rsob.royalsocietypublishing.org

RNA editing of microRNA prevents RNA-induced silencing complex recognition of target mRNA Yalei Cui†, Tianzhi Huang† and Xiaobo Zhang College of Life Sciences, Zhejiang University, Hangzhou 310058, People’s Republic of China

Research Cite this article: Cui Y, Huang T, Zhang X. 2015 RNA editing of microRNA prevents RNA-induced silencing complex recognition of target mRNA. Open Biol. 5: 150126. http://dx.doi.org/10.1098/rsob.150126

Received: 23 July 2015 Accepted: 17 November 2015

Subject Area: biochemistry/immunology/molecular biology Keywords: RNA editing, miRNA-induced silencing complex, virus latency, adenosine deaminase acting on RNA

Author for correspondence: Xiaobo Zhang e-mail: [email protected]

†

These authors contributed equally to this study.

MicroRNAs (miRNAs) integrate with Argonaut (Ago) to create the RNAinduced silencing complex, and regulate gene expression by silencing target mRNAs. RNA editing of miRNA may affect miRNA processing, assembly of the Ago complex and target mRNA binding. However, the function of edited miRNA, assembled within the Ago complex, has not been extensively investigated. In this study, sequence analysis of the Ago complex of Marsupenaeus japonicus shrimp infected with white spot syndrome virus (WSSV) revealed that host ADAR (adenosine deaminase acting on RNA) catalysed A-to-I RNA editing of a viral miRNA (WSSV-miR-N12) at the þ16 site. This editing of the non-seed sequence did not affect association of the edited miRNA with the Ago protein, but inhibited interaction between the miRNA and its target gene (wsv399). The WSSV early gene wsv399 inhibited WSSV infection. As a result, the RNA editing of miRNA caused virus latency. Our results highlight a novel example of miRNA editing in the miRNA-induced silencing complex.

1. Introduction Post-transcriptional mechanisms play important roles in the regulation of gene expression. RNA editing is one of the most important mechanisms of post-transcriptional genetic modification and generates a variety of cellular RNA signatures by base substitutions, insertions and deletions. The best characterized form of RNA editing found in mammals is base substitution of C to U (cytosine to uracil) and A to I (adenosine to inosine) [1]. The hydrolytic deamination of adenosine to inosine is catalysed by ADAR (adenosine deaminase acting on RNA) proteins [2]. A-to-I RNA editing is conserved from sea anemones to Homo sapiens and represents an irreversible RNA modification [3]. The targets of ADARs are double-stranded regions of at least 15 –20 base pairs [4], and following A-to-I RNA editing, the translational machinery recognizes inosine (I) as guanosine (G), producing different protein isoforms. The RNA editing involved in forming the coding region of the glutamate receptor subunit GluR-B is a well-known example [5]. Alternative ADAR2-mediated editing of GluR-B alters the gene-encoded glutamine (Q) codon CAG to the arginine (R) codon CIG, producing an ion channel that is impermeable to Ca2þ [5]. Additionally, RNA editing of the serotonin (5-HT) receptor 2C (5-HT2CR) affects its G-protein-binding affinity [6]. However, bioinformatic analyses report that the majority of A ! I RNA editing sites exist in noncoding sequences, 50 and 30 untranslated regions (UTRs), intronic retrotransposon elements and repetitive sequences [7–9], and the role of the RNA editing in these regions is largely unknown. MicroRNAs (miRNAs) also undergo RNA editing [10–12]. MiRNAs, generated from primary genome transcripts, integrate with Argonaut (Ago) to produce miRNA-induced silencing complexes (miRISC) that suppress expression of their target genes [13]. Mature miRNA ‘seed sequences’ recognize target sites in mRNA, and miRNAs predominantly target sequences in the 30 UTR of mRNAs. Binding of the miRISC can cause mRNA destabilization and/or

& 2015 The Authors. Published by the Royal Society under the terms of the Creative Commons Attribution License http://creativecommons.org/licenses/by/4.0/, which permits unrestricted use, provided the original author and source are credited.

2.1. Characterization of miRNAs and mRNAs in the Ago1 complex of shrimp in response to virus infection To investigate the miRNAs involved in antiviral immunity, shrimp were infected with WSSV, and the RNA contained within shrimp haemocyte Ago1 complexes was sequenced. We confirmed WSSV infection of shrimp (figure 1a), and co-immunoprecipitated the Ago1 complexes of infected haemocytes with an Ago1-specific antibody at 0, 24 and

2.2. Interactions between miRNAs and mRNAs in the Ago1 complex In order to evaluate the roles of these miRNAs, their mRNA targets were analysed. Approximately 40% of target RNA tags were aligned to 30 UTRs and 20% to coding sequences, while only 3 –4% were aligned to 50 UTRs (figure 2a). Both shrimp genes and WSSV genes were targeted by shrimp miRNAs and WSSV miRNAs (figure 2b). During virus infection, the number of shrimp transcripts targeted by WSSV miRNAs increased from 77 276 (24 h) to 90 835 (48 h) (figure 2b), and the number of WSSV transcripts

2

Open Biol. 5: 150126

2. Results

48 h post-infection. The RNAs (mRNA and miRNA) contained in these complexes were extracted and subjected to deep sequencing. For example, the RNAs extracted from the Ago1 complex of WSSV-infected haemocytes 24 h post-infection were illustrated in figure 1b. High-throughput small RNA sequencing yielded an average of 2 318 149 high-quality reads. Most small RNA reads were 20–25 nucleotides (nt) in length, which was typical for products generated by the enzyme Dicer (figure 1c). A total of 1 629 369 high-quality small RNA reads were mapped to known animal miRNAs or WSSV miRNAs, and 55 known shrimp miRNAs [26] and 45 known WSSV miRNAs [18,19] were identified (tables 1 and 2). The remaining nine candidate miRNAs, with no homologue, included seven shrimp putative miRNAs (mja-miR-27, mja-miR-28, mja-miR-29, mja-miR-30, mja-miR-31, mja-miR-32 and mjamiR-33) and two putative WSSV miRNAs (WSSV-miR-N50 and WSSV-miR-N51; tables 1 and 2). The WSSV miRNAs accumulated in shrimp at 24 and 48 h post-infection, and accounted for over 12% of the total small RNAs sequenced at 48 h post-infection (figure 1d). Some shrimp miRNAs were upregulated and some downregulated in response to virus infection, while viral miRNAs were detected only after WSSV infection (figure 1e). To confirm the involvement of these shrimp and viral miRNAs in WSSV infection, the expression of 11 randomly selected miRNAs was detected by northern blotting. The expression patterns of these miRNAs revealed by northern blots were similar to those revealed by sequencing (figure 1f ). To investigate potential target genes of shrimp and WSSV miRNAs, the mRNAs in the Ago1 complexes of shrimp haemocytes challenged with WSSV were sequenced at 0, 24 and 48 h post-infection. After removal of repetitive and low-quality reads, a total of 5.21 million high-quality reads were aligned to the assembled expressed sequence tags (ESTs) of shrimp or to the WSSV genome sequence. The results included 265 400 unigenes. Among them, only a small proportion (0.033%) of the reads originated from WSSV transcripts. Cluster analysis revealed that the pattern of mRNA expression changed throughout the time course of WSSV infection (figure 1g). In comparison to uninfected cells (0 h post-infection), 984 genes were significantly differentially expressed ( p , 0.01), of which 513 genes were upregulated and 471 were downregulated. To confirm the gene expression profiles of shrimp in response to WSSV infection, three genes were randomly selected for quantitative real-time PCR. The gene expression patterns revealed by quantitative real-time PCR were similar to those revealed by sequencing (figure 1h).

