Molecular Microbiology (2014) 92(3), 557–569 ■

doi:10.1111/mmi.12575 First published online 2 April 2014

Reversible non-genetic phenotypic heterogeneity in bacterial quorum sensing Binod B. Pradhan and Subhadeep Chatterjee* Centre for DNA Fingerprinting and Diagnostics, Nampally, Hyderabad 500001, India.

Summary Bacteria co-ordinate their social behaviour in a density-dependent manner by production of diffusible signal molecules by a process known as quorum sensing (QS). It is generally assumed that in homogenous environments and at high cell density, QS synchronizes cells in the population to perform collective social tasks in unison which maximize the benefit at the inclusive fitness of individuals. However, evolutionary theory predicts that maintaining phenotypic heterogeneity in performing social tasks is advantageous as it can serve as a bethedging survival strategy. Using Pseudomonas syringae and Xanthomonas campestris as model organisms, which use two diverse classes of QS signals, we show that two distinct subpopulations of QS-responsive and non-responsive cells exist in the QS-activated population. Addition of excess exogenous QS signal does not significantly alter the distribution of QS-responsive and non-responsive cells in the population. We further show that progeny of cells derived from these subpopulations also exhibited heterogeneous distribution patterns similar to their respective parental strains. Overall, these results support the model that bacteria maintain QS-responsive and non-responsive subpopulations at high cell densities in a bet-hedging strategy to simultaneously perform functions that are both positively and negatively regulated by QS to improve their fitness in fluctuating environments.

Introduction Bacteria are able to co-ordinate multiple social behaviours via the production and perception of diverse cell–cell communication molecules in a process known as quorum sensing (QS) (Fuqua et al., 2001; Parsek and Greenberg, Accepted 4 March, 2014. *For correspondence. E-mail subhadeep@ cdfd.org.in; Tel. (+91) 40 2474 9425; Fax (+91) 40 2474 9448.

© 2014 John Wiley & Sons Ltd

2005; Williams et al., 2007; Ng and Bassler, 2009). It is increasingly evident that QS synchronizes production and secretion of several exoproducts known as ‘public goods’ that are beneficial to the community as a whole. Such traits includes, extracellular polysaccharides and other components involved in biofilm formation, extracellular cell-wall hydrolysing enzymes and virulence factors that damage hosts, and products such as biosurfactants required for motility (Ng and Bassler, 2009; West et al., 2012). It has been generally assumed that QS synchronizes cells to respond in unison at high cell density for the production of the public goods that maximize the inclusive fitness of individuals (Long et al., 2009; Darch et al., 2012; Pai et al., 2012; West et al., 2012). Although it has been argued that QS uniformly co-ordinates QS responses, heterogeneity does arise in such communities (Sandoz et al., 2007; Anetzberger et al., 2009; Dandekar et al., 2012). In the opportunistic pathogen Pseudomonas aeruginosa it has been shown that heterogeneity in QS may arise due to the spontaneous occurrence of social cheaters (variants) under certain growth conditions (Sandoz et al., 2007; Dandekar et al., 2012). In Vibrio harveyi it has been argued that cells exhibit heterogeneity in response to QS signals, since they maintain autoinducer levels at relatively low concentrations when grown in broth culture and that while cells respond in unison to the addition of additional autoinducer to the culture (Anetzberger et al., 2009). An increasing body of research suggests that even in homogeneous environments, bacteria can exhibit cell-tocell phenotypic variability, termed non-genetic individuality (Gardner et al., 2007; Davidson and Surette, 2008; Jacob and Schultz, 2010). Phenotypic heterogeneity has been reported in diverse bacterial processes such as chemotaxis-driven motility (Spudich and Koshland, 1976), persistence in the presence of antibiotics (Balaban et al., 2004), bi-stability of gene expression (Novick and Weiner, 1957) and induction of natural competence (Su˝el et al., 2006). It has been argued that generation of phenotypic heterogeneity by stochastic fate determination in an isogenic population may be a bet-hedging survival strategy that allows the population to deploy phenotypically diverse cells that can appropriately respond to fluctuating environmental condition (Gardner et al., 2007; Davidson and Surette, 2008; Jacob and Schultz, 2010).

558 B. B. Pradhan and S. Chatterjee ■

Fig. 1. Schematic representation of QS circuit and biosensor strains of P. syringae pv. syringae (Pss), Xanthomonas camestris pv. campestris (Xcc) and the E. coli strain JB524 harbouring the Vibrio fischerie LuxR and gfp fused to luxI promoter. A. In PssB728a (wild-type Pss), ahlI encodes for the AHL synthase which is involved in the synthesis of N-acyl-homoserine lactone (AHL), 3-oxo-hexanoyl-homoserine lactone (3OC6-HSL). The AHL regulator, AhlR, binds with 3OC6-HSL and positively regulate expression of ahlI via a positive feedback in which AHL concentrations are produced as cell concentration increases. QS response is monitored via fluorescence of Pss cells harbouring a chromosomal-borne gfp reporter fusion (Pss B728a-PahlI::gfp), which exhibit AHL-dependent transcriptional activity. B. Xcc (a pathogen of crucifer) produces a fatty acid like QS signalling molecule, DSF (Diffusible signal factor; cis-11-methyl-2-dodecenoic acid). The rpfF (regulation of pathogenicity factor F) encodes the DSF synthase. The RpfC–RpfG are hybrid two-component sensor – and response regulator which are involved in sensing DSF and positively regulating QS traits such as production of Type II effectors [endoglucanase (eng), protease], biofilm formation and virulence. Dashed lines indicate unknown interaction mechanisms. DSF mediated QS induction is monitored via fluorescence of Xcc cells harbouring a chromosomal-borne gfp reporter fusion (Xcc 8004-Peng::gfp), which exhibit DSF-dependent transcriptional activity. C. The E. coli strain (JB524) QS-biosensor strain responds to exogenously added AHL, harbours the V. fisheries luxR and transcriptional fusion of GFP with luxI (AHL synthase promoter; PluxI:gfp).

QS responses have been characterized primarily in bulk populations, and it is likely that such measurements would mask non-genetic phenotypic heterogeneity exhibited by individual cells. Therefore, to understand how individuals behave in populations undergoing QS, we addressed this process in Pseudomonas syringae pv. syringae (Pss) and Xanthomonas campestris pv. campestris (Xcc), as model organisms that use two diverse classes of QS signals (Quiñones et al., 2005; Deng et al., 2011). Pss mediates QS via the production of 3-oxohexanoyl-homoserine lactone (3OC6-HSL), typical of the most well-characterized process of QS in Gram-negative bacteria (Fuqua et al., 1994; 2001) (Fig. 1A). In contrast, QS in several Gram-negative bacteria in the genus Xanthomonas and Burkholderia, is mediated by the synthesis and perception of fatty acid signalling molecules (cis-11methyl-2-dodecenoic acid) called DSF (diffusible signal factor) (Deng et al., 2011). DSF regulates expression of virulence-associated factors (Fig. 1B) such as extracellu-

lar polysaccharides (EPS) and extracellular enzymes (Barber et al., 1997; Chatterjee et al., 2008; Deng et al., 2011). In this study we used fluorescence activated cell sorting (FACS), single cell microscopy and live cell imaging to investigate the dynamics of QS in single cells in the population of wild-type and QS-deficient mutants of Pss and Xcc. We show that heterogeneity in QS response is a reversible stochastic phenomenon. We propose that non-genetic phenotypic heterogeneity in QS response is a bet-hedging strategy that enable adaptation to changing environmental conditions.

