrows inside the triangle show the direction of transcription of this element. The Om(JD)73 mutation from which the Om(JD)73R1 revertant was derived has one tom element inserted at the same site and in the same orientation as Om(JD)9. Brackets labeled with Om(JD)73R1 and Om(JD)9R64 indicate the respective segments which contain the 13A distal breakpoints of these revertants [both revertants are caused by inversions with a breakpoint in the 13A region (Tanda et al., 1989)]. The arrow labeled with Om(JD)9R98 shows the region deleted in this revertant. The thick hatched line on the restriction map shows the region proposed to contain the Om(JD) coding sequences in previous studies (Tanda et al., 1989). Thin lines below the map indicate DNA segments hybridizing to the Om(JD) transcript. The thin line labeled with an asterisk indicates the fragment used for Northern blot analysis.

408

Om(lD) encodes a homeobox protein

I~~~~~~~~~~~~~

[

*tt"-~~ ~ :!.

|

'Amm

.

!t_

,.

Fig. 2. Northern analysis of Om(JD) transcription. (a) Developmental Northern of RNA from the ca; px strain probed with the EcoRI-PstI fragment marked in Figure 1 with an asterisk. Embryos were collected every 24 h, allowed to develop at 22.5°C, and collected at various stages of development. The same blot was subsequently hybridized with the D.melanogaster yellow and ras2 genes as controls (Mozer et al., 1985; Geyer et al., 1986). Arrowheads labeled as Om(JD), yellow and ras2 indicate the 2.7 kb Om(JD), 2.0 kb yellow and 1.7 kb ras2 transcripts respectively. Marker sizes (RNA Ladder, BRL) are shown in kb on the left-hand margin. (b) Northern blot showing absence of the 2.7 kb transcript in Om(ID)73RI, a complete revertant of Om(JD)73. Lanes contain 7 ug of poly(A)+ RNA from adults of Om(JD)73R1 and m2 v2 j48 g3 (a wild-type strain with respect to Om mutations) respectively. An arrowhead labeled as Om(lD) indicates the position of the 2.7 kb transcript. Hybridization of the same filter with a ras2 probe shows that equal amounts of RNA were loaded in each lane (data not shown).

at approximately constant levels throughout development (Mozer et al., 1985), we used the amount of this transcript as a standard for Northern analysis. The amounts of 2.7 kb and ras2 transcripts in the Northern blots shown in Figure 3 were determined densitometrically and the ratios of the 2.7 kb versus ras2 transcripts were calculated and compared (Figure 3). In middle third instar there are no substantial

..

11

"

--

differences among the three strains examined, whereas mutant flies have 1.7-fold as much transcript as wild-type flies in late third instar and early pupae; the partial revertant strain contains as much 2.7 kb transcript as the mutant in late third instar, but the levels of this RNA become wildtype in early pupae. These differences are quite small and their significance is unclear. This experiment was carried out twice with approximately the same results. Expression of the Om(1D) transcript in the eye -antenna imaginal disc is affected by tominduced mutations A < 2-fold increase in the expression of the 2.7 kb transcript in Om (ID) alleles may not be enough to account for the phenotype observed in these mutations. Nevertheless, the increase observed in the Northern analysis shown in Figure 3 was measured in whole animals, whereas the mutant phenotype in these alleles affects only eye morphogenesis. Since differentiation of eye cells takes place in the eye-antenna imaginal discs, we decided to examine the morphology of these tissues in mutant and wild-type flies during larval development. Figure 4 shows a photograph of an eye -antenna imaginal disc from the parental ca; px and the Om(JD)Sb strains from late third instar larvae. It is apparent that whereas the part of the disc that gives rise to the adult antenna is equal in size in both discs, the portion that forms the eye in the Om(JD)Sb disc is approximately

rn4UP..

Fig. 3. Expression of the Om(JD) transcript in wild-type and mutant flies during eye morphogenesis. Lanes labeled with ca; px, Om(JD)5b and Om(JD)9P,5 contain 7 Ag of poly(A)' RNA purified from the parental stock ca; px, Om(JD)5b and a spontaneous partial revertant of Om(JD)9, Om(JD)9R25 respectively. Expression of the 2.7 kb transcript during middle and late third instars, and early pupae, were compared. Drosophila ras2 expression was used to estimate the amount of poly(A)+ RNA loaded in each lane. Upper and lower panels show blots probed with Om(JD) and ras2 respectively. Fragments used for hybridization of this blot are the same as those used in Figure 2. The autoradiograms were scanned and quantitated; numbers at the bottom show the ratio of the 2.7 kb versus ras2

products.

409

S.Tanda and V.G.Corces

1,

p,

......

....

Fig. 4. Morphology of eye-antenna imaginal disc. Pictures show light microscope photographs of eye-antenna type parental strain (A), and the Om(JD)5b mutant allele (B).

half of the wild-type size. This effect is due to cell death in the mutant imaginal disc as judged from staining with Trypan blue (data not shown). The specific effect of tom insertion in the Om(JD) gene on the viability of eye imaginal disc cells suggests a possible underlying restricted effect on the expression of this gene. We then reasoned that if the effect of tom element on Om(JD) gene expression is tissue-specific, the difference in the amount of the Om(JD) transcript between wild-type and mutant flies may be more dramatic in the eye -antenna imaginal discs where eye morphogenesis takes place. In order to estimate the amount of this 2.7 kb transcript in eye-antenna imaginal discs, first-strand cDNAs were reverse transcribed from total RNA obtained from this tissue, then amplified by PCR (Figure 5a). The values obtained (Figure Sb) were standardized relative to the amount of rRNA present in the sample (Figure 5c). These standardized values indicate that mutant Om(JD)Sb flies have seven times as much 2.7 kb transcript as the wild-type, supporting the hypothesis that this 2.7 kb transcript is the Om(JD) gene product. These results also suggest that the Om(JD) gene is expressed more abundantly in eye -antenna imaginal discs than in other tissues, and therefore the tom element may preferentially activate the Om(ID) gene in eye -antenna imaginal discs. The structure of the Om(1D) transcription unit Northern analysis of the 2.7 kb RNA using various small DNA fragments as hybridization probes revealed two singlecopy genomic fragments located 5 kb apart that are able to hybridize to the Om(JD) transcript, suggesting that the Om(JD) gene spans > 5 kb in length in the region separated by these two fragments (Figure 1). To begin a study of the structure of the Om(ID) transcription unit, we attempted the isolation of cDNA clones using the fragments mentioned above as hybridization probes and cDNA libraries constructed with poly(A)+ RNA from different stages of development of D.ananassae. These efforts failed, as well as numerous attempts to detect Om(JD)-homologous cDNAs in D.melanogaster libraries constructed by others, in spite of the close sequence similarity between the homologous genes in both species (data not shown). The lack of repre-