rsob.royalsocietypublishing.org

inhibition of translation [14,15]. RNA editing can shield miRNA from recognition and processing by Drosha and Dicer, and even alter the seed sequence, and thus mRNA target. A-to-I editing of the primary transcript of miR-142 shields this miRNA from processing by Drosha, reducing expression of mature miR-142 [12]. Editing of the fold-back double-stranded RNA (dsRNA) structure of primary miR151 inhibits its cleavage by Dicer, causing accumulation of edited pre-miR-151 intermediate RNA [16]. Editing of primary miR-376 at the þ4 and þ44 sites within the seed sequences of miRNA-376-5p and -3p strands alters the miRNA’s seed sequence, and thus mRNA target [11]. At present, however, the functional consequences of these miRNA editing processes remain unclear. As virus life cycles are short and can be completed within a single cell, a virus may represent a useful model in which to explore the mechanism of RNA editing. A-to-I RNA editing of viral mRNAs has been reported to be crucial for replication of hepatitis D virus (HDV) [17]. And although DNA viruses are reported to encode miRNAs [18,19], the role of viral miRNA editing in virus –host interactions has not been intensively explored. In this study, we characterized miRNA –mRNA interactions in Marsupenaeus japonicus shrimp haemocytes infected with white spot syndrome virus (WSSV). Based on the morphology and genomic composition, WSSV is assigned to a distinct virus family, Nimaviridae [20]. WSSV with 305-kb circular double-stranded genomic DNA has the capacity to encode 180 viral proteins and 89 viral miRNAs [18,19,21]. During WSSV infection, early genes, transcribed before 6 h post-infection, encode the viral regulatory proteins [22,23]. As reported, most of the WSSV miRNAs are transcribed at the early stage of virus infection [18,24]. The viral miRNAs regulate the expressions of the virus and/or host target genes in the WSSV –shrimp interactions [19,24,25]. In the present investigation, it was found that one viral miRNA (WSSV-miRNA-N12) underwent A-to-I RNA editing at its non-seed sequence, and this editing was dependent on the host ADAR. The edited miRNA no longer recognized its target gene, WSSV early gene wsv399, leading to accumulation of off-target miRNA in the Ago complex, thus preventing target gene silencing. At present, the function of wsv399 has not been characterized. The results of this study revealed that the silencing of wsv399 promoted the WSSV infection. In this context, the RNA editing of viral miRNA played an important role in viral latency. Thus, we have characterized a novel example of miRNA editing and miRNA –mRNA interactions in virus-infected animals.

x ple

(b) (i)

109 108 107 106 105 104 103 102 10 1

l go

-A ST

i-G

ant

kDa

200 bp

130 100

50 40

70

30

50

miRNA 20

24 h

48 h

(d) 0h 24 h 48 h

other small RNAs

100

WSSV miRNAs shrimp miRNAs

80 (%)

60 40 20

24

(ii)

0 h 24 h 48 h

miR-9 mja-miR-29 miR-305 miR-315 miR-5592 miR-30a miR-71 miR-33 miR-275 miR-745 miR-190 miR-306a miR-7 miR-122 miR-2a miR-320a miR-378a miR-92b mja-miR-31 miR-1 miR-184 miR-5112 miR-965 miR-3017b miR-let-7 mja-miR-32 miR-252 miR-5097 miR-981 miR-bantam miR-34 mja-miR-28 miR-10a miR-12 miR-279 miR-2001 miR-235 miR-750 miR-317 miR-995 miR-1000 mja-miR-33 mja-miR-27 mja-miR-30 miR-S7 miR-193 miR-278 miR-993 miR-133 miR-252b miR-8 miR-100 miR-263b miR-281 miR-263a miR-316 miR-2765 miR-2788 miR-S6 miR-276 miR-282 miR-S8

23

5.0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0 miss

0

25 0 h 24 h 48 h

WSSV-miR-N11 WSSV-miR-N29 WSSV-miR-N33 WSSV-miR-N30 WSSV-miR-N18 WSSV-miR-N37 WSSV-miR-N17 WSSV-miR-N49 WSSV-miR-N44 WSSV-miR-N13 WSSV-miR-105 WSSV-miR-N45 WSSV-miR-N16 WSSV-miR-N24 WSSV-miR-201 WSSV-miR-N26 WSSV-miR-N36 WSSV-miR-N23 WSSV-miR-N39 WSSV-miR-N41 WSSV-miR-N22 WSSV-miR-N40 WSSV-miR-110 WSSV-miR-180 WSSV-miR-195 WSSV-miR-214 WSSV-miR-N50 WSSV-miR-N12 WSSV-miR-N19 WSSV-miR-82 WSSV-miR-N7 WSSV-miR-134 WSSV-miR-N4 WSSV-miR-N5 WSSV-miR-N6 WSSV-miR-N8 WSSV-miR-N14 WSSV-miR-N20 WSSV-miR-N28 WSSV-miR-N34 WSSV-miR-N38 WSSV-miR-N46 WSSV-miR-N48 WSSV-miR-73 WSSV-miR-142 WSSV-miR-156 WSSV-miR-N51

24 h

0h

48 h

(f)

(g)

0 h 24 h 48 h miR-100

2.0 1.5 1.0 0.5 0 miss

miR-263a miR-281 miR-317 miR-S7

miR-2a miR-965 miR-122 WSSV-miR-N41

relative mRNA expression of nucleotide excision repair protein gene (%)

relative mRNA expression of stress-associated Ramp4 gene (%)

relative mRNA expression of phosphoglucosamine mutase gene (%)

120

160

140 120 100 80 60 40 20

140 120 100 80 60 40 20

0h

24 h

48 h

100 80 60 40 20 0

0

0

0 h 24 h 48 h

miR-1

180 160

1.15

miR-279

180

(h)

–1.15 0.01 0

22

1.1735556

21

2.3471112

20

0h

24 h

48 h

0h

24 h

48 h

Figure 1. Host and virus miRNAs and mRNAs in the Ago1 complex. (a) The copy number of WSSV genomic DNA in the haemocytes of virus-infected shrimp pre-infection (0), and 24 and 48 h post-infection was quantified using quantitative real-time PCR. (b) The Ago1 complex of virus-infected shrimp haemocytes was co-immunoprecipitated with Ago1-specific antibody. Then the complex was analysed by western blot analysis (i). The anti-GST antibody was used as a control. RNAs in the Ago1 complex were extracted (ii) and subjected to sequencing. M, protein marker or RNA marker. (c) Size distribution of small RNAs in the Ago1 complex pre-infection (0), and 24 and 48 h post-infection. (d ) Percentages of sequence reads of shrimp and viral miRNAs in the Ago1 complex of shrimp pre-infection (0), and 24 and 48 h post-infection. (e) The shrimp miRNA (i) and WSSV-miRNA (ii) expression profiles of WSSV-challenged shrimp pre-infection (0), and 24 and 48 h post-infection The numbers on the right indicated the log10 of the number of copies of miRNAs. (f ) Northern blots of selected shrimp and WSSV miRNAs. Total RNAs extracted from the Ago1 complexes of virus-free or WSSV-infected shrimp haemocytes were blotted with the DIG-labelled oligodeoxynucleotide probes pre-infection (0), and 24 and 48 h post-infection. (g) Heat map of differentially expressed shrimp and WSSV genes in the Ago1 complex of shrimp haemocytes. The shrimp were infected with WSSV. mRNAs in the Ago1 complex of shrimp haemocytes were sequenced pre-infection (0), and 24 and 48 h post-infection. The colours indicate the Z-values of genes. (h) Real-time PCR detection of gene expression profiles of shrimp in response to WSSV pre-infection (0), and 24 and 48 h post-infection.