Results Heterogeneity in QS response in the wild-type P. syringae pv. syringae and X. campestris pv. campestris Using the chromosomal integration plasmid (pVO155; Oke and Long, 1999), which is used in constructing © 2014 John Wiley & Sons Ltd, Molecular Microbiology, 92, 557–569

Individuality in bacterial quorum sensing 559

chromosomal reporter fusion, we had made chromosomal reporter fusion strain in the wild-type Pss (B728aPahlI::gfp), Xcc (8004-Peng::gfp) as well as in the QS-deficient mutants, ΔahlI-PahlI::gfp and ΔrpfF-Peng::gfp (Table S1, see Experimental procedures). To study the QS response of single cells in culture, we used wild-type strains of Pss (B728a-PahlI::gfp) and Xcc (8004-Peng::gfp) harbouring chromosomal-borne gfp reporter fusions responsive to AHL and DSF respectively (Fig. 1). Cells from overnight (12 h; approximate cell density of 1 × 107cells ml−1) grown cultures were inoculated at a density of ∼ 2 × 106 cells ml−1 into fresh media supplemented with appropriate antibiotics and samples collected after various time. In a similar fashion, QS-deficient mutant strains of Pss and Xcc (ΔahlI-PahlI::gfp and ΔrpfFPeng::gfp) harbouring the chromosomal-borne gfp reporter fusions were inoculated as controls. The average cellnormalized GFP fluorescence of B728a-PahlI::gfp and 8004-Peng::gfp increased in a typical density-dependent fashion, with maximum induction occurring between 24 and 48 h after inoculation (Fig. 2A and B). In parallel, the distribution of GFP fluorescence intensity of individual cells was analysed by FACS (Fig. 2C and D; Supporting information, Figs S1 and S2). At a given sample time, Pss ΔahlI-PahlI::gfp (AHL−) and ΔrpfF-Peng::gfp mutants harbouring the AHL and DSF biosensor plasmids exhibited little gfp fluorescence (mean of ∼ 150–200 A.U.) respectively. Analysis of the fraction of induced (GFP fluorescence intensity above 1000 A.U.) and uninduced cells (< 200 A.U.) in the population of wild-type Pss B728aPahlI::gfp and Xcc 8004-Peng::gfp cells revealed that the percentage of QS induced (GFP+) cells increased with time (Fig. 2A and B). Interestingly, there was significant proportion of cells (∼ 18–22%) that did not attain QS-induced state even at high cell densities (∼ 1012–1014 cells ml−1 between 40 and 48 h of growth), as they exhibited GFP fluorescence similar to the ΔahlI- PahlI::gfp and ΔrpfF-Peng::gfp QS mutants (Fig. 2; Supporting information, Figs S1 and S2). We also examined the QS response in Pss B728a-PahlI::gfp and Xcc 8004-Peng::gfp after 40 h of growth using confocal laser scanning microscopy (CLSM) single cell microscopy (Fig. 3). Analysis of the mean GFP fluorescence intensity of individual cells of Pss and Xcc visualized by fluorescence microscopy also corroborated heterogeneity pattern in QS response and revealed broadly heterogeneous GFP fluorescence intensity within the population, ranging from bright to dark cells similar to QS− uninduced control (Fig. 3). To determine if the QS-unresponsive phenotype was associated with dead cells, we simultaneously performed propidium Iodide (PI) staining of cultures Pss B728a-PahlI::gfp and Xcc 8004-Peng::gfp, and found that even at high cell densities (∼ 1012–1014 cells ml−1 at 40 h of growth), only approximately, 3–4% of the cells were dead (Fig. 3; © 2014 John Wiley & Sons Ltd, Molecular Microbiology, 92, 557–569

Table 1). We also examined the QS response in wild-type Pss B728a and Xcc 8004 harbouring plasmid-borne AHL and DSF biosensor using FACS analysis, whole-cell GFP fluorescence, growth (by dilution plating) and microscopy, which further corroborated the heterogeneity pattern observed using the biosensor plasmid borne strains (Figs S3 and S4). We examined QS response in the wild-type Pss and Xcc strain with or without supplementation of various concentrations of exogenous AHL and DSF (Tables S2 and S3). Henceforth, we have further carried out all experiments with 20 μM and 35 μM DSF (Fig. 4A and B). Although there was about a twofold increase in the average GFP fluorescence of cultures, the proportion of QS-unresponsive cells was not changed significantly in the cultures of wild-type Pss B728a-PahlI::gfp and Xcc 8004-Peng::gfp by the addition of exogenous synthetic 3OC6-HSL and DSF, to the cultures respectively (Fig. 4A and B). We also did FACS analysis to determine the mean and median GFP fluorescence intensity of induced cells in the population of wild-type Pss B728a-PahlI::gfp and Xcc 8004-Peng::gfp, with or without exogenous AHL and DSF supplementation (Figs S5 and S6). Analysis of mean GFP fluorescence intensity by FACS further corroborated the pattern observed in the whole-cell GFP fluorescence measurement experiments. We also studied QS response in wild-type Pss and Xcc strains harbouring plasmidborne GFP reporter fusion, with or without exogenous AHL and DSF supplementation, which further corroborated the pattern observed with the strains harbouring the chromosomal-borne reporter fusion (Fig. S7). This indicated that heterogeneity of the QS response was not due to the presence of sub-saturating levels of the QS signals. Intriguingly, in an Escherichia coli biosensor strain (Fig. 1C) harbouring both the Vibrio fisheries luxR and transcriptional fusion of GFP with the luxI (PluxI:gfp), the percentage of QS-induced (GFP+) cells increased to about 97–99% after addition of even low levels of synthetic 3OC6-HSL after 2 h of growth (Fig. 4C). Characterization of QS-responsive and non-responsive cell subpopulations To understand the nature of the heterogeneity in QS response in the populations of Pss and Xcc, we separated cells from the two subpopulations (GFP+ and GFP−) from the cultures of wild-type strains using flow cytometry after 40 h of growth to determine if their progeny also retained difference in QS response. We used QS− mutants as control and scatter-gated fluorescence analysis to separate QS-responsive and non-responsive cells (Fig. 5; Supporting information, Fig. S8; Table S4). The mean GFP fluorescence intensity of uninduced cells in the wildtype Pss and Xcc population was less than 120–300 A.U.,

560 B. B. Pradhan and S. Chatterjee ■

similar to QS− uninduced controls. The mean GFP fluorescence intensity of induced cells (GFP+) was above 1000 A.U. To isolate distinct sub-populations of uninduced and induced cells, fluorescence channel boundaries (gates) were set to sort the GFP– (gate P2; mean GFP

fluorescence < 300 A.U.) and GFP+ (gate P3; mean GFP fluorescence intensity > 1000 A.U.) cells (Fig. 5; Fig. S8). Separated cells from the cultures of wild-type Pss and Xcc exhibited a broad distribution of GFP fluorescence but could be distinguished as either GFP− (dark) and GFP+ © 2014 John Wiley & Sons Ltd, Molecular Microbiology, 92, 557–569