410

imaginal discs from the

ca; px wild-

sentation of Om(ID) cDNAs in various libraries may be due, in retrospect, to a 73 % GC-rich stretch located in the 3' protein-coding region of the RNA that may preclude firststrand synthesis by reverse transcriptase under normal conditions. To avoid this problem, the region of genomic DNA that hybridizes to the 2.7 kb transcript was sequenced and the putative protein coding regions were determined in all reading frames (Figure 6). DNA primers corresponding to putative protein-encoding regions were constructed and used for first-strand synthesis with reverse transcriptase (see Materials and methods for details of the strategies employed), using 7-deaza-2'-deoxy-GTP to minimize problems derived from RNA secondary structure; single-stranded DNA was then amplified by PCR, also in the presence of 7-deaza2'-deoxy-GTP. The double-stranded DNA was then cloned and sequenced, and the information compared to that obtained from the analysis of genomic DNA. This type of approach allowed the determination of the structure of the 5' and 3' transcribed untranslated regions, although the initiation and termination sites of the RNA could not be identified. In addition, the protein-coding region of the Om(ID) gene was found to be separated by two introns into three different exons (Figure 6). Splicing donor and acceptor site sequences show good match to the consensus (Mount, 1982; see below). The 5' end of the Om(ID) transcript was then determined by primer extension (Figure 7). The Om(JD) transcript begins at the second T in the heptanucleotide sequence ATCTGTG (Figure 8). This sequence shows a considerable degree of homology (five matches of seven) to the Drosophila consensus initiation site (ATCAG/TTC/T) for RNAs transcribed by RNA polymerase II (Hultmark et al., 1986). The 3' end of the Om(ID) transcript was not present in the cDNAs obtained by PCR and was not determined experimentally. Nevertheless, the size predicted assuming that termination takes place at one of the clustered polyadenylation sites present at the 3' end of the coding region (Figure 8) is in good agreement with the 2.7 kb size of the transcript observed experimentally, suggesting that transcription termination takes place in this region. This size for the Om(ID)-encoded transcript was confirmed in Northern blots of poly(A)+ RNA obtained from flies transformed with an hsp70-Om(JD) hybrid gene (see below).

Om( lD) encodes a homeobox protein

a

Fig. 5. cDNA amplification of the Om(JD) gene from eye-antenna imaginal discs. (a) Competitive PCR of the Om(lD) transcript. This panel shows the EtBr staining of an agarose gel containing PCR products of the first strand cDNA from eye-antenna imaginal discs. The left side of the panel shows the products of RNA from the ca; px strain, and the right side shows those from Om(ID)Sb. For each panel, four reactions contained, from left to right, 5, 50, 500 and 5000 fg of genomic DNA respectively. Size markers (1 kb ladder, BRL) are shown in the lane labeled M. Arrows labeled as genomic and cDNA indicate the fragments corresponding to the PCR amplified products of 423 bp genomic and 303 bp cDNA sequences. Each band was cut from the gel and the amount of radioactivity (32p) was determined in a scintillation counter. (b) Estimation of the amount of Om(JD) transcript. The ratios of genomic DNA versus cDNA were plotted against the amounts of genomic DNA added to the PCR reactions that were actually amplified. Three points which gave the best correlation were plotted. Lines labeled with ca; px and Om(ID)Sb indicate the regression lines calculated from the count readings of the ca; px and Om(JD)5b samples respectively. A ratio of 1.0 gives the estimate of the amount of the Om(JD) transcript. Numbers below the X-axis are the estimates of the amount of the Om(JD) transcript in the ca; px and Omn(JD)Sb strains. (c) Northern blot of total RNA probed with an rRNA gene. Each lane contains 1 yI volume of the lysed sample of eye-antenna imaginal discs. Samples were electrophoresed on a formaldehyde-agarose gel and subjected to Northern analysis using a plasmid containing a Xenopus 18S rRNA gene as hybridization probe. Lanes contain total RNA from the ca; px, Om(JD)5b, Oregon R and Bar strains. Numbers below indicate the amount of total RNA present in each sample; levels in mutant strains are expressed relative to their respective wild-type samples, which were assigned an arbitrary value of 1.0.

The Om(1D) gene encodes a homeobox protein DNA sequence analysis of genomic and cDNA clones, together with the primer extension data presented above,

reveals that the Omn(ID) transcript has a 103 bp 5' transcribed untranslated region. Typical TATA and CAAT boxes were not found in the region immediately upstream of the transcription start site. However, there are several GAGA repeats, suggesting that the Om(JD) gene may use GAGA repeats instead of the TATA box as promoter sequences (Figure 8). This type of repeat has also been found in the promoter region of some homeobox genes such as Antennapedia (Perkins et al., 1988), engrailed (Soeller et al., 1988) and Ultrabithorax (Biggin and Tjian, 1988). Conceptual translation of the RNA sequence suggests that the Om(JD) gene encodes a 606 amino acid long protein, with a predicted mol. wt of 61 737 daltons, which is rich in Ala (17%), Gly (11%), Ser (10%) and Pro (10%). The amino acid sequence displayed in Figure 8 assumes that translation of the protein starts at the first ATG that would give rise to a protein extending the length of the RNA. Sequences surrounding the second in frame ATG display a better match than the first one to the consensus for translation start sequences ANNC/AAA/CA/CATGNNN found for Drosophila genes (Cavener, 1987). A third ATG initiation codon located at +314 bp, 72 amino acid residues further downstream, shows a perfect match to this consensus and if used would give rise to a protein with a predicted mol. wt of 53 716 daltons; nevertheless, antibodies against the carboxy terminus of the Om(ID) protein recognize a 66 000 dalton protein in Western blots (S.Tanda, unpublished), suggesting that one of the first two ATG initiation codons is used in vivo. The Om(JD) product has two opa repeats located in the amino-terminal region consisting of Gln and Gln/His stretches. These polyGIn repeats are hydrophilic and could give rise to random coil regions that may play a role in protein stabilization. Ala stretches were also found after the Gln-rich region as well as in the carboxy-terminal domain. In addition, the Om(ID) protein contains a His-Pro repeat that extends for 28 amino acid residues and is homologous to the PRD repeat found in the paired gene product (Frigerio et al., 1986). The functional significance of this domain as well as the polyAla repeats is not known at the moment. The most important characteristic of the Om(JD) protein, which sheds light on its possible function, is the presence of a homeodomain that is split by the second intron near the carboxy terminus (Figure 8). The sequence of the Om(JD) homeodomain is 42-48% identical with respect to similar domains found in Drosophila homeotic genes. In particular, Om(JD) can be assigned to the Antennapedia family of homeobox proteins on the basis of a Gln residue present in the ninth position of helix 3 (Figure 9). This residue seems to determine binding specificity, and therefore Om(JD) might bind to the same type 1 (TAA), and type 2 TCAATTAAAT target sequences recognized by the gene products of other members such as even-skipped, Deformed, rough, labial and zerknullt (Figure 9) (Beachy et al., 1988; Desplan et al., 1988; Hoey and Levine, 1988; Treisman et al., 1989; Hanes and Brent, 1990).

Overproduction of the Om(1D) protein driven by the hsp7O promoter results in eye phenotypes To verify that the structure of the Om(JD) gene drawn by pasting partial cDNAs is correct, and to confirm that the 2.7 kb RNA corresponds to the Om(JD) locus, we tested

411

S.Tanda and V.G.Corces

:

r

- .