Open Biol. 5: 150126

(i)

mRNA

100

0h

(e)

A RN

M

in

170

(c) 70 60 50 (%) 40 30 20 10 0

ST

(ii)

i-G

ant

3

om

lc

o Ag

rsob.royalsocietypublishing.org

WSSV copies

(a)

Table 1. Shrimp miRNAs in Ago1 complex.

4

length (nt)

references of reported microRNAs

miR-1

UGGAAUGUAAAGAAGUAUGGAG

22

Huang et al. [26]

miR-10a miR-100

UACCCUGUAGAUCCGAAUUUGU AACCCGUAGAUCCGAACUUGUG

22 22

Huang et al. [26] Huang et al. [26]

miR-1000 miR-12

AUAUUGUCCCGUCACAGCAGUA UGAGUAUUACAUCAGGUACUGGU

22 23

Huang et al. [26] Huang et al. [26]

miR-122 miR-133

GGAGUGUGACACUGGUGUUUG UUGGUCCCCUUCAACCAGCUGU

21 22

Huang et al. [26]

miR-184

UGGACGGAGAACUGAUAAGGGC

22

Huang et al. [26]

miR-190 miR-193

AGAUAUGUUUGAUAUUCUUGGUUG UACUGGCCUGCUAAGUCCCAA

24 21

Huang et al. [26] Huang et al. [26]

miR-2a miR-2001

UAUCACAGCCAGCUUUGAUGAGCG UUGUGACCGUUAUAAUGGGCA

24 21

Huang et al. [26] Huang et al. [26]

miR-235

UUGCACUUUCCCCGGCCU

18

miR-252 miR-252b

CUAAGUACUAGUGCCGCAGGAG CUAAGUAGUAGUGCCGCAGGUAA

22 23

Huang et al. [26] Huang et al. [26]

miR-263a miR-263b

AAUGGCACUGGAAGAAUUCACGG CUUGGCACUGGAAGAAUUCACAUAGU

23 26

Huang et al. [26]

miR-275 miR-276

UCAGGUACCUGAUGUAGCGCG UAGGAACUUCAUACCGUGCUCU

21 22

Huang et al. [26] Huang et al. [26]

miR-2765

UUAGUAACUCCACCACCGUUGG

22

miR-278 miR-2788

UCGGUGGGACUCUCGUCCGUUU CACUGCCCUUGGAAAUCCCAAA

22 22

Huang et al. [26]

miR-279 miR-281

UGACUAGAUCCACACUCAUCCA CUGUCAUGGAGUUGCUCUCUUU

22 22

Huang et al. [26] Huang et al. [26]

miR-282

UAGCCUCUCCUUGGCUUUGUCU

22

Huang et al. [26]

miR-30a miR-3017b

UGUAAACCUCCUCGACUGGAAGC GCACCGGACUGGCGGGGAA

23 19

miR-305 miR-306a

AUUGUACUUCAUCAGGUGCUCGG UCAGGUACUACGUGACUCUG

23 20

Huang et al. [26]

miR-315

UUUUGAUUGUUGCUCAGAAGG

21

Huang et al. [26]

miR-316 miR-317

UGUCUUUUUCUGCUUUGCUGCC UGAACACAGCUGGUGGUAUCUCAGU

22 25

Huang et al. [26]

miR-320a miR-33

AAGCUGGGUUGAGAGGGCGAAUA AUGCAUUGUAGUUGCAUUGCA

23 21

Huang et al. [26]

miR-34 miR-378a

UGGCAGUGUGGUUAGCUGGUUGU ACUGGACUUGGAGUCAGAAG

23 20

miR-5097

GUUCAGGUCCCUGUUUG

17

miR-5112 miR-5592

UGGGGUGUAGCUCAGUGG UUCCCGGUCGAUGCACCA

18 18

miR-7 miR-71

UGGAAGACUAGUGAUUUUGUUGUU UGAAAGACAUGGGUAGUGAGAU

24 22

miR-745

CAGCUGCCCAAUGAAGGGCUGU

22

miR-750 miR-8

CCAGAUCUAACUCUUCCAGCUCA UAAUACUGUCAGGUAAAGAUGUA

23 23

Huang et al. [26] Huang et al. [26]

miR-9 miR-92b

UCUUUGGUGAUCUAGCUGUAUGA AAUUGCACUAGUCCCGGCCUG

23 21

Huang et al. [26] Huang et al. [26]

Open Biol. 5: 150126

sequence (50 – 30 )

rsob.royalsocietypublishing.org

name

Huang et al. [26]

Huang et al. [26] Huang et al. [26]

(Continued.)

5

Table 1. (Continued.) length (nt)

references of reported microRNAs

miR-965

UAAGCGUAUGGCUUUUCCCCUC

22

Huang et al. [26]

miR-981

UUCGUUGUCGUCGAAACCUGCAU

23

Huang et al. [26]

miR-993 miR-995

GAAGCUCGUUUCUACAGGUAUCU UAGCACCACAGGAUUCAGC

23 19

Huang et al. [26]

miR-bantam miR-let-7

UGAGAUCAUUGUGAAAGCUGAUUAU UGAGGUAGUAGGUUGUAUAGUU

25 22

Huang et al. [26] Huang et al. [26]

mja-miR-27 mja-miR-28

AAGCGGGAAACCGCGCUGAGCUU CGCCCUCGGGUCGACGGA

23 18

mja-miR-29

AUACAAACAUGACUUCUAU

19

mja-miR-30 mja-miR-31

UCGCUCCGAGCUCGGACCCGACC GAGGGAGAAGGACUGGGCGAGGG

23 23

mja-miR-32 mja-miR-33

UGACUAGACUCUUACUCAUCUG UCGCUCCGAGCUCGGACCCGACC

22 23

miR-S6

AAUGGUCUAGUGAGGGCACCG

21

Huang et al. [26]

miR-S7 miR-S8

GCGGUAGCCCGGGCAAGA GUUGACCGAAGCGGAGGAG

18 19

Huang et al. [26] Huang et al. [26]

targeted exclusively by shrimp miRNAs increased from 62 (24 h) to 72 (48 h), while the number of WSSV transcripts targeted by WSSV miRNAs increased from 65 (24 h) to 79 (48 h) (figure 2b). Together, shrimp and WSSV miRNAs targeted 3038–4024 shrimp transcripts, and two WSSV genes (figure 2b). These findings suggested that both host and viral gene expression was regulated by shrimp miRNAs and/or WSSV miRNAs during virus infection. To investigate the functions and pathways of miRNA target genes, the coding sequences of Ago1 complex transcripts were analysed with the Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genome (KEGG). The GO analysis revealed that most identified genes were associated with membrane-enclosed lumen, organelles, macromolecular complexes and membranes, while many genes were involved in viral reproduction and immune system processes (figure 2c). The miRNA target genes were classified into 239 KEGG pathways. Some were involved in pathogen –host interactions, the NF-kB cascade, RNA interference, the Toll-like signalling pathway, the JAK –STAT cascade, the Wnt signalling pathway and the Notch signalling pathway (figure 2c). The 20 most highly expressed miRNAs targeted genes involved in host immunity including phagocytosis, endocytosis, virus –host interaction, apoptosis, autophagy, NF-kB and RNAi (figure 2d ). These data suggest that these miRNAs played important roles in immunity.