Individuality in bacterial quorum sensing 561

Fig. 2. Heterogeneity in QS response in wild-type Pss (B728a-PahlI::gfp) and Xcc (8004-Peng::gfp) strains harbouring the chromosomal GFP reporter fusion responsive to 3OC6-HSL and DSF. A and B. (A) Wild-type PssB728a-PahlI::gfp and (B) Xcc8004-Peng::gfp strains were inoculated at a density of ∼ 2 × 106 cells ml−1 from 12 h grown cultures in fresh media supplemented with appropriate antibiotics at time zero. In a similar fashion, the QS− mutant strains of Pss and Xcc (ΔahlI- PahlI::gfp; ΔrpfF-Peng::gfp) harbouring the chromosomal GFP reporter fusion were inoculated as a control. At times indicated samples were taken and analysed for average whole-cell GFP fluorescence determined by fluorescence spectrophotometer (GFP fluorescence intensity at Excitation-472 nm, Emission-512 nm), cfu ml−1 (determined by dilution plating) and percentage of uninduced (dark; indicated by open bars) and induced (bright; indicated by closed bars) cells in the wild-type population was determined by fluorescence activated cell sorting (FACS) analysis at times indicated by comparing the GFP fluorescent intensity distribution of similarly grown QS-deficient strains. Per time point cell normalized GFP fluorescence (closed triangles) and culture density [Log (cfu ml−1)] (closed circles) are presented. Values presented are average from three independent experiments ± S.E. C and D. Representative FACS histograms shows GFP fluorescence intensity distribution of uninduced (Dark; GFP−) and induced cells (Bright; GFP+) in the wild-type PssB728a-PahlI::gfp (C) and Xcc8004-Peng::gfp (D) population at 8, 32 and 48 h (indicated by green colour histograms). Distribution of GFP fluorescent intensity of respective QS− mutant control of Pss and Xcc (ΔahlI- PahlI::gfp; ΔrpfF-Peng::gfp) are represented in red colour shaded histogram for each time point. The boxed area represents the fraction of uninduced cell population (indicated by percentage) in the wild-type Pss and Xcc (mean GFP fluorescence intensity of < 120–300 A.U.), in the same fluorescence range as in the QS-deficient mutant controls, ΔahlI- PahlI::gfp and ΔrpfF-Peng::gfp. X-axis shows GFP fluorescence in log. Y-axis shows number of cells in each channel. For FACS analysis at each time point, at least 10 000 cells or events were analysed.

(bright) (Fig. 5A and B; Supporting information, Fig. S8). We also separated two distinct subpopulation of QS-r esponsive and non-responsive cells exhibiting bi-modal distribution (GFP+ and GFP−) from the cultures of QS−

mutants of Pss (PssBHSL) and Xcc (Xcc8523) grown in the presence of 3OC6-HSL and DSF respectively (Supporting information; Fig. S8, Table S4). The sorted cells were then cultured to obtain single colonies. Interestingly,

Fig. 3. Representative confocal laser scanning microscopy (CLSM) images of wild-type PssB728a-PahlI::gfp and Xcc 8004-Peng::gfp grown for 40 h. Cells were harvested after 40 h of growth, stained with propidium iodide (PI) and suspended in water, air dried and observed in a confocal microscope under 100×/1.4 oil DIC objective (LSM 510, META; Carl Zeiss, Germany). Confocal images for GFP (green), PI (red) and Differential interference contrast (DIC) were constructed simultaneously using a multitrack mode. The excitation maximum was at 488 nm (argon laser) and the emission maxima were observed in band pass (BP) 500 to 550 nm (for GFP fluorescence). For propidium iodide (red colour), the excitation maximum was 561 nm (DPSS laser – Diode Pumped Solid State laser) and emission maxima were observed in long pass (LP) 575. Approximately, 300 cells were analysed for bright and dark GFP fluorescence pattern. The images were analysed using the software Zeiss LSM image examiner (Carl Zeiss, Germany). © 2014 John Wiley & Sons Ltd, Molecular Microbiology, 92, 557–569

562 B. B. Pradhan and S. Chatterjee ■

Table 1. Confocal laser scanning microscopy (CLSM) analysis of uninduced (dark), induced (bright) and dead cells in wild-type Pss and Xcc strains harbouring the chromosomal-borne reporter fusions after 40 h of growth.

Strain

Bright cell (%)

Dark cells (%)

Dead cells (%)

Pss B728a-PahlI::gfp Xcc 8004-Peng::gfp

77.36 ± 4.5 74.4 ± 3.5

18.82 ± 5.6 21.9 ± 3.5

3.82 ± 1.2 3.61 ± 0.6

Wild-type Pss B728a-PahlI::gfp and Xcc 8004-Peng::gfp strains were grown for 40 h, cells were harvested and stained with propidium iodide (PI) and suspended in water, air dried and observed in a confocal microscope under 100×/1.4 oil DIC objective (LSM 510, META; Carl Zeiss, Germany). Confocal images for GFP (green), PI (red) and Differential interference contrast (DIC) were constructed simultaneously using a multitrack mode. The excitation maximum was at 488 nm (argon laser) and the emission maxima were observed in band pass (BP) 500 to 550 nm (for GFP fluorescence). For propidium iodide (Red), excitation maximum was 561 nm (DPSS laserDiode Pumped Solid State laser) and emission maxima were observed in long pass (LP) 575 nm. Approximately, 300 cells were analysed for bright and dark GFP fluorescence pattern and the average distribution of bright, dark and dead cells ± standard deviations from three independent experiments are indicated. The images were analysed using the software Zeiss LSM image examiner (Carl Zeiss, Germany).

the mean GFP fluorescence of cells derived from the progeny of sorted GFP+ and GFP− cells, which were derived either from the wild-type (PssB728a, Xcc8004) or from QS− (PssBHSL, Xcc8523) mutant strains, was similar to that of un related parental strains (Supporting information, Tables S4 and S5). To examine whether the colonies derived from GFP+ and GFP− cells exhibited heterogeneous distributions of dark and bright cells upon subculturing in fresh media, they were analysed by FACS. Analysis of GFP fluorescence intensity distribution of cells from the cultures of related GFP+ and GFP− cells indicated that irrespective of the origin of the progeny of cells [derived from either the QS-responsive (bright) or nonresponsive (dark) cells], they exhibited broad distribution of QS-responsive and non-responsive subpopulation (Fig. 5C; Supporting information, Table S6). That is, GFP− cells gave rise to progeny having a mixture of GFP+ and GFP− cells. We also did live cell time-lapse imaging of microcolonies to better determine the temporal stability of phenotypic heterogeneity in QS responses in wild-type Pss with and without the presence of exogenous 3OC6HSL supplementation (Supporting information, Supporting Movies S1–S5). Live cell imaging indicated that both individual GFP+ or GFP− cells can give rise to stochastically heterogeneous progeny having either a GFP+ or GFP− phenotype and this process occurred both in the presence and in the absence of exogenous 3OC6-HSL supplementation. These results indicated that the nongenetic heterogeneity of QS response is not linked to preexisting phenotypic heterogeneity.