"I ii

:..-

Fig. 6. Mapping of the Om(JD) transcription unit. The top of the figure shows coordinates in kb with 0 as the transcription initiation site. The DNA segment that has been sequenced is shown in the middle. Small shaded circles indicate the locations of the polyadenylation signals. Open arrowheads indicate the locations of primers used to clone the Om(JD) cDNA; numbers correspond to the last one or two digits in the names of the primers described in Materials and methods. Open rectangles below indicate the possible coding region of each open reading frame present in the Om(JD) genomic sequence as determined by the method of Fickett (1982). The structure of the Om(JD) gene is shown in the lower part of the figure below the rectangles. The numbers in the shaded rectangles indicate which open reading frames are used by the Om(JD) gene. Brackets labeled with A, H, 0 and P show the locations of alanine-rich region, homeodomain, glutamine and/or histidine, and PRD repeats respectively. The long arrow at the bottom shows the DNA segment which was used to construct an hsp7O promoter-Om(JD) coding region chimeric gene.

whether overexpression of the coding region for this transcript could induce phenotypes similar to those observed in Om(JD) alleles. To this end, we constructed a chimeric gene containing the D. melanogaster hsp70 promoter linked to a 5. 1 kb AccI -HindIll genomic fragment containing the protein coding region of the Om(JD) gene (Figure 6). This hybrid gene was cloned into the CaSpeR P element transformation vector and injected into preblastoderm embryos of the D.melanogaster w1118 stock. One transformed w+ line was obtained that contained this construct inserted in the second chromosome and showed no phenotypic abnormalities when raised at 22.5 °C. A heat-shock treatment of 37°C for 2 h at different times during development did not affect the viability or fertility of the transformed strain, but gave rise to Om(JD)-like phenotypes in animals heatshocked during the time of eye morphogenesis (Figure 10). The mutant phenotype was almost undetectable in adult flies that had been heat-shocked during the second instar period (Figure IOA), and was more pronounced in flies heatshocked in the middle of the third instar (Figure lOB and C). The most extreme phenotype was obtained when the transformed flies were subjected to temperature elevation during the late third instar (Figure IOD), and the severity decreased again when heat-shock was performed in prepupae (Figure 1OE). The earliest period at which heat-shock results in eye morphology defects is middle third instar, and flies treated at this point show a rough eye phenotype except for a few normal ommatidia at the posterior end (Figure lOB); in addition, eyes from these flies only have 12 rows of ommatidia, suggesting that cell death in the eye imaginal disc during morphogenesis is responsible for the resulting adult phenotype. A few hours later, flies had more normal ommatidia at the posterior end but show a dorsal -ventral groove running across the surface (Figure 10C); the area located anterior to this groove shows a rough eye surface and again approximately half of the ommatidial rows are missing. Animals heat-shocked 8-10 h after this period show an eye phenotype very similar to that of Om(JD) mutations, with only nine ommatidia rows present and -

412

\

Fig. 7. Determination of the 5' end of the Om(ID) gene by primer extension. The lane on the left contains the extended product from a 32P-end-labeled lDdl 1 primer. The four lanes labeled A, C, G and T show the dideoxy sequence reactions of the plDEl9 plasmid primed with the 1Ddll primer. Nucleotide sequence shown on the right-hand margin is the sequence of the 5' end of plDEl9, an EcoRI subclone in pUC18. The extended product corresponds to the position of the sixth nucleotide from the end of plDE19, which is indicated by an arrow.

missing all the ommatidia located more anteriorly than the position of the morphogenetic furrow at the time of heatshock (Figure IOD). Flies heat-shocked later than this period had more normal ommatidia, since the morphogenetic furrow had passed through the eye imaginal disc at the time of heatshock. The extra bristles seen at the vertical groove (Figure IOC) suggest that cell death probably occurred along

Om(1D) encodes a homeobox protein

the morphogenetic furrow in the eye imaginal discs when the animals were heat-shocked, and therefore overexpression of the Om(ID) gene may induce cell death in the eye discs. It is interesting to point out that a heat-shock of only 2 h during the late third instar prevents the formation of the anterior region of the compound eye, suggesting that cell death may continue until the morphogenetic furrow has passed through the disc. Tissues other than the eye imaginal discs were not affected by heat pulse treatments during various developmental stages except for the tarsal segments in adult flies. Only a few among several hundred heat-shocked transformants examined had one or two tarsal segments instead of five, suggesting that the leg discs might be sensitive to high levels of Om(ID) protein during a narrow developmental window.

Om(1D) gene of D.ananassae may be homologous to the Bar gene of D.melanogaster Numerous analogies exist between the D. ananassae Om (ID) and the D. melanogaster Bar (B) loci. Both of them map to a similar location in the X chromosome, betweenforked and Beadex (Hinton, 1984; Lindsley and Zimm, 1985). The

Dominant alleles of both genes show similar eye phenotypes (Figure 10), and chromosomal breakpoints in both loci show the characteristic podfoot (pdj) phenotype (Welshons, 1960; Schalet, 1969; Tanda et al., 1989). Moreover, Om(ID) and Bar revertants associated with deficiencies or rearrangements that include both genes fail to complement pdf, e.g. transheterozygotes of Om(ID) 73RI over Om(JD)9R98 as well as transheterozygotes of BMJ over B263-20, show a pdf phenotype. Finally, closely linked dominant enhancer mutations have been described for both genes (Bonnier and Nordenskiold, 1942; Tanda et al., 1989). The possibility that Om (ID) corresponds to the Bar gene of D. melanogaster was tested by in situ hybridization of Om(JD) sequences contained in clone XOm(1D)ca;px-5 (Tanda et al., 1989) to polytene chromosomes of several Bar mutants. The four alleles tested, Bl (Lindsley and Zimm, 1985), B2, BMR2, BMR3 (T.Gerasimova, personal communication) are caused by small, cytologically visible duplications. In all four cases, the region of hybridization of Om(JD) sequences was located within the duplicated region (data not shown), suggesting an additional correlation between the Om(ID) and Bar genes. To test more directly the possibility that Om(JD) and Bar correspond to the same gene, we isolated Om(JD)homologous sequences from D. melanogaster and measured the amount of RNA encoded by this DNA in eye -antenna imaginal discs of wild-type Oregon R and the B' allele. The determination of RNA levels was carried out by reverse transcription followed by PCR using appropriate primers (see Materials and methods). The amount of transcript was then standardized relative to the levels of ribosomal RNA present in the sample to account for the different size of the eye imaginal discs in both strains (Figure Sc). The result of this experiment indicates that Bar mutants contain 13-fold more Om(JD)-homologous RNA than the wild-type Oregon R strain, supporting the hypothesis that Bar may be the D.melanogaster homolog of Om(JD).