2.3. Viral miRNA editing mediated by host adenosine deaminase acting on RNA To further characterize these viral miRNAs, their sequences were compared to the WSSV genomic DNA sequence. Sequence analysis identified one A-to-G editing site in WSSV-miRNA-N12 (figure 3a). It was the only case of WSSV-miRNA editing based on sequence analysis. The sequencing data showed that the percentage of the edited

WSSV-miR-N12 accounted for 31% (24 h post-infection) and 5.8% (48 h post-infection) of the total WSSV-miRNA-N12 sequences. A-to-G editing is prevalent in human mRNAs. Analysis of the predicted hairpin structure revealed that the precursor of WSSV-miRNA-N12 could form a fold-back structure (figure 3b) which can be edited by ADAR, which catalyses A-to-I RNA editing in humans [4]. To investigate the mechanism of viral miRNA (WSSV-miRNA-N12) editing, the shrimp ADAR gene was cloned (GenBank accession no. AHK23065.1). The shrimp ADAR contained two dsRNAbinding domains and one dsRNA adenosine deaminase domain. Neighbour-joining phylogenetic tree analysis indicated that ADAR was highly conserved in animals (figure 3c). As previously reported, a primary miRNA or a precursor miRNA can be the substrate of ADAR –RNA editing [12,16]. To explore the involvement of shrimp ADAR in viral miRNA editing, a construct expressing the shrimp ADAR protein and a synthetic precursor of WSSV-miRNA-N12 were cotransfected into insect cells, then WSSV-miRNA-N12 was sequenced. Western blots revealed that ADAR was expressed differentially in insect cells (figure 3d). The total insect cell RNAs were extracted and the WSSV-miRNA-N12 precursor was cloned. Sequencing revealed that 17 of 120 clones isolated from cotransfected cells possessed copies of WSSVmiRNA-N12 that had undergone A-to-G RNA editing, while no edited WSSV-miRNA-N12 was detected in 60 clones isolated from cells transfected with WSSV-miRNA-N12 precursor alone (figure 3e). These findings indicated that the shrimp ADAR protein could edit viral miRNAs.

2.4. The role of viral miRNA editing in virus latency To explore the role of viral miRNA editing in viral replication, the time-course of expression of unedited and edited WSSVmiR-N12 s was investigated in more detail. Northern blotting

Open Biol. 5: 150126

sequence (50 – 30 )

rsob.royalsocietypublishing.org

name

Table 2. WSSV miRNAs in Ago1 complex.

6

length (nt)

references of reported microRNAs

WSSV-miR-N4

GGAGCAACAGUCGGUUCUGG

20

Huang et al. [19]

WSSV-miR-N5 WSSV-miR-N6

CACUUGGCGGUCAUCGUUUUGAA GAAACGACUGUUGCUCCAGAAAC

23 23

Huang et al. [19] Huang et al. [19]

WSSV-miR-N7 WSSV-miR-N8

GAUGAUGGAGAAGAAGCGACU GUAGUUGUAGAAUUAACAUCAUCCU

21 25

Huang et al. [19] Huang et al. [19]

WSSV-miR-N11 WSSV-miR-N12

AUCAAUUUCUUCCUCUUCUUCCU UUUUAUCGAGAGAAUGAGAAUA

23 22

Huang et al. [19] Huang et al. [19]

WSSV-miR-N13

ACAUGAUUGACGAUAGGUUGACU

23

Huang et al. [19]

WSSV-miR-N14 WSSV-miR-N16

GAGGAGGAGGAGGAUGAAGAA AUCCGAUGAGUAUGAUUUUGAUGAU

21 25

Huang et al. [19] Huang et al. [19]

WSSV-miR-N17 WSSV-miR-N18

CCUGAAAUGACUGCAGAUUUAUUG GAAGAAGAAUGGUCUCUAAGCA

24 22

Huang et al. [19] Huang et al. [19]

WSSV-miR-N19

GUGGGAGAAUCAUGUGUAUGGA

22

Huang et al. [19]

WSSV-miR-N20 WSSV-miR-N22

GUUGUCAAUCAUUGUAUUUUGUC GGGGCGUAAAAAGACUGUAGG

23 21

Huang et al. [19] Huang et al. [19]

WSSV-miR-N23 WSSV-miR-N24

GUGGUCUUAACGAAGGGCAUU GUAUGAGUAGUGAUGAAGAAUCA

21 23

Huang et al. [19] Huang et al. [19]

WSSV-miR-N26 WSSV-miR-N28

UAUUUGUCUUGGAAGUAACUU UUCGAGUGUCCGAAUAUUCGCGUC

21 24

Huang et al. [19] Huang et al. [19]

WSSV-miR-N29

AAGAGGACAAAAACACAGGGU

21

Huang et al. [19]

WSSV-miR-N30 WSSV-miR-N33

AUUGGCCUAGAUGACUCUGUAGAUU GACGUGCGAUAUUUCUGCCUU

25 21

Huang et al. [19] Huang et al. [19]

WSSV-miR-N34 WSSV-miR-N36

CACCGACGGCUUUUUUAAUGCA AGUUUCUGUAUUGACAGAUA

22 20

Huang et al. [19] Huang et al. [19]

WSSV-miR-N37

UUUAGAGCAAUUUCUCGCUCAG

22

Huang et al. [19]

WSSV-miR-N38 WSSV-miR-N39

UUAGUCGGUAUCGGAAUCAGUG UGAGGAUAGUGGACAUGUUGAA

22 22

Huang et al. [19] Huang et al. [19]

WSSV-miR-N40 WSSV-miR-N41

AUCGAGGAUGAACAUGCAAGACA GAAGAAAUUUGGGGUAGGCAUC

23 22

Huang et al. [19] Huang et al. [19]

WSSV-miR-N44

CGACGACGGAUCUUCUACAUC

21

Huang et al. [19]

WSSV-miR-N45 WSSV-miR-N46

GAGGACUUUCUAAGCAUGAGAAA AGUGCCAAGAUAACGGUUGAAG

23 22

Huang et al. [19] Huang et al. [19]

WSSV-miR-N48 WSSV-miR-N49

ACGAGGAGAUGGUUGGGGACU GUGAGAUUUGGUUUCAUGCCC

21 21

Huang et al. [19] Huang et al. [19]

WSSV-miR-73 WSSV-miR-82

UAGUAGUAAUAAGAAGAGGAAG CUCAGUAUUCCUGUUGUGUAUU

22 22

He et al. [18] He et al. [18]

WSSV-miR-105

CACAACAAGCACUCUCUCUCCU

22

He et al. [18]

WSSV-miR-110 WSSV-miR-134

CCUAAAAAAAUCACCGCCUAUU AACCAGAGUUCAUAAACAAGUU

22 22

He et al. [18] He et al. [18]

WSSV-miR-142 WSSV-miR-156

UGGUGAUUACAUCCUCUCUCCG UUUUAUGAUACCAUUAAGACAC

22 22

He et al. [18] He et al. [18]

WSSV-miR-180

CCAUAACAAUCAUCUUCAUCAU

22

He et al. [18]

WSSV-miR-195 WSSV-miR-201

AUAAAAACAAGUGGAAUAAUUU CGUUGUGCCGUCUCUGAAGAAC

22 22

He et al. [18] He et al. [18]

WSSV-miR-214 WSSV-miR-N50

AAGAAGAAGAAGAAGAAGAAUAU GAGCGCACCGAGCGUCUGAGGAA

22 23

He et al. [18]

WSSV-miR-N51

GAGGUUGGCAGAUUCGGCUGCU

22

Open Biol. 5: 150126

sequence (50 – 30 )

rsob.royalsocietypublishing.org

name

(b)

no. shrimp genes

100 80 60 (%)

40 20 0

0h

24 h

48 h

genes targeted by shrimp miRNA and WSSV miRNA genes targeted by WSSV miRNA genes targeted by shrimp miRNA

200 000 180 000 160 000 140 000 120 000 100 000 80 000 60 000 40 000 20 000 0

0h

24 h

48 h

170 160 150 140 130 120 110 100 90 80 70 60 50 40 30 20 10 0

genes targeted by shrimp miRNA and WSSV miRNA genes targeted by WSSV miRNA genes targeted by shrimp miRNA