It has been reported that QS positively regulate production of extracellular polysaccharide (both in Pss and in Xcc), endoglucanase (a secreted cell wall hydrolysing enzyme in Xcc) and negatively regulates swarming motility in Pss (Fig. 6A; Barber et al., 1997; Quiñones et al., 2005). To examine whether cultures derived from the progeny of QS-unresponsive (GFP−) cells recovered from either the wild-type (PssB728a; Xcc8004) or the QS− (PssBHSL; Xcc8523) strains are altered in QS-dependent traits, we performed quantitative assays for the production of extracellular polysaccharide, endoglucanase activity and swarming motility as appropriate (Supporting information; Table S5). All the derived strains exhibited QSdependent phenotypes similar to their respective parental strain (Supporting information, Tables S4 and S5). However, it is possible that they could be simply due to heterogeneity of plasmid copy number. In Pss, swarming motility is influenced by cell–cell signalling (Quiñones et al., 2005; Dulla and Lindow, 2008). It has been shown that QS negatively regulate swarming motility in Pss and promote production of extracellular polysaccharide, which is involved in biofilm formation (Quiñones et al., 2005). Since it is difficult to study QS response in individual cells when bacterial cells are embedded in a biofilm or are in close proximity in swarm colonies, we did swarm plate assay to see if we could observe any pattern of QS response (GFP expression) in swarm dendrites of Pss (Fig. 6B). In our swarm plate studies we observed a heterogeneous distribution of patches of GFP fluorescence intensities (indicative of variable QS responses) which appeared as bright and dark patches in the wild-type PssB728a with or without exogenous AHL supplementation (Fig. 6B). We also observed the swarm dendrites under phase contrast to see if the observed heterogeneity in GFP fluorescence intensity is due to difference in cell density or growth. Comparison of phase contrast images and GFP fluorescence intensities of the swarm dendrites indicated that the heterogeneity in GFP fluorescence intensity in different regions of the swarm dendrites may not be due to differential growth (Fig. 6B). A swarm colony is spatially heterogeneous, so difference in gene expression may well be due to environmental conditions such as nutrient availability or cell clustering (see Discussion).

Discussion An increasing body of research suggests that even in homogeneous environments, bacteria can exhibit cell-tocell phenotypic variability, termed as non-genetic individuality (Davidson and Surette, 2008; Jacob and Schultz, 2010). This is evident in chemotaxis driven motility (Spudich and Koshland, 1976), persistence in the presence of antibiotic (Balaban et al., 2004), bistability in gene © 2014 John Wiley & Sons Ltd, Molecular Microbiology, 92, 557–569

Individuality in bacterial quorum sensing 563

Fig. 4. QS response in wild-type PssB728a-PahlI::gfp and Xcc 8004-Peng::gfp grown in the presence of exogenous 3OC6-HSL and DSF supplementation. (A) PssB728a-PahlI::gfp, (B) Xcc 8004-Peng::gfp and (C) E. coli strain JB524 (QS-biosensor strain) harbouring the V. fisheries luxR and transcriptional fusion of GFP with luxI (AHL synthase promoter; PluxI:gfp). Strains harbouring the biosensors were inoculated at a density of 2 × 106 cells ml−1 from 12 h grown cultures in fresh media supplemented with or without exogenous 3OC6-HSL and DSF. At times indicated samples were taken and analysed for average whole-cell GFP fluorescence (GFP fluorescence intensity at Excitation-472 nm, Emission-512 nm), OD600. Percentage of cells indicate fraction of uninduced (dark; indicated by open bars) and induced (bright; indicated by closed bars) cells was determined by FACS analysis at times indicated by comparing the GFP fluorescence intensity distribution in the population of QS-biosensor strains PssB728a-PahlI::gfp, Xcc8004 Xcc 8004-Peng::gfp and E. coli strain JB524 with similarly grown ΔahlI- PahlI::gfp and ΔrpfF-Peng::gfp and E. coli strain JB524 control strains without any 3OC6-HSL and DSF supplementation. Per time point OD normalized average whole-cell GFP fluorescence (closed circles) is presented. Values presented are average from three independent experiments ± S.E. Similar trends were observed in several independent experiments. For FACS analysis at each time point, at least 10 000 cells or events were analysed.

expression (Novick and Weiner, 1957) and induction of natural competence (Su˝el et al., 2006). In this study we have shown that QS responses as heterogeneous in bacterial populations, with QS-responsive and lessresponsive cells coexisting even at high cell densities when all cells might have been expected to be in a QS state. We have also shown that the phenotypic heterogeneity in QS responses as a reversible and stochastic phenomenon as progeny of cells derived from either QS-responsive or non-responsive cells exhibited similar wide ranges of expression of genes indicating responsiveness to QS as the respective parental strains. Our results indicated that a significant percentage of wild-type cells of Pss and Xcc (18–25%) remained in a © 2014 John Wiley & Sons Ltd, Molecular Microbiology, 92, 557–569

QS-uninduced state even at high cell densities and in the presence of exogenously supplemented QS signal (Figs 2 and 4). Analysis of the distribution of GFP fluorescence intensity of cells from cultures of wild-type Xcc and Pss (Xcc8004; PssB728a) harbouring a constitutive nptII (kanamycin resistance) promoter fused to gfp cloned in respective plasmid backbone (pKAN1 and pKAN1; Table S1) revealed that nearly all of the cells (95 to 98%) exhibited expression of GFP fluorescence between 30 and 48 h of growth (Figs S9 and S10). Thus, the lack of expression of GFP fluorescence of Pss and Xcc in the presence QS signals appears to reflect an intrinsic blockage in some of the cells. The use of this positive control

564 B. B. Pradhan and S. Chatterjee ■

also circumvented questions that might arise regarding the formation and function of GFP under the culture conditions used, as well as contribution of stochastic noise in transcription. Our plasmid-borne results with the QS-heterogeneity studies reinforce conclusions drawn from chromosome-borne experiments. However, it is possible that they could be simply due to heterogeneity of plasmid copy number.