Discussion Insertion of transposable elements into a gene or in relatively close proximity may cause a mutant phenotype by a variety of mechanisms, ranging from the disruption of sequences

of the gene involved in various aspects of transcriptional control to effects on gene expression due to sequences present in the transposable element. The dramatic specificity in the nature of mutant phenotypes induced by insertion of the tom retrotransposon has no previous parallel and suggests a precise and distinct mechanism underlying its mutagenic effect. This specificity may arise as a consequence of a selectivity in the choice of insertion sites by the tom element or may be due to the idiosyncratic properties of this transposon that determine the effects on adjacent genes. The first possibility seems unlikely due to the lack of specificity in the insertion sites used by transposable elements described to date. In the case of retrotransposons, insertion sites are usually composed of alternating purines and pyrimidines that can be found in numerous places in the genome. This is also the case for the tom element, although its target preference is more specific than for other retrotransposons since recessive mutations are rarely seen in the Om mutability system. In addition, the tom element is present in many silent sites in the genome where insertion does not result in a mutant phenotype (Shrimpton, 1986; S.Tanda, unpublished), suggesting that this element does not preferentially move into sequences involved in the control of the expression of genes affecting eye morphogenesis. Therefore, it is more likely that the dominant gain-of-function phenotype induced by the insertion of tom is a consequence of specific sequences of this element that affect the expression of the adjacent gene. This hypothesis is supported by information obtained from the isolation and functional analysis of the Om(JD) locus. Insertion of the tom element in the 3' region of the Om(JD) gene results in a very slight increase in the amount of Om(ID) transcript during third instar larvae in whole animals from strains carrying tom-induced alleles, but this effect is 7-fold larger in the eye -antenna imaginal discs. This dramatic specific increase in the accumulation of Om(JD) transcript suggests that the effect of the tom element on adjacent gene expression might be limited to individual tissues and particular times of development. This specificity could be accomplished, for example, if the tom element contains tissue-specific transcriptional enhancers that could act on neighboring genes to increase their transcription rate in a spatially discrete manner. Analysis of Om(JD) RNA levels seem to confirm this hypothesis, since accumulation of this transcript is 7-fold higher in the eye imaginal disc of tom-induced alleles than in wild type, whereas whole animals do not show a significant increase in the amount of Om(JD) transcript during the third instar period. The effect of induction of Om(JD) expression using a heterologous heat-shock promoter lends further support to this hypothesis, since high levels of Om(JD) transcription result in an eye phenotype similar to that observed in tominduced alleles. In the case of temperature-induced overexpression, synthesis of the Om(ID) protein presumably occurs in every tissue and developmental stage; nevertheless, the epigenetic effect of increased Om(JD) synthesis is only observed in the eye, indicating that high levels of Om(JD) protein in other tissues have no deleterious effects for the fly. The nature and specificity of the mechanism of tominduced mutagenesis raises the question as to the putative involvement in eye morphogenesis of genes affected by the tom element. Dominant phenotypes caused by tom insertion resemble the Bar phenotype in D. melanogaster, suggesting that cell death in the eye imaginal discs of the larvae may be responsible for the adult defect (Fristrom, 1969, 1972). 413

S.Tanda and V.G.Corces

catttgatgctccgccagaggactctaattattttaatgcgttccgcaattgaagcgcgcgcttgagtccttcctccttactcctgcccctgccccttccccstgctcctgctcctaccc ctgctcctgctgctctaattttctagccactaatgaccttcgcaggtcacctgacctttccagcctggtgttcttcgttccgggctgtctttcaac cggaatcaatatcaatcaaacgg

-1475 - 1351

aaaccgccgctctcgacaaattgcatttgtttctcatctcgctccgcttctgtttcccttcagagtccttcctgcaattagtcctttttttttttgggagaacaggcggcctctgaagg

- 1232

cactaacctggctggGGGAGAGcggcaaagtcaccaccaagtggcctgtaacaaagtggcagaaatgttgccgttctgccggcgtcgacgcagagcagcagagcagcagccacagcggca agcgacgtcggcaggtgcgtttccagccgccCGGiAACcgctcaGTCTCGTtttggcagccaagccgctcacgacgtcgctggCGGAGAAccccccccaattaccaagtagagtgtgaa

- 161

aagctGGGAGAGtcttagggagtgtgccaatatccgaaatctstsaagaattcctcgaagtttattttttttgtgaagtgtctctgagagaagaaagactcgggaagaaagagtatcat EcoR

+78

tactaggtctgggaggcccagaagcagagctattggcgtgaaattttaattgccagctagttgtctggagagaggaggtggagggagttactatgtaggagtatctaggactatctgag -11 13 tcctgtaaacctcaaaaacagccatctcattgagtttaaagacaagttatattgttcatttaacacttcccttataatttttaaataaaaactcgaaaataaatctcaaaaaaacttcc -994 tctttgccagaaaataggaatagctagtgttacaggactattaaggagtatctaggacgatctagattatcgaaaacctcaaaaacagccatctcattgagtttaaagacaactactat -- 875 756 tgtttaataaacactttccttcaaatttcttgctaaaaactcaaaaatatatcgcaaaaacatatctctttgccggaaaatcagaatagatactattacaggactatcaaggactaact +1~~~~~~~~~~~~~~~~~~~~~~17 aagactatctaggtcctgaaaaacagccatatctttgagattaaaagacaaatcttattgtttaaataacactttccttcaaatttcttaacaaaaactcaaaaataaatctcaaaaag -637 acttcctccctcccataaaaccagaaacctcttctcaaaaaacccccaagatctcaattatggagcctcttggatactacgcccaccacccccccgacacagcgccattttggggcaca - 518 tataaaaagtggcgCGGAGAGccccggaggcgagCTCTCGTcgtg - 399 gactggccgaaattacggccatttgaccgacatttgccgcacatctgccgctctctgccgcctgccgcctctgs gc tgct c taa - 280 tgCCGAGAGgCCGAGAGGGAGAGGccacaggGCGAGAGtagagtggt tagagcagtccggc gt gag ttggcggcaat ggcggcgc tggacgcgagcgggaggcaagacc - 42

-

GAC TCG ATG AGC ATT CTA ACC CAA ACG CCC AGC GAA ACG CCC GCG GCC CAC AGC CAG CTG CAC CAC +174 MET Lys Asp Ser MET Ser lie Leu Thr Gin Thr Pro Ser Glu Thr Pro Ala Ala His Ser Gtn Leu His His 24

ttgtggagtgcttgtagactggctATG AAA Accl

CAT CTC AGT CAC CAC CAC CAT CCG GCG CTG CAC CAC CAC CCG GTC CTG CAG CAC CAC TAC AGC CTG CAG CAG CAG CAT CAG CAG CAG CAA +264 His Leu Ser His His His His Pro Ala Leu His His His Pro Val Leu Gtn His His Tyr Ser Leu Gtn Gin Gln His Gin Gin Gtn Gln 54 0 CAG CAG CAG CCA CCA GCA CCA CCG GCG GTA GCC ACA ACC ACG GTG GTC AAC ATG TCC GGC AGC ACC ACC ACG GCG GCT AAT CTG AAG CCC +354 Gln Gln Gtn Pro Pro Ala Pro Pro Ala Vat Ala Thr Thr Thr Vat Val Asn Met Ser Gly Ser Thr Thr Thr ALa Ala Asn Leu Lys Pro 84 AAC CGC TCC CGC TTC ATG ATC AAC GAC ATC CTG GCG GGC AGT GCC GCG GCC GCC TTT TAC AAG Asn Arg Ser Arg Phe Met lie Asn Asp lle Leu Ala Gly Ser Ala Ala Ala Ala Phe Tyr Lys