0h

24 h

48 h

molecular function

0.04

0.08

0.12

metabolic process developmental process cell killing viral reproduction death regulation of molecular function rhythmic process biological regulation regulation of biological process cellular process localization positive regulation of biological process positive regulation of molecular function cell proliferation cellular component organization or biogenesis growth response to stimulus carbon utilization reproductive process negative regulation of biological process multicellular organismal process immune system process multi-organism process reproduction negative regulation of molecular function pigmentation biological adhesion locomotion signalling establishment of localization organelle cell junction virion extracellular matrix macromolecular complex extracellular matrix part membrane virion part cell membrane-enclosed lumen cell part synapse synapse part organelle part extracellular region part membrane part extracellular region receptor activity nucleic acid binding transcription factor activity binding morphogen activity molecular transducer activity catalytic activity enzyme regulator activity nutrient reservoir activity translation regulator activity protein binding transcription factor activity transporter activity channel regulator activity receptor regulator activity metallochaperone activity protein tag structural molecule activity electron carrier activity antioxidant activity

0

no. unigenes 10 20 30

40

0

40

80

apoptosis telomerase activity JAK-STAT cascade autophagy toll-like signalling pathway RNA interference NF-kB cascade notch signalling pathway virus-host interaction viron binding response to virus viron attachment viron transport defence response to virus innate immune response

KEGG analysis

DNA repair heat shock protein binding Wnt signalling pathway integrin signalling pathway RNA processing

GO analysis

cellular component

biological process

0

Open Biol. 5: 150126

percentage of unigenes

(c)

120

no. unigenes

(d) 0

0

0.5 0.01

miR-965 miR-7 miR-71 miR-263b miR-745 miR-263a miR-8 miR-315 miR-276 miR-let7 miR-317 miR-100 miR-1 miR-281 miR-N16 miR-S8 miR-2a miR-S7 miR-279 miR-122

1

7

rsob.royalsocietypublishing.org

others non-coding RNAs 5´-untranslated region 3´-untranslated region coding sequence

no. WSSV genes

(a)

1.0 phagocytosis endocytosis lysosome actin filament organization virus–host interaction response to virus siRNA binding RNA processing apoptosis regulation of autophage regulation of transcription protein polymerization rRNA processing Wnt receptor signalling pathway integrin-mediated signalling pathway telomerase activity JAK–STAT cascade retinal binding Notch signalling pathway sulfonylurea receptor binding NF-kB cascade

Figure 2. Interactions between miRNAs and mRNAs in Ago1 complex of shrimp. (a) Distribution of target RNA-annotated clusters across transcripts from Ago1 complex of virus-free and virus-infected shrimp pre-infection (0), and 24 and 48 h post-infection. The numbers indicated the time points of virus infection. (b) Numbers of genes targeted by host and virus miRNAs detected at 0, 24 and 48 h post-infection. (c) Function and pathway analyses of genes targeted by miRNAs. GO was performed by comparing the coding sequences of the transcripts in the Ago1 complex with the GO database with the blast E-value of less than 1  1025. KEGG classifications of the genes were simultaneously characterized. (d ) Heat map generated from GO analysis of transcripts targeted by the top 20 miRNAs with high expression level. Tree showed the hierarchical clustering of miRNAs based on GO analysis. The colours indicated the significant differences between clusters.

(a)

WSSV genomic DNA

...cacat

8

aagt...

rsob.royalsocietypublishing.org

WSSV-miR-N12

(b)

5´ 3´

82

hsa-ADAR

(d)

mmu-ADAR gga-ADAR

100

xtr-ADAR dre-ADAR mja-ADAR

ADAR 70

ame-ADAR

99 95

kDa 100

dme-ADAR

100

M

zne-ADAR cel-ADAR

b-actin

40

0.1

(e)

precursor of WSSV-miR-N12

the unedited type

the edited type

Figure 3. Viral miRNA editing mediated by host adenosine deaminase acting on RNA (ADAR). (a) Comparison of WSSV-miR-N12 mature sequence with the WSSV genomic DNA sequence. The editing site was coloured. (b) The predicted hairpin structure of WSSV-miRNA-N12 precursor using MFOLD software (http://frontend. bioinfo.rpi.edu/applications/mfold/). Red indicates the mature sequence of WSSV-miRNA-N12. Green indicates the potential A-to-I editing site. (c) Neighbour-joining phylogenetic tree analysis of ADAR proteins of vertebrates and invertebrates. Bootstrap values are shown. The bar represents the distance. hsa, Homo sapiens; mmu, Mus musculus; xtr, Xenopus (Silurana) tropicalis; gga, Gallus gallus; dre, Danio rerio; dme, Drosophila melanogaster; ame, Apis mellifera; cel, Caenorhabditis elegans; zne, Zootermopsis nevadensis. (d ) Western blot analysis of the expressed shrimp ADAR protein in insect cells. The plasmid expressing the V5-ADAR fusion protein and the synthetic WSSV-miRNA-N12 precursor were cotransfected into insect cells. The synthetic WSSV-miRNA-N12 precursor alone was included in the transfection as a control. The expression of shrimp ADAR was detected by the V5 antibody. M, protein marker. (e) The involvement of shrimp ADAR in the RNA editing of viral miRNA. The total RNAs were extracted from insect cells transfected with the plasmid expressing the shrimp ADAR protein and/or the synthetic WSSVmiRNA-N12 precursor. Then the precursor of WSSV-miRNA-N12 was cloned and sequenced. The positions of the edited site and the unedited site are indicated with arrows. indicated that both the unedited and edited WSSVmiR-N12 s were detected in WSSV-infected shrimp at 6 h post-infection (figure 4a), suggesting that this viral miRNA was expressed and the miRNA editing occurred at the early

stage of WSSV infection. The results showed that the frequency of viral miRNA editing increased before 18 h post-infection and decreased after 24 h post-infection (figure 4a). To evaluate the effects of this miRNA on WSSV

Open Biol. 5: 150126

100 80

r so ur ec pr 12 -N e iR on m al VSS r W so ur ec pr 12 -N AR iR D m A V- + SS W

(c)

9

0 h 6 h 12 h 18 h 24 h 36 h 48 h unedited WSSV-miR-N12 edited WSSV-miR-N12 U6

rsob.royalsocietypublishing.org

(a)

percentage of edited and unedited WSSV-miR-N12 (%)

percentage of unedited WSSV-miR-N12 percentage of edited WSSV-miR-N12

100 80 60 40 20 0

0 h 12 h 24 h 36 h 48 h WSSV + AMO-WSSV-miR-N12

12 h 18 h 24 h 36 h time post-infection

48 h

unedited WSSV-miR-N12

WSSV alone WSSV + AMO-WSSV-miR-N12 edited WSSV-miR-N12 WSSV alone U6

(d )

(c) WSSV alone WSSV + AMO-WSSV-miR-N12 WSSV + AMO-WSSV-miR-N12-scrambled *

109

120

shrimp mortality (%)

100

108 ** WSSV copies

WSSV alone WSSV + AMO-WSSV-miR-N12 WSSV + AMO-WSSV-miR-N12-scrambled

107 ** 106

*

105

80 60

*

40 **

20

**

*

104

0 0h

10 24 h

12 h

36 h

(e)

48 h

12 h 24 h 36 h 48 h 72 h 96 h 120 h time post-infection

0 h 12 h 24 h 36 h 48 h WSSV + unedited WSSV-miR-N12 unedited WSSV-miR-N12 WSSV alone WSSV + edited WSSV-miR-N12 edited WSSV-miR-N12 WSSV alone U6

(f)

(g) WSSV alone WSSV + unedited WSSV-miR-N12 WSSV + edited WSSV-miR-N12 WSSV + WSSV-miR-N12-mimic-scrambled

*

108

** **

107 WSSV copies

100 shrimp mortality (%)

109

106

WSSV alone WSSV + unedited WSSV-miR-N12 WSSV + edited WSSV-miR-N12 WSSV + WSSV-miR-N12-mimic-scrambled

**

105

* 80

**

60 ** 40 ** 20

104 0 0h 10 12 h

Figure 4. (Caption overleaf.)