It has been reported that bi-stability in gene expression due to sub-saturating levels of inducers can yield phenotypic heterogeneity in various process, such as expression of the lac operon in E. coli and competence in Bacillus subtilis (Davidson and Surette, 2008; Jacob and Schultz, 2010). In V. harveyi, wild-type cells exhibited homogeneous QS response upon addition of autoinducer (Anetzberger et al., 2009). Previously it has been reported © 2014 John Wiley & Sons Ltd, Molecular Microbiology, 92, 557–569

Individuality in bacterial quorum sensing 565

Fig. 5. Sorting and analysis of heterogeneous QS-responsive and non-responsive cells. A. Side- and forward scatter plots (1 and 3) of cells of PssBHSL (QS−; control) and PssB728a (wild-type) harbouring the biosensor plasmid pBQ9 with the corresponding gates P1 after 40 h of growth. Scatter plots (2 and 4) shows side-scatter and GFP fluorescent intensity distribution pattern of all gated (P1) cells of PssBHSL (pBQ9) and PssB728a (pBQ9). The inner boundaries (box) P2 and P3 in the FACS scan represent the fluorescence channel boundaries (gates) that were set to sort the uninduced (GFP–) and induced (GFP+) cell population of the wild-type PssB728a. B. FACS histograms 1 and 2 shows distribution of the GFP fluorescence intensity of all analysed cells of the gate P1 for the control PssBHSL (pBQ9) and the wild-type PssB728a (pBQ9) respectively. Boxed area represents GFP− (dark; GFP fluorescence intensity of ∼ 800 A.U.) and GFP+ (GFP fluorescence intensity above 1000 A.U.) and heterogeneous distribution of dark and GFP-expressing cells in the wild-type PssB728a population. Histogram 3 shows the GFP fluorescence intensity distribution of separated subpopulation (indicated by inner boundaries or box) of GFP− cells ∼ 9 × 104 (gate P2) and GFP+ ∼ 2 × 105(gate P3) from the wild-type PssB728a population. Sorted cells were dilution plated in media supplemented with appropriate antibiotics to obtain single colonies. C. FACS histogram shows GFP fluorescence intensity distribution of all analysed cells from the colonies derived from the progeny of uninduced (GFP−; gate P2) and induced (GFP+; gate P3) sorted cells, after 40 h of growth. Five colonies each, representing progeny derived from sorted uninduced and induced cells of PssB728a were inoculated in fresh media at a density of ∼ 2 × 105 cells ml−1. For FACS analysis cells were harvested at different time point as described in Experimental procedures. The boxed area represents the fraction of uninduced cell population, in the same fluorescence range as in the QS− mutant control (PssBHSL) harbouring the biosensor plasmid pBQ9. X-axis shows GFP fluorescence in log. Y-axis shows number of cells in each channel.

that in Xcc and in Pss, DSF and AHL concentration as low as 10 μM and 1 μM could induce QS response and complement the phenotypes of the QS− mutants (He et al., 2006; Dulla and Lindow, 2008). In our dose response

experiments with the wild-type Pss and Xcc (Tables S2 and S3), we have used various saturating concentration of inducers (much higher than 10 μM) in the wild-type background, which is in addition to the endogenous proFig. 6. QS response on swarm plates. A. Sterile filter discs were inoculated with 1 × 107 cells of PssB728a (wild-type) and PssBHSL (QS−), with (2 and 4) or without (1 and 3) added exogenous 3OC6-HSL, after 20 h of growth at 28°C. B. Representative pictures of swarm dendrites of wild-type PssB728a harbouring the QS-responsive biosensor plasmid (pBQ9) grown on 0.4% soft agar swarm plates with and without added 3OC6-HSL. In majority of the swarm dendrites, GFP fluorescence is seen as bright and low intensity or dark (indicated by white arrows) patches. Bright spots, indicative of QS-induced state is seen in discrete patches within or end of the tendrils. GFP fluorescence was visualized using stereomicroscope (Zeiss Lumar). GFP was excited at 450–490 nm and the fluorescence collected in the range 500–550 nm (filter set 38 HE eGFP, Zeiss). Bar 2 mm.

© 2014 John Wiley & Sons Ltd, Molecular Microbiology, 92, 557–569

566 B. B. Pradhan and S. Chatterjee ■

duction by these strains. In contrast, our results showed that even addition of high amount of exogenous QS signals (20 μM AHL for Pss and 35 μM DSF for Xcc) to culture media did not significantly reduce the fraction of QS-unresponsive cells present in the populations (Fig. 4; Supporting information, Figs S5 and S6), indicating that the occurrence of uninduced cells in high cell density culture is not due to a limiting amount of QS signal in the system. This may be due to the fact that different bacterial species may generate phenotypic heterogeneity in QS responses by diverse strategies in a species-specific fashion. In future, it will be interesting to identify factors/ conditions contributing to species-specific phenotypic heterogeneity in QS response. Interestingly, an E. coli strain harbouring the Vibrio fischeri LuxR and gfp fused to the luxI promoter exhibited a homogenous response to the addition of exogenous AHL (Fig. 4C). We believe this is due to the fact that E. coli harbouring this heterologous system has not evolved mechanism to generate stochastic heterogeneity in the QS response unlike that in Pss and Xcc, where both QS and mechanism/s to generate inherent stochastic heterogeneity in the QS response have coevolved. It has been shown that bacterial persistence in the presence of antibiotics is linked to pre-existing phenotypic heterogeneity in the population since so-called persister cells exhibited slow growth that enabled them to escape the deleterious effect of the antibiotic. The surviving persister cells then give rise to progeny of cells exhibiting both susceptible and resistant (persister) sub-populations (Balaban et al., 2004). Our study showed that irrespective of the origin of progeny cells [derived from either the QS-responsive (bright) or non-responsive (dark) cells], all such derived cells yielded a wide range of responsive and non-responsive cells when propagated (Fig. 5C; Supporting information, Table S6, Movies S1–S5). This indicated that phenotypic heterogeneity in the QS response is an inherently reversible stochastic event, where both the QS-responsive and non-responsive cells can give rise to phenotypically heterogeneous subpopulation. It has been proposed that QS has evolved to co-ordinate the production of public goods so as to maximize the cost benefit for the population as a whole (Darch et al., 2012; Pai et al., 2012). We argue that since QS controls transition to different lifestyles which are also influenced by rapidly changing environmental conditions (for example transition between planktonic to biofilm and vice versa), it is advantageous to maintain some degree of phenotypic heterogeneity (outliers) in the population as a bet hedging strategy which ensures that at least some members of the community are well adapted to the new fluctuating environment. In Pss, QS-positively regulates production of extracellular polysaccharides and negatively regulates motility (Quiñones et al., 2005; Fig. 6A). Using a QS-biosensor

strain it was shown that Pss forms both small and large cellular aggregates (biofilms) on the host plant. These aggregates in turn exhibited varying degrees of QS induction that are also influenced by environmental conditions such as water availability (Dulla and Lindow, 2008). It is intriguing to think in that context the presence of phenotypically heterogeneous QS-responsive populations may facilitate an adaptive transition between the planktonic (motile) to biofilm (sessile) lifestyle and vice versa. As in this study, we have observed phenotypic heterogeneity in the QS response in planktonic cultures; we thought that it would be interesting to see if we could observe any heterogeneity pattern in QS response when bacterial cells are present in large community such as swarm colonies or in biofilm (social traits which are influenced by QS). In Pss, swarming (a social trait) is influenced by cell–cell signalling regulated (Quiñones et al., 2005; Dulla and Lindow, 2008). In our swarm plate studies we observed a heterogeneous distribution of patches of GFP fluorescence intensities (indicative of variable QS responses) which appeared as bright and dark patches in the wild-type PssB728a with or without exogenous AHL supplementation (Fig. 6B). It is possible that the pattern of differential fluorescence patches is caused by differences in thickness of the cell layers, nutrient limitation in specific areas, growth rate differences in specific areas, etc. In future it will be interesting to study the QS response of individual bacterial cells in a biofilm, swarm colonies and in natural habitat (in planta). Our results show that bacteria maintain stochastic reversible phenotypic heterogeneity during a widely conserved QS response that is involved in co-ordinating multiple social behaviours. In the future it should prove fruitful to study whether the inherent stochastic heterogeneity in QS responses plays a role in the adaptation of bacteria to fluctuating environmental conditions in their natural habitats. Strategies aimed at altering non-genetic phenotypic heterogeneity in cells undergoing QS responses may have implications for QS-interference mediated disease control.