CAA CAG CAG CAG CAC CAC CAC CAC CAC +444 Gin Gin Gin Gin His His His His His 114

0 CAC CAG AGC CAC CAC AAC AAC AAC AAT CAC TCT GGT GGC TCG AGT GGC GGC ACG AGC CCC ACC CAC CAC AAC AAC AAC AAC GGC GAG GGA +534 His Gln Ser His His Asn Asn Asn Asn His Ser Gly Gly Ser Ser Gly Gly Thr Ser Pro Thr His His Asn Asn Asn Asn Gly Glu Gly 144 TTC GAG CCA CCG AGT GGA GGA GCT GGA GCA GGA GCA GGA GCA GCT GCC CCA CCA CCA CCG CTG CAC CAC Phe Glu Pro Pro Ser Gly Gly Ata Gly Ala Gly Ala Gly Ata Ata Ata Pro Pro Pro Pro Leu His His p GCC CTG GCC CAC CCG CAT GTG CTG GCC CAC CAT CCA CCA CAC AAG CAT CCG CAT CCG CAT CCG CAC TCA His Pro His Pro His Pro His Ser His Pro His Pro His Ala Leu Val His Pro His Ata Lys Leu Ala

CTC CAC CCG CAA TCG CAT CCC +624 Leu His Pro Gln Ser His Pro 174 GCG GGC GGT GGC GCC GCC AAC +714 Ala Gty Gly Gty Ata Ala Asn 204

GGT CTG AAT GTG GCA CAG TAC GCG GCG GCC ATG CAA CAG CAC TAT GCC GCC GCA GCC GCA GCA GCA GCG GCC CGA AAC AGT GCA GCA GCA +804 Gly Leu Asn Vat Ala Gln Tyr Ala Ala ALa Met Gin Gin His Tyr Ala Ala Ala Ala ALa Ata Ata Ala Ata Arg Asn Ser Ala Ala Ala 234

GCC GCC GCG GCA GCC GCA GCA GCA GCA TCA GCC GCC GCC GCC GGA GGA GGA GGA GGA GGT GGC CTG GGT GTG GGT GGT GCG CCG GCG GGA +894 Ala Ata Ata Ala Ala Ata Ala Ala Ata Ser Ata Ala Ata Ala Gty Gty Gly GLY Gly Gty Gly Leu Gly Val Gly Gly Ala Pro Ala Gty 264 GCG GAG CTG GAC GAC AGC AGC GAT TAT CAC GAG GAG AAC GAG GAC TGC GAC AGC GAC GAG GGC GGC AGC GCG GGA GGC GGC GGG GGA GGC +984 Ala Gtu Leu Asp Asp Ser Ser Asp Tyr His Glu Glu Asn Gtu Asp Cys Asp Ser Asp Glu Gly Gly Ser Ala GtY Gly Gly Gty Gly Gly 294 AGC AAC CAC ATG GAC GAT CAC AGC GTT TGT AGC AAT Ggtgaggtg--(2421 bp)--cttttagGC GGC AAG GAC GAT GAC GGA AAC AGC ATT AAG +3489 ly Gty Lys Asp Asp Asp Gly Asn Ser lle Lys 317 Ser Asn His Met Asp Asp His Ser Vat Cys Ser Asn G AGC GGC TCC ACC AGC GAC ATG AGC GGG CTG AGC AAG AAG CAG AGG AAG GCC AGG ACC GCC TTC ACC GAC CAC CAG CTG CAG ACG CTG GAG +3579 Ser Gly Ser Thr Ser Asp Met Ser Gly Leu Ser Lys Lys Gtn Arg LS Ala Ars Thr Ala Phe Thr ASD His Gln Leu Gtn Thr Leu Glu 347 AAG TCC TTC GAG CGG CAG AAG TAC CTC AGT GTC CAG GAG CGC CAG GAG CTG GCC CAC Lys Ser Phe Gtu Arg GlIn LYS 1ar Leu Ser Vat Gin Glu Arg Gtn Glu Leu Ala His

AAG

Lys

CTG GAC TTG AGC GAC TGC CAG GTG AAG ACC +3669 Leu ASP Leu Ser ASP CYS Gin Val LYS Thr 377

TGG TAC CAG AAC AGG AGgtgcgtct--(104 bp)--ctttttagG ACC AAA TGG ATG CGA CAG ACT GCT GTC GGG CTG GAA CTC CTC GCC GAG GCC g Thr Lys Trp) Met Gin Thr Ala. Val Gty Leu Glu Leu Leu Ala Gtu Ala Tr2 Tyr Gln Asn TGG CCG TAC GCG GCT GCT GCC GGT GCT GGG GCC GCT GCC TTG GGC TAC CCC GGA AAC TTC GCC GCC TTC CAG CGG CTC TAC GGC GGA TCC Gly Asn Phe Ala Ala Phe Gln Arg Leu Tyr Gly Gty Ser Pro Tyr Leu Gly Ala Trp Pro Tyr Ala Ala Ala Ala Gly Ala Gty Ala Ala

I=sAr

Arg,

GCT GCC GCC GCC CAT GGT GCC ACG CCC CAC ACC AGC ATC GAC ATC TAC TAC CGC Ala Ala Ala ALa His Gly Ala Thr Pro His Thr Ser Ilie Asp Ile Tyr Tyr Arg

CAA GCG Gln ALa

+3858 400 +3948 430

GCC GCC GCC GCC GCC ATG CAG AAG CCC CTG +4038 ALa Ala ALa Ata Ala Met Gln Lys Pro Leu 460

CCC TAC AAC CTC TAC GCC GGA GTG CCC AAT GTG GGC GTG GGC GTG GGC GTC GGC GTC GGC CCA GCC CCC TTC TCG CAC CTC TCC GCC TCC +4128 Pro Tyr Asn Leu Tyr Ata Gty Vat Pro Asn Vat Gly Vat Gly Val Gly Val Gly Vat Gly Pro Ala Pro Phe Ser His Leu Ser Ala Ser 490

AGT TCG CTG TCC TCG CTG AGC AGC TAC TAC CAG AGC GCC GCT GCC GCT GCG GCT GCC GCG AAT CCG GGC GGA CCG CCG CCC CCA CCC CCG +4218 Ser Ser Leu Ser Ser Leu Ser Ser Tyr Tyr Gln Ser Ala Ala Ata Ata Ala Ala Ata Ala Asn Pro Gly Gly pro Pro Pro Pro Pro Pro 520 CCC TCG TCG GCG GCG GCG GCT ACC GGC GGC TCT CCA TCG CCC ATC GGG GGA CTG ATC AAG CCG CTG GCC GGC AGC CCC ACC GGC GGT ATG +4308 Pro Ser Ser Ala Ala Ala Ala Thr Gly Gly Ser Pro Ser Pro lie Gly Gly Leu Ile Lys Pro Leu Ala Gly Ser Pro Thr Gly Gly Met 550 A

414

Om( D) encodes a homeobox protein CCC CCG CAC CAC CCC TCC CGT CCC GAC TCC GCC TCG CCG CCG CTG CCC CTG CCG CTG GCA CGC CCC CCC TCC ACA CCA AGT CCC ACC CTG +4398 Pro Pro His His Pro Ser Arg Pro Asp Ser Ala Ser Pro Pro Leu Pro Leu Pro Leu ALa Arg Pro Pro Ser Thr Pro Ser Pro Thr Leu 580