24 h

36 h

48 h

12 h 24 h 36 h 48 h 72 h 96 h 120 h time post-infection

Open Biol. 5: 150126

6h

0h

(b)

2.5. The mechanism of viral miRNA editing in the miRNA-induced silencing complex To investigate the mechanism of viral miRNA editing in the miRISC, WSSV-miR-N12 target genes were predicted. The prediction results indicated that the WSSV wsv399 gene could be targeted by WSSV-miR-N12 (figure 5a). To evaluate the direct interaction between WSSV-miR-N12 and wsv399, the EGFP gene and the 30 UTR of the wsv399 gene or its mutant were cloned, generating the EGFP-wsv399-30 UTR construct and the EGFP-wsv399-30 UTR-mutation construct (figure 5b). Co-transfection of WSSV-miR-N12 mimic and the EGFP-wsv399-30 UTR or EGFP-wsv399-30 UTR-mutation revealed that the fluorescence intensity of insect cells cotransfected with WSSV-miR-N12 and EGFP-wsv399-30 UTR was significantly weaker than that of controls (figure 5c), indicating that WSSV-miR-N12 directly targeted the wsv399 gene. To illustrate the effect of viral miRNA editing on the direct interaction of viral miRNA with its target gene, the edited WSSV-miR-N12 and the EGFP-wsv399-30 UTR were cotransfected into insect cells. We found that the wsv399 gene was

not targeted by the edited WSSV-miR-N12 (figure 5d), indicating that the base change at the miRNA þ16 site inhibited target mRNA recognition. To explore the capacity of unedited or edited WSSVmiR-N12 to be loaded onto the host Ago1 protein during the assembly of miRISC, the viral miRNA was incubated with the shrimp Ago1 protein. Electrophoretic mobility shift assay (EMSA) results revealed that both the unedited and edited WSSV-miRNA-N12 bound the Ago1 protein (figure 5e), and the base change at the miRNA þ16 site did not inhibit assembly of the miRISC. To further investigate the interaction between viral miRNA and its target gene in the miRISC, the 30 UTR of the wsv399 gene and the unedited or edited WSSV-miRNA-N12 were incubated with Ago1 protein. EMSA data revealed that the wsv399 30 UTR interacted with the unedited WSSV-miRNA-N12, but not the edited WSSV-miRNA-N12 (figure 5f ), confirming that the RNA editing of viral miRNA inhibited miRISC target recognition. In order to characterize the role of the wsv399 gene in WSSV infection, expression of wsv399 was measured in virus-infected shrimp. Northern blots also revealed that wsv399 mRNA was detected at 6 h post-infection (figure 5g), indicating that wsv399 was transcribed during the early stage of infection. Expression of wsv399 was silenced by injection of the sequence-specific siRNA (wsv399-siRNA) into WSSV-infected shrimp (figure 5h), which caused significantly more copies of the virus to be produced than in shrimp injected with WSSV alone or WSSVþwsv399-siRNAscrambled (figure 5i). Knockdown of wsv399 expression also significantly increased mortality of WSSV-infected shrimp (figure 5j ). These data illustrate that expression of the wsv399 gene negatively regulates WSSV infection in shrimp. To refine the mechanism of virus replication control by wsv399/WSSV-miR-N12/ADAR, the ADAR expression in virus-free and WSSV-challenged shrimp was characterized. The quantitative real-time PCR data indicated that ADAR was upregulated in shrimp before 18 h post-infection and downregulated after 24 h post-infection (figure 5k), which was in accordance with the editing frequency of WSSVmiR-N12 (figure 4g). The results showed that the wsv399 mRNA level was upregulated in shrimp treated with WSSV and edited WSSV-miR-N12 at the early stage of WSSV infection and subsequently downregulated (figure 5l ), which was consistent with that in shrimp treated with WSSV alone (figure 5l ). When the WSSV-infected shrimp were treated with the unedited WSSV-miR-N12, the wsv399 mRNA level decreased (figure 5l ). These results demonstrated that the

Open Biol. 5: 150126

replication in shrimp, its expression was silenced using antimiRNA oligonucleotide (AMO)-WSSV-miR-N12 (figure 4b). Silencing of WSSV-miR-N12 expression significantly reduced WSSV copy number (figure 4c) and significantly decreased shrimp mortality (figure 4d ), indicating that expression of WSSV-miR-N12 contributed to viral replication. To investigate the influence of viral miRNA editing on virus infection, the edited and unedited WSSV-miR-N12 were overexpressed in shrimp, which were then infected with WSSV. Northern blotting confirmed that the edited and unedited WSSV-miR-N12 were overexpressed in shrimp (figure 4e). Significantly more copies of the WSSV genome were detected in shrimp in which unedited WSSVmiR-N12 was overexpressed than shrimp infected with WSSV alone. However, the number of copies of the WSSV genome detected in shrimp in which edited WSSVmiR-N12 was overexpressed did not differ significantly from shrimp infected with WSSV alone (figure 4f ), indicating that WSSV-miR-N12 promotes WSSV infection and that WSSV-miR-N12 editing could cause WSSV latency in shrimp. Shrimp mortality analysis generated similar results (figure 4g). These findings suggest that A-to-I editing of viral miRNA (WSSV-miR-N12) could reduce viral replication in the shrimp, and cause virus latency.

10

rsob.royalsocietypublishing.org

Figure 4. (Overleaf.) The role of viral miRNA editing in virus latency. (a) Viral miRNA detected in shrimp infected with WSSV. The expressions of edited and unedited WSSV-miR-N12 were examined by northern blot pre-infection (0 h), and post-infection (6, 12, 18, 24, 36 and 48 h). The percentages of edited and unedited viral miRNA were evaluated. (b) The silencing of viral miRNA expression. The expression of WSSV-miR-N12 in WSSV-infected shrimp was silenced by AMO-WSSV-miR-N12. The silencing was examined by northern blot pre-infection (0), and 12, 24, 36 and 48 h post-infection. U6 was used as a control. (c) Effects of WSSV-miR-N12 on the WSSV replication in shrimp. Shrimp were simultaneously injected with WSSV and AMO-WSSV-miR-N12. WSSV alone and AMO-WSSV-miR-N12-scrambled were used as controls. The shrimp were subjected to real-time PCR to detect the WSSV copies 12, 24, 36 and 48 h post-infection. The numbers indicated the time points postinfection. (d ) Cumulative mortalities of WSSV-challenged shrimp after the injection of AMO-WSSV-miR-N12. Each point represented the mean of triplicate assays. (e) The overexpression of viral miRNA. The edited and unedited WSSV-miR-N12 mimics were co-injected with WSSV into shrimp, respectively. Edited and unedited WSSV-miR-N12 were detected pre-infection (0), and 12, 24, 36 and 48 h post-infection by northern blots. U6 was used as a control. (f ) The shrimp were simultaneously injected with WSSV and the unedited or edited WSSV-miR-N12, and the WSSV copies in shrimp were monitored by quantitative real-time PCR at 12, 24, 36 and 48 h post-infection (g) The accumulative mortalities of WSSV-infected shrimp treated with the unedited or edited WSSV-miR-N12 were monitored 1 – 5 days post-infection. All the assays were repeated three times (*p , 0.05; **p , 0.01).