Experimental procedures Bacterial strains and culture conditions To construct the chromosomal reporter fusion, PahlI::gfp and Peng::gfp cassettes were amplified from pBQ9 (Quiñones et al., 2004) and pKLN55 (Newman et al., 2004) by PCR using primer pairs: ahlI F XbaI-GCTCTAGACTGATCCTG GTGCGTGTGGGCATCGGCCAG, GFP R XhoI-GCCTCGA GTCATTTGTATAGTTCATCCATG (for PahlI::gfp) and pEng F XbaI-GCTCTAGATCACAAACGACGCGAACA, GFP R XhoIGCCTCGAGTCATTTGTATAGTTCATCCATG (for Peng::gfp). The amplified fragments were digested with XbaI and XhoI and cloned in pVO155 (chromosomal fusion reporter vector; Oke and Long, 1999). pVO155, containing the PahlI::gfp and © 2014 John Wiley & Sons Ltd, Molecular Microbiology, 92, 557–569

Individuality in bacterial quorum sensing 567

Peng::gfp cassettes were mobilized into wild-type Pss and Xcc and QS mutants ΔahlI and ΔrpfF by triparental mating. Single recombinants with chromosomal integration of pVO155 containing the PahlI::gfp and Peng::gfp cassettes were selected on kanamycin containing selection plates to obtain Pss B728aPahlI::gfp, Xcc 8004-Peng::gfp, ΔahlI-PahlI::gfp and ΔrpfFPeng::gfp strains. Insertion at the promoter region was confirmed by PCR and sequencing (data not shown). P. syringae pv. syringae (Pss) strains B728a (wild-type) (Loper and Lindow, 1987), BHSL (ahlI) (Kinscherf and Willis, 1999) and their derivatives harbouring either the AHL biosensor plasmid pBQ9 (PahlI:gfp; Quiñones et al., 2004) or a GFP expressing plasmid (pKAN1; Table S1) conferring constitutive GFP expression [nptII (kanamycin resistance) promoter fused to gfp)]were grown in King’s B medium (KB) or KB agar (King et al., 1954) at 28°C. X. campestris pv. campestris (Xcc) strains 8004 (wild-type), 8523 (DSF deficient rpfF mutant) harbouring the DSF biosensor plasmid PKLN55 (Peng:gfp) or a constitutive GFP expressing plasmid gfp (pKAN2, Table S1) were grown in Peptone Sucrose Agar (PSA) or in PS broth at 28°C as described previously (Newman et al., 2004). The E. coli AHL biosensor strain, JB524 harbouring the V. fischeri luxR and PluxI:gfpmut3* was grown in Luria–Bertani (LB) medium at 37°C (Wu et al., 2000). AHL and DSF used in this study were 3OC6-HSL and cis-11-methyl-2-dodecenoic acid (Sigma). AHL and DSF stock solutions were prepared in ethyl acetate and stored at −20°C. Stocks of 3OC6HSL and DSF were freshly diluted in appropriate media and used in growth and QS induction experiments. The concentrations of antibiotics used were: kanamycin, 50 μg ml−1; rifampin, 100 μg ml−1; spectinomycin, 20 μg ml−1; and tetracycline, 15 μg ml−1. Experimental cultures of different strains of Pss and Xcc harbouring the chromosomal-borne GFP reporter fusion were inoculated at a density of ∼ 2 × 106 cells ml−1 from 12 h grown cultures, in conical flasks containing 200 ml of appropriate media at time zero. For QS-signal supplementation experiments, appropriate concentration of AHL and DSF were added from the stocks. At various times culture aliquots were removed and analysed for average whole-cell GFP fluorescence in a fluorescence spectrophotometer (Excitation472 nm, Emission-512 nm) and was normalized for all measurements by determining cfu ml−1 by dilution plating, FACS analysis or microscopy.

FACS analysis and cell sorting At the times indicated, culture aliquots were removed and centrifuged at 5000 g for 12 min. Cell pellets were washed two times in phosphate-buffered saline (PBS) and in 1:10 diluted in PBS were analysed in a FACS cell sorter system. PBS containing bacterial cells was transferred to 5 ml roundbottom polystyrene tubes (BD FalconTM, Bedford, MA) and analysed with a Flow Cytometer (BD FACS AriaTM III, Becton Dickinson, San Jose, CA, USA). Forward and side-scatter (FSC and SSC respectively) were detected on a log scale with a threshold of 1000 on both parameters. GFP fluorescence was detected with a Blue laser (FITC-A, Excitation488 nm and Emission-530/30 nm). For Pss and Xcc strain harbouring the chromosomal-borne fusions (Pss B728aPahlI::gfp; Xcc 8004-Peng::gfp), photomultiplier (PMT) voltage was 400 for FSC, 460 for SSC and 700 for FITC-A (GFP © 2014 John Wiley & Sons Ltd, Molecular Microbiology, 92, 557–569

fluorescence). For Pss and Xcc strains harbouring the plasmid-borne reporter fusions, PMT voltage was 400 for FSC, 450 for SSC and 480 for FITC-A (GFP fluorescence). According to the FSC-A and SSC-A plots, gates were set more stringently to allow the sorting of single cells. Events shown in histograms of GFP and FITC-A were gated on both SSC and FSC. Approximately, 10 000 events were collected for each analysis. Uninduced cells were defined as those having fluorescence intensity of less than 800 A.U., similar to that of control QS− strains and cells having higher value were sorted as GFP+ and cells with a lower value as GFP−. Raw data were analysed by using software Flow Jo 7.6.4 (Tree Star, USA). For sorting FACSDiva Version 6.1.3 (BD Biosciences) data analysis software was used during sorting determination of efficiency of sorting. The subpopulation of GFP+ and GFP− cells obtained were collected separately in sterile Milli Q water and then immediately cultured in selection plates containing appropriate antibiotics to obtain single colonies. Colonies derived from the progeny of uninduced (GFP−) and induced (GFP+) cells were further analysed, at times indicated by FACS (described above) and assayed for whole-cell GFP florescence, extracellular polysaccharides (EPS), endoglucanase production and motility.