AAC CCG GGC AGT CCG CCG GGC CGC TCG GTG GAC AGT TGT TCG CAG GCC CAG TCG GAT GAC GAG GAT CAG ATC CAG GTG TGA gcgagaggcag +4490 606 Asn Pro GLy Ser Pro Pro Gty Arg Ser Val Asp Ser Cys Ser Gin Ala Gln Ser Asp Asp GLu Asp Gln ILe Gin VaL *

gatctagagagtgtgtgtgtgtgtgtgtggaaacagtgttggaaaaccccccaaaagcacaatatctttatttcgaaaaaaaaagcatttatttttaaaagcaactttaaaaagcacaa +4609 aaaaagacagtttttagcgaaAATAAAttcaggatgtgtgctagtgtgtgtgtgttgtgtatataagccctgtattagtgtgtgtgcgtgtctgcttcttaacttagttttttaggtcg +4728 cggcttagtacactgtattgggaagtgcttctggaagctcaaaaacaacattttttttttctaaaaaagtsataataatataatcgatgataaatggaaaataattaataatatttatt +4847

tagaatgcttgtatatattcactatcagccaaaaaaaaagtaacaaaactctgtatagttaggcctaaccacaaaatgtattatcttcattaatattaattttaaatactattatatac atatattatattttttttaatagatactagcctagacgttgtaactgtaactgtaactgtaacagtataatgtaaagtatatcctttttttgtctatgttagcaaccacacgtattttt ttgtctaaAATAAAaaaaaaaAATAAAtaacaataattatatacgagaaagtaaapctt

l+4966 +5085 +5144

Hindlll

Fig. 8. Sequence of the Om(ID) gene. The DNA sequence from coordinate - 1.5 to +5.1 in Figure 5 is shown. The DNA sequence of the proteincoding region is written in capital letters with the amino acids shown below. GAGA repeats in the 5' regulatory region are indicated as underlined capital letters. Polyadenylation signals (AATAAA) in the 3' region are also shown as underlined capitals. The transcription initiation site is labeled with + 1 above the Drosophila consensus hexamer (underlined). The double underline labeled with H indicates the location of the homeodomain. The underlines labeled with A, 0 and P indicate the locations of the alanine-rich domain, glutamine/histidine-rich domain and histidine/proline repeat respectively. Mono-amino acid stretches (more than four amino acids in a row) are also underlined. An asterisk shows the putative termination codon. Methionine codons that may be used as translation initiation are capitalized. Numbers in the right-hand margin designate the location of nucleotides (+1 refers to the transcription initiation site) and amino acids. The AccI (at +92) and HindIll (at +5139) sites used for the construction of the hsp7O-Om(JD) chimeric gene are marked as AccI and HindIII. The EcoRI site at the end of the plDEl9 plasmid is shown at +7. 1

60

30

I

I

Om(lD} QRKAARTATDHQLQTlES _KYLSVQEYRLAHRKLDASDCQVKTWY * * * * * * * * eve VRRYRTAFTRDQRI LKENYVSRP RRCELAAQINLPESTIKVVEQNRR KDKRQRI Dfd ro

lab zen

29

RT RIAHTLVlSERQIIWFQNRRNKWKKDNK 28 PKRQRTAYTRHQI QRRQRTTFSTEQTLRIEVmFRNEYISRSRRFELAETLRLTETQIKWFQNRRAKDKRIEK 27

NNSGNNRNKQYLTR A/INTWUIERVK LKRSRTAPTSVQLVELEN NMYLYRTRRIEI[QRLSLCERQIQRFKIQ

l

Helix 1

I

26 26

I ll

l Helix 2

Helix 3

Fig. 9. Amino acid sequence of the homeodomain of Om(JD) and other Drosophila genes. Shaded amino acids of the Om(JD) homeodomain indicate residues which are shared with either of several known Drosophila homeodomains. Five homeodomain sequences that give the highest homology scores when compared to the Om(JD) homeodomain are listed below the sequence of the latter. Numbers on the right margin indicate the number of amino acids that are identical to those of Om(JD). Brackets below the amino acid sequence show the locations of expected helices according to information obtained from analysis of the Antennapedia homeodomain (Otting et al., 1988). References for homeodomain sequences shown in this figure are as follows: eve (Macdonald et al., 1986; Frasch et al., 1987); Dfd (Regulski et al., 1985); ro (Tomlinson et al., 1988); lab (Hoey et al., 1986; Mlodzik and Gehring, 1987); zen (Rushlow et al., 1987).

Examination of eye-antenna discs in Om(JD) mutants confirms this contention based on the finding that eye discs from strains carrying Om(JD) alleles are approximately half the normal size. Therefore, overexpression of the Om(JD) protein results in cell death in the eye imaginal disc, but not in any other tissue, since heat-shocked adult animals only display eye defects, although in some cases these flies also show leg abnormalities. A priori, it is possible to imagine that similar cell lethal defects could be associated with overexpression of many genes that may not necessarily be involved in eye development. Nevertheless, several indirect lines of evidence suggest that genes mutated by the tom element indeed represent functions concerned with eye morphogenesis. In particular, the Om(JD) locus encodes a protein containing a homeobox, a motif previously found in many genes controlling developmental decisions at various times including eye morphogenesis (Tomlinson et al., 1988). Although overexpression of many homeobox-containing genes usually results in homeotic transformations, high levels of Om(JD) protein result in cell death in the eye imaginal discs that seems to be restricted to those cells located on the morphogenetic furrow, suggesting some specificity in the ability of cells to respond to signals generated by Om(JD) overexpression. This effect is reversed by mutations in the unlinked Om(JK)Su gene, which shows a recessivefurrowed eye phenotype (Hinton, 1988). This interaction with a gene

that shows an eye-specific phenotype is supportive of a role for Om(JD) in eye development. This function is probably not exclusive, and the Om(JD) gene product is likely to play other roles during embryogenesis, since the lack of Om(JD) function in recessive alleles results in an embryonic lethal phenotype. The Om hypermutability system in D.ananassae may thus allow the identification of genes involved in eye morphogenesis that are also important at other times of development, and that may be difficult to identify in screenings for recessive eye-specific phenotypes. Isolation of other tom-induced mutations now in progress will allow us to confirm this expectation.

Materials and methods Fly culture and strains Flies were raised at 22.5°C in standard corn meal/molasses/yeast medium

seeded with live baker's yeast. To prepare RNA for developmental Northerns, embryos were collected from agar/molasses plates every 24 h and cultured at 22.5°C in 12 cm diameter tubs containing standard medium until animals reached appropriate developmental stages. Materials were stored at -80°C until use. All D.ananassae stocks used in this study have been described in previous reports (Hinton, 1984; Tanda et al., 1989). Bar mutants were obtained from the Mid-America Drosophila Stock Center, Bowling Green State University. Bmi is a weak Bar allele associated with an inversion containing a breakpoint between 16A and 20A; B263-20 is a complete revertant of Bar where the duplicated 16A region which contains the Bar locus has been deleted (see Sutton, 1943, for a detailed description of these alleles).