EGFP

(a)

coding region

(b)

3´ UTR

SacI pIZ

EGFP

XbaI

11

SacI

wsv399 3´

target 5´

5´

WSSV-miR-N12 3´

...3´ ...3´

EGFP-wsv399-3¢UTR 5´... EGFP-wsv399-3¢UTR-mutation 5´...

(c) EGFP-wsv399-3´UTR -mutation

relative fluorescence intensity (%)

EGFP-wsv399-3´UTR

EGFP

WSSV-miR-N12 mimic

WSSV-miR-N12-mimic-scrambled

120

WSSV-miR-N12 mimic WSSV-miR-N12-mimic-scrambled

100

**

80 60 40 20

EGFP EGFP-wsv399-3¢UTR

EGFP-wsv399-3¢UTR -mutation

relative fluorescence intensity (%)

EGFP

edited WSSV-miR-N12 mimic

WSSV-miR-N12-mimic-scrambled

EGFP-wsv399-3´UTR EGFP-wsv399-3´UTR-mutation

edited WSSV-miR-N12 mimic WSSV-miR-N12-mimic-scrambled

120 100 80 60 40 20 0

EGFP

EGFP-wsv399-3´UTR EGFP-wsv399-3´UTR-mutation

(e)

edited WSSV-miR-N12 bound with Ago1

unedited WSSV-miR-N12 bound with Ago1

free unedited WSSV-miR-N12

free edited WSSV-miR-N12

ethidium bromide

ethidium bromide Ago1

Ago1 Coomassie

Coomassie

(f) unedited WSSV-miR-N12 and wsv399 3´UTR bound with Ago1 edited WSSV-miR-N12 bound with Ago1 free wsv399 3´UTR

free wsv399 3´UTR

free edited WSSV-miR-N12

free unedited WSSV-miR-N12

ethidium bromide

ethidium bromide

Ago1

Ago1 Coomassie

Coomassie

0 h 12 h 24 h 36 h 48 h

(g)

0h

6h

12 h

(h)

24 h

wsv399-siRNA wsv399

wsv399

WSSV alone

actin

actin

(i)

WSSV alone WSSV + wsv399-siRNA WSSV + wsv399-siRNA-scrambled

( j)

WSSV alone WSSV + wsv399-siRNA WSSV + wsv399-siRNA-scrambled

109 shrimp mortality (%)

WSSV copies

100

**

108 **

107 ** 105 106 104

* 80

** **

60 **

40 20

101

0 12 h

24 h

36 h

48 h

0h

(k)

(l)

12 h 24 h 36 h 48 h 72 h 96 h 120 h time post-infection WSSV alone WSSV + unedited WSSV-miR-N12 WSSV + edited WSSV-miR-N12

600 relative mRNA expression of wsv399 gene (%)

relative mRNA expression of ADAR gene (%)

700

500 400 300 200 100

**

600 **

**

400 200

** *

0

0 0h

Figure 5. (Caption overleaf.)

**

800

6h

12 h 18 h 24 h time post-infection

36 h

48 h

0h

6h

12 h 18 h 24 h time post-infection

36 h

48 h

Open Biol. 5: 150126

0

(d )

rsob.royalsocietypublishing.org

EGFP

pIZ

XbaI SacII

3. Discussion Virus replication, one of the most key steps in the virus life cycle, is elaborately regulated by virus. During the virus replication process, miRNAs are required [19,24,25]. In this investigation, the results revealed that the RNA editing of viral miRNA played an important role in the virus replication, showing the elaborate mechanism of virus replication regulated by miRNA. miRNAs have been reported to influence both virus replication and pathogenicity, and host innate antiviral immune responses [27]. Studying the regulation of miRNA expression, including RNA editing of miRNA, can further reveal the function of miRNA. A-to-I RNA editing, catalysed by the ADAR enzyme, can generate RNA diversity post-transcriptionally [28,29]. Our study indicated that a viral miRNA, WSSV-miR-N12, underwent A-to-I RNA editing at the þ16 site, and that RNA editing of WSSV-miR-N12 influenced virus latency. WSSV-miR-N12 could promote virus replication by targeting the WSSV early gene, wsv399. The role of wsv399 in the WSSV – shrimp interaction has not been identified. Our study revealed that wsv399 expression inhibited the WSSV infection. Although the edited WSSV-miR-N12 bound Ago just like the unedited WSSV-miR-N12, the edited WSSV-miRN12-coupled Ago could not interact with the target gene wsv399. As a result, WSSV-miR-N12 editing at the early stage of virus infection promoted the expression of viral wsv399 gene, leading to the inhibition of WSSV replication and subsequently affecting virus latency. In this context,

our study presented a novel aspect of viral miRNA editing which could act as a mechanism to promote virus latency. miRNAs, loaded into the miRISC, are thought to target multiple mRNAs, affecting the translation or stability of several target genes [30]. Although computer algorithms that constrain searches for mRNA sites complementary to the miRNA ‘seed’ region to the 30 UTR of mRNA can identify potential matches, accurately predicting the mRNA target of miRNAs remains difficult [31,32]. Different computer algorithms generate divergent target sets with high false-positive rates, and usually contradict one another [33,34]. Recently, miRNA overexpression or knockdown studies have beenombined with proteome analysis to identify miRNA targets [31,35]. However, these studies have identified a relatively small number of proteins, and the results of miRNA overexpression or knockdown studies do not distinguish between primary miRNA effects and secondary effects. Also, it is known that not all miRNAs load onto Ago proteins and bind target genes. Therefore, it has become important to use a combination of target identification methods to reveal the spectrum of miRNA targets. With an aim to understand the role of miRNAs in virus –host interactions, in this study we characterized the miRNAs and mRNAs loaded into the Ago complex of WSSV-infected shrimp haemocytes. Many miRNAs and their target genes were identified based on the miRNA –mRNA interactions facilitated by the Ago complex. Therefore, we presented an efficient strategy for the comprehensive analysis of miRNA-mediated regulation of gene expression in virus –host interactions. Our findings reveal that while A-to-I editing of WSSV-miR-N12 did not affect binding to shrimp Ago, edited WSSV-miR-N12 could not recognize the target gene via A : U Watson –Crick pairing. The change to G : U pairing at the þ16 site weakened the interaction between miRNA and its target gene. Previous studies have reported that even a single G : U base-pair change in the seed region can reduce the efficiency of target recognition, and miRNA 30 pairing with the target favours contiguous Watson – Crick pairs

Open Biol. 5: 150126

virus could exploit the host ADAR to edit the viral miRNA, leading to increase of viral wsv399 gene expression and further inhibition of the WSSV replication at the early stage of virus infection. Taken together, the findings revealed that RNA editing of viral miRNA induced virus latency by preventing miRISC recognition of mRNA (figure 6).