CLSM analysis Culture aliquots of Pss and Xcc strains harbouring the chromosomal-borne reporter fusion and biosensor plasmids were removed after 40 h of growth and centrifuged at 5000 g for 12 min. Harvested cells were then washed three times with PBS (pH 7.4) and resuspended in Milli Q water and stained with stained with propidium iodide (PI) [component-B (PI solution of LIVE/DEAD® BacLightTM Bacterial Viability Kits (L7012; Invitrogen)] as per manufacturer’s instructions. Samples were air dried and observed in a confocal microscope under 100×/1.4 oil DIC objective (LSM 510, META; Carl Zeiss, Germany). Confocal images for GFP (green), PI (red) and Differential interference contrast (DIC) were constructed simultaneously using a multitrack mode. For GFP fluorescence, the excitation maximum was at 488 nm (argon laser) and the emission maxima were observed in band pass (BP) 500 to 550 nm. For propidium iodide (Red), excitation maximum was 561 nm (DPSS laser-Diode Pumped Solid State laser) and emission maxima were observed in long pass (LP) 575 nm. For GFP fluorescence of Pss and Xcc strains harbouring the chromosome-borne GFP reporter fusion, pinhole was set to 1000 μm (6.51 Airy Unit) for channel 2 (FITC-GFP). For Pss and Xcc strains harbouring the plasmid borne GFP reporter, pinhole was set to 154 μm (1.01 Airy Unit) for channel 2 (FITC-GFP). For Propidium Iodide (Dead cells) in channel 3 Pinhole were used 172 μm (1 Airy Unit) for both plasmid and chromosomal-borne GFP reporter. Approximately 200 to 300 cells were analysed for bright and dark GFP fluorescence pattern (50 cell per field were observed and 10–15 fields were counted per sample). The images were analysed using the software Zeiss LSM image examiner (Carl Zeiss, Germany).

Fluorescence microscopy analysis Five to 10 μl of cell suspension in PBS was subsequently placed on glass slides and fixed by air drying, mounted with

568 B. B. Pradhan and S. Chatterjee ■

25% glycerol, and analysed using a Nikon Inverted fluorescence Microscope (Eclipse Model No. TI-DH; NIKON, Tokyo, Japan). The fluorescence of individual bacterial cells was quantified by analysis of digital images captured using epifluorescence microscopy. The intensities of all the pixels making up the image of a single cell were averaged to yield a mean pixel intensity per cell. Images were captured using a colour charge-coupled device (CCD) camera mounted on an Axiophot epifluorescence microscope equipped with a mercury excitation lamp. GFP fluorescence was detected with a GFP Endow filter set (excitation 470 ± 20 nm and emission 525 ± 25 nm). Two images were taken of each field of view through an ×100 objective. Cells were first visualized using phase-contrast optics to identify the number and location of cells in a given field. Approximately 50 cells per field were observed and 10–15 fields were counted per sample. Cells were then illuminated with blue light and then green fluorescence images were captured over a 10 s period. The captured digital images were saved in ND format using NISElements AR 3.1 software. The phase- contrast images were subjected to threshold filtering whereby all pixels brighter than a given threshold value were identified and grouped into objects that defined the location of a given cell analysed using ROI Statistics of Analysis Control in NIS- Elements AR 3.1 software, first selecting the shape and size of the area of cells from which fluorescence intensity would subsequently be measured. The mean pixel intensity of each cell was then transferred to Excel (Microsoft) and grouped into different mean pixel intensity.

Measurement of GFP fluorescence in bacterial cultures At the times indicated, culture aliquots were removed and centrifuged at 5000 g for 12 min (as described above). Cell pellets were washed and suspended in sterile MilliQ water. GFP fluorescence intensity (Excitation-472 nm, Emission512 nm) was measured using a VarioskanR Flash fluorescence spectrophotometer (Thermo Fisher Scientific; Vantaa, Finland). The Optical density at 600 nm (OD600) of bacterial cultures was measured using a UV/Visible spectrophotometer (Ultraspec 2100 pro; Cambridge, UK).

Motility, extracellular polysaccharide and endoglucanase assay The swarming motility of Pss strains B728a and BHSL was assessed on semisolid KB plates containing 0.4% agar (technical; Difco) with or without exogenous 3OC6-HSL supplementation, as in previous studies (Quiñones et al., 2005). The cells were grown overnight and then harvested and washed in potassium phosphate buffer (10 mM, pH 7.5) and resuspended. Approximately 1 × 107 cells of the appropriate bacterial strain was inoculated at the centre of the swarm plates or on sterile Whatman 3 MM filter disc and incubated at 28°C for 30 h. QS induction (GFP fluorescence) in the swarm dendrites of PssB728a and PssBHSL harbouring the biosensor plasmid pBQ9 was visualized using a stereomicroscope (Zeiss Lunar V12; Carl Zeiss Goettingen, Germany). GFP was excited at 450–490 nm and the fluorescence in the range of 500–550 nm (filter set 38 HE eGFP, Zeiss) was obtained.

To see growth of swarm dendrites on the plates, pictures were taken simultaneously using the GFP filter and with the phase contrast to visualize the growth pattern as well as the GFP fluorescence (indicative of induction of QS) in the swarm dendrites. The extracellular polysaccharides xanthan and alginate from Xcc and Pss cultures were isolated and quantified by standard protocols as described previously (Quiñones et al., 2005; Rai et al., 2012). Secreted endoglucanase activity was determined by measuring the size of clear zones in CMC-congo red plates as described previously (Rai et al., 2012).

Live cell imaging Wild-type Pss harbouring the QS-bioreporter (B728a/pBQ9) was grown with appropriate antibiotics in King’s B medium (KB) broth for 40 h as described above. Culture aliquots were removed and centrifuged at 5000 g for 12 min. Cell pellets were washed two times in PBS and finally suspended in sterile Milli Q water. Cells were dilution plated on sterile glass bottom cell culture dishes (Greiner Bio-one, Frickenhausen, Germany) containing a thin layer of KB agar without or with 20 μM 3OC6-HSL and viewed with a Nikon Inverted Microscope (Eclipse Model No. TI-DH; Tokyo, Japan). The fluorescence of individual bacterial cells cultured in KB medium was determined by analysis of digital images captured using epifluorescence microscopy. Images were captured in 10 min intervals using CCD camera mounted on an Axiophot epifluorescence microscope equipped with a mercury excitation lamp. GFP fluorescence was detected with a GFP Endow filter set fitted with excitation (470 ± 20 nm) and emission (525 ± 25 nm) filters through an 100× oil objective. Cells were then illuminated with blue light and green fluorescent images were captured over a 7 s period with a CCD camera. The captured digital images were saved in ND format using NISElements AR 3.1 software. The images were converted into movie format using ImageJ software (http://rsbweb.nih.gov/ ij/).

Statistical analysis P values were determined by an unpaired Student’s t-test (two-sample) assuming unequal variances using the of Microsoft office Excel data analysis tool. P < 0.05 was considered statistically significant.

Acknowledgements This study was supported by funding to S.C. from DBT, Government of India Basic research and IYBA grants and core funding from CDFD. We thank C. Balamaddileti and Vallentyne Joy Prashant for their help in FACS, confocal microscopy and live cell imaging. We thank S. West and S. Diggle for helpful comments.