415

S.Tanda and V.G.Corces

Fig. 10. Scanning electron micrographs showing phenotypes of heat-treated transformants. Anterior is to the right and dorsal is at the top. (A) Phenotype of transformed flies heat-shocked during the second instar. (B, C) Phenotypes of transformants heat-shocked during middle third instar. (D, E) Phenotypes of transformants heat-shocked during late third instar and prepupae. (F) Phenotype of the Bar mutant in D.melanogaster. RNA preparation, Northern analysis and genomic DNA sequencing RNA was extracted from - 1 g of animals using the SDS-phenol technique (Spradling and Mahowald, 1979). Poly(A)+ RNAs were purified by chromatography on oligo(dT) -cellulose (Aviv and Leder, 1972), separated on 1.2% formaldehyde/agarose gels (7 ,tg RNA/lane) and transferred to Biotrans (ICN Biochemicals) or Nytran (Schleicher & Schuell). Filters were incubated with a 32P-labeled probe in hybridization solution (5 x SSCP, 5 x Denhardt's, 50% formamide, 1 % sarcosyl, 100 Agg/ml carrier DNA and 10% dextran sulfate) at 42°C overnight. The filters were then washed at 50°C in 0.1 x SSC/O.5% SDS for 30 min and exposed to X-ray films

I Dd7 (+ 3542 to + 3520); 5'-TTCTTGCTCAGCCCGCTCATGT; I Dd8 (+3910 to +3889), 5'-ATCCGCCGTAGAGCCGCTGGAA; lDd5 (+4517 to +4494), 5'-ACTCTCTAGATCCTGCCTCTCGC. These primers were synthesized using a 381A DNA Synthesizer (Applied Biosystems) and purified through Sep-Pak cartridges (Waters, Millipore). Reverse transcriptase and polymerase chain reactions (PCR) were carried out by the methods described in Innis et al. (1990). Two micrograms of poly(A)+ RNA from Om(JD)9R25 were hybridized to Om(lD)-specific downstream primers (300 ng) after denaturation at 85 -90°C for 5 min and

at -800C.

and 0.01 % gelatin), 5 mM DTT, 500 AM each of dNTP, 40 units of RNasin (Promega) and 36 units of AMV reverse transcriptase (Life Sciences Inc.). After denaturing the enzyme at 95°C for 5 min, DNA was amplified by PCR in 100 Al of reaction mix containing 1 x PCR buffer, 1 Ag each of Om(ID)-specific upstream and downstream primers, 200 pM each of dATP, dCTP and TTP, 50 pM of dGTP, 150 pM of 7-deaza-2'-deoxy-GTP (Boehringer Mannheim Biochemicals) and 2.5 units of Taq polymerase (Perkin Elmer Cetus). PCR reactions were carried out using a DNA Thermal Cycler (Perkin Elmer Cetus). A step-cycle program consisting of denaturation (94°C, 1 min), annealing (55°C, 1 min) and extension (72°C, 1-3 min) was used for the first-strand cDNA amplification except in the cloning of the 3' end of the Om(JD) gene. In order to clone the 3' end of the gene, an adapter primer (5'-GACTCGAGTCGCATCGAT) and a dT16-adapter

To determine the sequence of genomic DNA, six EcoRI fragments of XOm(1D)ca; px3B containing the Om(JD) locus from the wild-type ca; px stock (Tanda et al., 1989) were subcloned into pUC 18. All or part of four clones designated pIDEl 1, p1DE19, plDE27 and p1DE35, which cover the region from coordinate -1.5 to 5.1, were sequenced by the dideoxy chain termination method (Sanger et al., 1977) using Sequenase in the conditions recommended by the manufacturer (United State Biochemicals).

cDNA isolation by the polymerase chain reaction procedure and primer extension Primers used in this experiment are schematically shown in Figure 6. Upstream primers [with respect to the orientation of the Om(ID) gene] are the following: lDu13 (+70 to +90), 5'-GAGTATCATTTGTGGAGTGCT; Du9 (+ 160 to + 181), 5'-AGCCAGCTGCACCACCATCTCA; I DuO0 (+ 712 to + 733), 5'-AACGGTCTGAATGTGGCACAGT; Du3 (+ 3488 to + 3501), 5'-AAGGACGATGACGGAAACAGCATT; 1 Du4 (+ 3826 to +3855), 5'-ACAGACTGCTGTCGGGCTGG; lDul2 (+3991 to +4011), 5'-CACACCAGCATCGACATCTAC. Downstream primers are as follows: I Ddl 1 (+378 to +368), 5'-CAGGATGTCGTTGATCATGAA;

416

reverse transcribed at 42°C for 1 h in 20 Al of reaction mix containing 1 x PCR buffer (10 mM Tris-HCI, pH 8.3, 50 mM KCI, 1.5 mM MgCl2,

primer (5'-GACTCGAGTCGCATCGATTTTTTTTTTTTTTTTT) were made and used for the first round of amplification and reverse transcription respectively. Since the 3' part of the Om(JD) gene is extremely GC-rich (>70%), a two-step nested PCR (first round at 45°C low annealing temperature) was performed using 250 pM dGTP and 250 uM 7-deaza-2' deoxy-GTP. Fragments hybridizing to the Om(JD) region were filled-in with the Klenow fragment and subcloned into the SmaI site of pUC 18. DNA

Om(lD) encodes a homeobox protein sequences of these clones were determined by the method mentioned above. For primer extensions, 10 ,g aliquots of poly(A)+ RNA purified from heads of the ca,px stock were hybridized in 10 ng of IDdI 1 primer endlabeled at the 5' end with [-y-32P]dATP overnight at 23°C, and extended by the method described in Sambrook et al. (1989). Extended single-stranded fragments were separated on a 6% denaturing polyacrylamide gel along with dideoxy sequence reactions of plDEI9, primed with the IDdI 1 primer, as a marker; plDE19 is an EcoRI fragment cloned in pUC18 and containing the most upstream region of the Om(JD) gene. Amplification of the Om(1D) transcript from eye-antenna imaginal discs Five larvae at the late third instar stage were dissected and 10 eye -antenna imaginal discs were transferred to lysis buffer (10 mM Tris-HCI, pH 8.0, 10 mM NaCl, 3 mM MgCl2 and 0.5% NP-40) and incubated on ice for 5 min. After spinning down the samples in a microcentrifuge at 4°C, a 5 ytl aliquot of the supernatant was taken and used for reverse transcription. Reverse transcription was carried out as described above. To estimate the amount of first-strand cDNA, various amounts of linearized plDE35, which contains the genomic segment corresponding to the region amplified, were added to the reactions to carry out competitive PCR (Gilliland et al., 1990). Four PCR reactions containing 0.1, 1, 10 and 100 ng of plDE35 respectively, and 5 jil aliquots of the reverse transcribed cDNA, were set up and amplified 50 cycles with a small amount of [a-32P]dATP. A set of lDu3 and lDd8 primers that give rise to 423 bp genomic and 303 bp cDNA fragments was used in this experiment. Amplified fragments were separated on a 1 % agarose gel and fragments corresponding to genomic and cDNA were cut out for liquid scintillation counting. To determine the amount of Om(JD)-homologous transcript in D. melanogaster, a 1.1 kb DNA fragment was amplified by low stringency PCR (45°C annealing temperature) using genomic DNA from D.melanogaster and a set of Om(JD)-specific primers, lDu3 and lDd6 (5'-ATCTGATCCTCGTCATCCGACT). After subcloning this fragment in pUC18, the DNA sequence was determined as described above. An upstream Bul (5'-AAGAGCGGCTCCACCAGCGA) and a downstream Bd2 (5'-TAGCTGCTCAGCGAGGACAGCGA) primer were made and used for PCR amplification of the Om(JD) homolog in eye-antenna imaginal discs from D. melanogaster Oregon R and Bar strains; the conditions used for reverse transcription and PCR are the same as those described above. To determine the amount of total RNA extracted from eye-antenna imaginal discs, 1 yl aliquots of the extracts were subjected to Northern analysis. The blots were then hybridized with clone pXlrl4 containing a Xenopus 18S rRNA gene (Botchan et al., 1977), and the intensity of the band corresponding to rRNA was measured by densitometry. Construction of chimeric genes and germline transformation A 5.1 kb genomic fragment extending from the AccI site, located between the EcoRI site and the translation initiation site, to the HindEII site at coordinate 5.1 (see Figure 8 for their locations), was cloned in the appropriate orientation into the blunt-ended XbaI site of phsp7OC4 which contains the XhoI-BamHI fragment of pVCI-8 (Bishop and Corces, 1988) in the Camegie 4 vector (P.Geyer personal communication). A 5.5 kb SaIl fragment containing the hsp70 promoter and the Om(JD) genomic segment from this Carnegie construct was introduced into the blunt-ended BamHI site of the CaSpeR vector (Pirrota et al., 1985). This construct was co-injected with p7r25.7wc (Karess and Rubin, 1984) into a D.melanogaster w"118 stock using the method described by Rubin and Spradling (1982). Electron microscopy Flies for electron microscopy were fixed in 4% glutaraldehyde in 0.1 M sodium cacodylate, pH 7.0, dried, coated, and examined in a Jeol scanning electron microscope.