Author contribution S.C. designed research; B.B.P. and S.C. performed research; B.B.P. contributed new reagent; S.C. and B.B.P. analysed data; and S.C. wrote paper. © 2014 John Wiley & Sons Ltd, Molecular Microbiology, 92, 557–569

Individuality in bacterial quorum sensing 569

References Anetzberger, C., Pirch, T., and Jung, K. (2009) Heterogeneity in quorum sensing-regulated bioluminescence of Vibrio harveyi. Mol Microbiol 73: 267–277. Balaban, N.Q., Merrin, J., Chait, R., Kowalik, L., and Leibler, S. (2004) Bacterial persistence as a phenotypic switch. Science 305: 1622–1625. Barber, C.E., Tang, J.L., Feng, J.X., Pan, M.Q., Wilson, T.J.G., Slater, H., et al. (1997) A novel regulatory system required for pathogenicity of Xanthomonas campestris is mediated by a small diffusible signal molecule. Mol Microbiol 24: 555–566. Chatterjee, S., Almeida, R.P.P., and Lindow, S.E. (2008) Living in two worlds: the plant and insect lifestyles of X. fastidosa. Annu Rev Phytopathol 46: 243–271. Dandekar, A.A., Chugani, S., and Greenberg, E.P. (2012) Bacterial quorum sensing and metabolic incentive to cooperate. Science 338: 264–266. Darch, S.E., West, S.A., Winzer, K., and Diggle, S.P. (2012) Density-dependent fitness benefits in quorum-sensing bacterial populations. Proc Natl Acad Sci USA 109: 8259–8263. Davidson, C.J., and Surette, M.G. (2008) Individuality in bacteria. Annu Rev Microbiol 42: 253–268. Deng, Y., Wu, J., Tao, F., and Zhang, L.H. (2011) Listening to a new language: DSF-based quorum sensing in gramnegative bacteria. Chem Rev 111: 160–173. Dulla, G., and Lindow, S.E. (2008) Quorum size of Pseudomonas syringae is small and dictated by water availability on the leaf surface. Proc Natl Acad Sci USA 105: 3082– 3087. Fuqua, C., Parsek, M.R., and Greenberg, E.P. (2001) Regulation of gene expression by cell–cell communication: acylhomoserine lactone quorum sensing. Annu Rev Genet 35: 4439–4468. Fuqua, W.C., Winans, S.C., and Greenberg, E.P. (1994) Quorum sensing in bacteria: the LuxR LuxI family of cell density-responsive transcriptional regulators. J Bacteriol 176: 269–275. Gardner, A., West, S.A., and Griffin, A.S. (2007) Is bacterial persistence a social trait? PLoS ONE 2: e752. doi: 10.1371/journal.pone.0000752 He, Y.W., Xu, M., Lin, K., Ng, Y.J., Wen, C.M., Wang, L.H., et al. (2006) Genome scale analysis of diffusible signal factor regulon in Xanthomonas campestris pv. campestris: identification of novel cell–cell communication-dependent genes and functions. Mol Microbiol 59: 610–622. Jacob, E.B., and Schultz, D. (2010) Bacteria determine fate by playing dice with controlled odds. Proc Natl Acad Sci USA 107: 13197–13198. King, E.O., Ward, M.K., and Raney, D.E. (1954) Two simple media for the demonstration of pyocyanin and fluorescein. J Lab Clin Med 44: 301–307. Kinscherf, T.G., and Willis, D.K. (1999) Swarming by Pseudomonas syringae B728a requires gacS (lemA) and gacA but not the acyl-homoserine lactone biosynthetic gene ahlI. J Bacteriol 181: 4133–4136. Long, T., Tu, K.C., Wang, Y., Mehta, P., Ong, N.P., Bassler, B.L., et al. (2009) Quantifying the integration of quorumsensing signals with single-cell resolution. PLoS Biol 7: e1000068. doi: 10.1371/journal.pbio.1000068 © 2014 John Wiley & Sons Ltd, Molecular Microbiology, 92, 557–569

Loper, J.E., and Lindow, S.E. (1987) Lack of evidence for in situ fluorescent pigment production by Pseudomonas syringae pv. syringae on bean leaf surfaces. Phytopathology 77: 1449–1454. Newman, K.L., Almeida, R.P.P., Purcell, A.H., and Lindow, S.E. (2004) Cell–cell signaling controls Xylella fastidiosa interactions with both insects and plants. Proc Natl Acad Sci USA 101: 1737–1742. Ng, W.-L., and Bassler, B.L. (2009) Bacterial quorum-sensing network architectures. Annu Rev Genet 43: 197–222. Novick, A., and Weiner, M. (1957) Enzyme induction as an all-or-none phenomenon. Proc Natl Acad Sci USA 43: 553–566. Oke, V., and Long, S.R. (1999) Bacterial genes induced within the nodule during the Rhizobium–legume symbiosis. Mol Microbiol 32: 837–849. Pai, A., Tanouchi, Y., and You, L. (2012) Optimally and robustness in quorum sensing (QS)-mediated regulation of a costly public good enzyme. Proc Natl Acad Sci USA 109: 19810–19815. Parsek, M.R., and Greenberg, E.P. (2005) Sociomicrobiology: the connections between quorum sensing and biofilms. Trends Microbiol 13: 27–33. Quiñones, B., Pujol, C.J., and Lindow, S.E. (2004) Regulation of AHL production and its contribution to epiphytic fitness in Pseudomonas syringae. Mol Plant Microbe Interact 17: 521–531. Quiñones, B., Dulla, G., and Lindow, S.E. (2005) Quorum sensing regulates exopolysaccharide production, motility, and virulence in Pseudomonas syringae. Mol Plant Microbe Interact 18: 682–693. Rai, R., Pradhan, B.B., Ranjan, M., and Chatterjee, S. (2012) Atypical regulation of virulence associated functions by a Diffusible Signal Factor in Xanthomonas oryzae pv. oryzae. Mol Plant Microbe Interact 25: 789–801. Sandoz, K.M., Mitzimberg, S.M., and Schuster, M. (2007) Social cheating in Pseudomonas aeruginosa quorum sensing. Proc Natl Acad Sci USA 104: 15876–15881. Spudich, J.L., and Koshland, D.E., Jr (1976) Non-genetic individuality: chance in the single cell. Nature 262: 467– 471. Su˝el, G.M., Garcia-Ojalvo, J., Liberman, L.M., and Elowitz, M.B. (2006) An excitable gene regulatory circuit induces transient cellular differentiation. Nature 440: 545–550. West, S.A., Winzer, K., Gardner, A., and Diggle, S.P. (2012) Quorum sensing and the confusion about diffusion. Trends Microbiol 20: 586–594. Williams, P., Winzer, K., Chan, W.C., and Cámara, M. (2007) Look who’s talking: communication and quorum sensing in the bacterial world. Philos Trans R Soc Lond B Biol Sci 362: 1119–1134. Wu, H., Song, Z., Hentzer, M., Andersen, J.B., Heydorn, A., Mathee, K., et al. (2000) Detection of N-acylhomoserine lactones in lung tissues of mice infected with Pseudomonas aeruginosa. Microbiology 146: 2481–2493.

Supporting information Additional supporting information may be found in the online version of this article at the publisher’s web-site.