Acknowledgements The authors wish to express their special thanks to Drs C.W.Hinton and C.H.Langley for their critical comments and encouragement during these studies. The sequence of the Om(JD) gene has been independently determined by Drs K.Saigo and S.Ishimaru, and made available to us in the course of these studies. We would like to thank Dr Saigo for sharing unpublished information with us. We also thank Drs B.Sollner-Webb for the Xenopus 18S rRNA clone, P.Geyer for the phsp7OC4 plasmid, M.Sepanski for help with electron microscopy, P.Morin for help with densitometry, and members of the Corces lab for help with various techniques, enlightening discussions and moral support. This work was funded by American Cancer Society Grant NP-546A and US Public Health Service Award GM 35463.

References Aviv,H. and Leder,P. (1972) Proc. Natl. Acad. Sci. USA, 69, 1408-1412. Beachy,P.A., Krasnow,M.A., Gravis,L.R. and Hogness,D.S. (1988) Cell, 55, 1069-1081. Biggin,M.D. and Tjian,R. (1988) Cell, 53, 699-711. Bishop,J.G. and Corces,V.G. (1988) Genes Dev., 2, 567-577. Bonnier,G. and Nordenskiold,H. (1942) Drosophila Inform. Serv., 16, 47. Botchan,P., Reeder,R.H. and Dawid,I.B. (1977) Cell, 11, 599-607. Cavener,D.R. (1987) Nucleic Acids Res., 15, 1353-1361. Desplan,C., Theis,J. and O'Farrell,P.H. (1988) Cell, 54, 1081-1090. Fickett,J.W. (1982) Nucleic Acids Res., 10, 5303-5318. Frasch,M., Hoey,T., Rushlow,C., Doyle,H. and Levine,M. (1987) EMBO J., 6, 749-759. Frigerio,G., Burri,M., Bopp,D., Baumgartner,S. and Noll,M. (1986) Cell, 47, 735-746. Fristrom,D. (1969) Mol. Gen. Genet., 103, 363-379. Fristrom,D. (1972) Mol. Gen. Genet., 115, 10-18. Geyer,P.K., Spana,C. and Corces,V.G. (1986) EMBO J., 5, 2657-2662. Gilliland,G., Perin,S. and Bunn,H.F. (1990) In Innis,M.A., Gelfand,D.H., Sninsky,J.J. and White,T.J. (eds), PCR Protocols: A Guide to Methods and Applications. Academic Press, New York, pp. 60-69. Hanes,S. and Brent,R. (1989) Cell, 57, 1275-1283. Hinton,C.W. (1984) Genetics, 106, 631-653. Hinton,C.W. (1988) Genetics, 120, 1035-1042. Hoey,T. and Levine,M. (1988) Nature, 332, 858-861. Hoey,T., Doyle,H.J., Harding,K., Wedeen,C. and Levine,M. (1986) Proc. Natl. Acad. Sci. USA, 83, 4809-4813. Hultmark,D., Klemenz,R. and Gehring,W.J. (1986) Cell, 44, 429-438. Innis,M.A., Gelfand,D.H., Sninsky,J.J. and White,T.J. (1990) PCR Protocols: A Guide to Methods and Applications. Academic Press, New York. Karess,R.E. and Rubin,G.M. (1984) Cell, 38, 135-146. Lindsley,D. and Zimm,G. (1985) The genome of Drosophila melanogaster. Part 1: genes A-K. Drosophila Inform. Serv., 62, 33-35. Macdonald,P.M., Ingham,P. and Struhl,G. (1986) Cell, 47, 721-734. Mlodzik,M. and Gehring,W.J (1987) Cell, 48, 465-478. Mount,S.M. (1982) Nucleic Acids Res., 10, 459-472. Mozer,B., Marlor,R., Parkhurst,S. and Corces,V. (1985) Mol. Cell. Biol., 5, 885-889. Otting,G., Qian,Y., Muller,M., Affolter,M., Gehring,W. and Wuthrich,K. (1988) EMBO J., 7, 4305 -4309. Perkins,K.K., Dailey,G.M. and Tjian,R. (1988) Genes Dev., 2, 1615-1626. Pirrota,V., Steller,H. and Bozzetti,M.P. (1985) EMBO J., 4, 3501 -3508. Regulski,M., Harding,K., Kostriken,R., Karch,F., Levine,M. and McGinnis,W. (1985) Cell, 43, 71-80. Rubin,G.M. and Spradling,A.C. (1982) Science, 218, 348-353. Rushlow,C., Doyle,H., Hoey,T. and Levine,M. (1987) Genes Dev., 1, 1268-1279. Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Press, Cold Spring Harbor, NY. Sanger,F., Nicklen,S. and Coulson,A.R. (1977) Proc. Natl. Acad. Sci. USA, 74, 5463-5467. Schalet,A. (1969) Drosophila Inforn. Serv., 44, 87. Spradling,A.C. and Mahowald,A.P. (1979) Cell, 16, 589-598. Shrimpton,A.E., Montgomery,E.A. and Langley,C.H. (1986) Genetics, 114, 125-135. Soeller,W.C., Poole,S.J. and Kornberg,T. (1988) Genes Dev., 2, 68-81. Sutton,E. (1943) Genetics, 28, 97-107. Tanda,S., Shrimpton,A.E., Ling-Ling,C., Itayama,H., Matsubayashi,H., Saigo,K., Tobari,Y.N. and Langley,C.H. (1988) Mol. Gen. Genet., 214, 405-411. Tanda,S., Shrimpton,A.E., Hinton,C.W. and Langley,C.H. (1989) Genetics, 123, 495-502. Tomlinson,A., Kimmel,B.E. and Rubin,G.M. (1988) Cell, 55, 771-784. Treisman,J., Gonczy,P., Vashishtha,M., Harris,E. and Desplan,C. (1989) Cell, 59, 553-562. Welshons,W.J. (1960) Drosophila Inform. Serv., 34, 54. Received

on

October 5, 1990; revised

on

November 5, 1990

Note added in proof The nucleotide sequence data reported here will appear in GenBank and DDBJ databases under the accession number

the

EMBL,

X56682.

417