12

rsob.royalsocietypublishing.org

Figure 5. (Overleaf.) The mechanism of viral miRNA editing in virus infection. (a) The region of the viral gene wsv399 30 UTR targeted by WSSV-miR-N12. The seed sequence of WSSV-miR-N12 is underlined. (b) Constructs of EGFP-wsv399-30 UTR and EGFP-wsv399-30 UTR-mutation. The sequence targeted by WSSV-miR-N12 is underlined. (c) Direct interaction between WSSV-miR-N12 and wsv399 gene in insect cells. Insect High Five cells were cotransfected with the WSSV-miR-N12 mimic or WSSV-miR-N12-mimic-scrambled and EGFP, EGFP-wsv399-30 UTR or EGFP-wsv399-30 UTR-mutation. At 36 h after cotransfection, the fluorescence of cells was examined. (d ) The interaction between the edited WSSV-miR-N12 and wsv399 gene in insect cells. Insect High Five cells were cotransfected with the edited WSSV-miR-N12 mimic and EGFP-wsv399-30 UTR. WSSV-miR-N12-mimic-scrambled, EGFP and EGFP-wsv399-30 UTR-mutation were used as controls. At 36 h after cotransfection, the fluorescence of cells was evaluated. (e) The interaction between edited or unedited viral miRNA and host Ago1 protein. The unedited or edited WSSV-miRNA-N12 was incubated with recombinant shrimp Ago1 protein, then separated by native polyacrylamide gel and stained with ethidium bromide to visualize the miRNA (top), followed by staining with Coomassie blue (bottom). The wedges indicated the concentration gradient of recombinant protein used. ( f ) The interaction between viral miRNA and its target gene in the miRISC. The unedited or edited WSSV-miRNA-N12 and the 30 UTR of the wsv399 gene were incubated with shrimp Ago1 protein. Subsequently, the mixture was separated by agarose gel and stained with ethidium bromide to show the miRNA and target gene, followed by staining with Coomassie blue (bottom). The wedges indicate concentrations of recombinant protein used. (g) Northern blot analysis of expression profiles of the wsv399 gene in WSSV-infected shrimp. The shrimp were challenged with WSSV. Numbers indicated the time points post-infection. Shrimp b-actin was used as a control. (h) Silencing of wsv399 expression in WSSV-infected shrimp. The wsv399-siRNA and WSSV was co-injected into WSSVinfected shrimp. Then the shrimp haemolymph was subjected to northern blot analysis to detect the expression level of the wsv399 gene. Numbers indicate the time points post-infection. Shrimp b-actin was used as a control. (i) Effect of wsv399 gene silencing on WSSV copies in shrimp. The shrimp were simultaneously injected with WSSV and wsv399-siRNA, followed by detections of virus copies with quantitative real-time PCR. As controls, WSSV alone and wsv-399-siRNAscrambled were included in the injections. ( j ) Accumulative mortalities of WSSV-infected shrimp. At different times post-infection, the accumulative mortalities of shrimp were monitored daily. Numbers showed the time points post-infection. (k) The detection of ADAR expression in virus-challenged shrimp. Shrimp were infected with WSSV. At different times post-infection, the ADAR mRNA level was evaluated with quantitative real-time PCR. (l ) The examination of wsv399 expression. The wsv399 mRNA in shrimp treated with WSSV and unedited or edited WSSV-miR-N12 was quantified with quantitative real-time PCR. In all panels, the statistically significant differences between treatments were represented with asterisks (*p , 0.05; **p , 0.01).

plasma membrane

13

wsv399

WSSV genome n

tio

ip cr

ns

WSSV-miR-N12 precursor

RN A

ed iti ng

Ago1 Dicer wsv399 mRNA unedited WSSV-miR-N12

tra

Ago1

ADAR host genome

edited WSSV-miR-N12

Figure 6. The model for the role of ADAR-mediated RNA editing of viral miRNA in virus – host interaction. uninterrupted by wobbles, bulges or other mismatches at 12– 17 sites [36,37]. Our findings reveal a novel regulatory aspect of miRNA editing in the miRNA –target interaction. The mechanism merits further study.

4. Material and methods 4.1. Shrimp culture and white spot syndrome virus infection Marsupenaeus japonicus shrimp (about 15 g each) were reared in groups of 20 individuals in air-pumped circulating seawater at 258C. Then three shrimp were randomly chosen for the WSSV detection using PCR with the WSSV-specific primers (50 -TTGGTTTCATGCCCGAGATT-30 and 50 -CCTT GGTCAGCCCC TTGA-30 ). Virus-free shrimp were infected with WSSV as previously described [26]. Before infection, and 24 and 48 h post-infection, shrimp haemocytes were collected. WSSV copies were quantified by quantitative real-time PCR, as previously described [26].

4.2. Recombinant expression of shrimp Ago1 in Escherichia coli and antibody preparation The Ago1 gene of M. japonicus was amplified with primers 50 AAGGATCCATGTACCCTGTC GGGCAGCCACC-30 (BamHI, underlined) and 50 -AACTCGAGTTAAGCAAAGTACATGACT CT GTTCGT-30 (XhoI, underlined) and cloned into the pGEX4T-2 vector downstream of glutathione S-transferase (GST). Gene expression and protein purification were achieved by following the manufacturer’s protocols (Amersham Biosciences, USA). Purified GST or GST2Ago1 proteins were used as antigen to immunize mice to prepare antibody. Antiserum titres were evaluated by enzyme-linked immunosorbent assay, the immunoglobulin fraction was purified with protein A–Sepharose (Bio-Rad, USA) and antibody specificity was evaluated by western blot.

4.3. Co-immunoprecipitation of shrimp Ago1 Shrimp haemocytes were collected and UV (ultraviolet) irradiated at 254 nm, then lysed in lysis buffer (20 mM Tris –Cl, 1 mM EDTA, 150 mM NaCl, 1% Triton X-100, pH 7.5). The

cross-linked lysate was treated with 15 ml of RNAsin (Promega, USA) and incubated on ice for 10 min, then 30 ml of RQ1 DNAse was added (Promega). After 5 min at 378C the Ago1 –RNA complex was immunoprecipitated using the polyclonal antibody against GST or GST2Ago1 for 16 h at 48C, followed by incubation with protein A–Sepharose (GE Healthcare, USA) for 30 min at 48C. After washing in lysis buffer, the Ago1 –RNA complex was eluted with elution buffer (50 mM glycine, pH 2.8) and subjected to western blot. RNAs (including mRNA and miRNA) were extracted from the complex using a mirVanaPTMP miRNA isolation kit according to the manufacturer’s instructions (Ambion, USA). After separation on a 15% polyacrylamide –8 M urea gel, RNAs of 16– 30 nt and RNAs of more than 100 nt were recovered, using the RNA gel extraction kit (Takara, Japan) for sequencing.

4.4. Western blot Protein samples were analysed on a 10% SDS-PAGE gel and transferred onto a nitrocellulose membrane (Bio-Rad, USA). The membrane was immersed in blocking buffer (3% bovine serum albumin (BSA)) at 48C overnight, followed by incubation with anti-GST or anti-GST –Ago1 antibody. Then the membrane was incubated in AP-conjugated goat antimouse IgG (Sigma, USA) for 1 h and binding was visualized with NBT and BCIP solutions (BBI, Canada).

4.5. Sequencing and sequence analysis of Ago1-associated RNAs Small RNAs and longer RNAs were sequenced with a GA-I genome analyser (Illumina, San Diego, CA, USA) according to the manufacturer’s protocols. Small RNAs were also analysed by searching the ACGT V3.1 program developed by LC Sciences (Houston, TX, USA). After the removal of adaptor sequences, mRNA, rRNA, tRNA, snRNA, snoRNA and other non-coding RNA sequences available in Rfam (http://www.sanger.ac.uk/software/Rfam), the high-quality sequences were compared with known animal miRNAs in miRBase 19.0 and the known WSSV miRNAs, as previously described [18,19,26]. The miRNAs with no homologue were further analysed using BLASTN against the shrimp EST database (National Center for Biotechnology Information,

Open Biol. 5: 150126

virus latency

Dicer

rsob.royalsocietypublishing.org

virus latency WSSV infection

Total RNAs were extracted from the Ago1 complex of shrimp haemocytes using a mirVanaPTMP miRNA isolation kit according to the manufacturer’s instructions (Ambion, USA). The NanoDrop ND-100 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) was used to determine the concentration of the extracted RNAs. Total RNAs (5 mg) were separated on a denaturing 15% polyacrylamide gel containing 8 M urea. Then the separated RNA was transferred to a Hybond-Nþ membrane (Amersham Biosciences, Buckinghamshire, UK). The membrane was washed with DIG Easy Hyb granules buffer (Roche, Basel, Switzerland) for 0.5 h at 428C after cross-linking by UV irradiation and subsequently hybridized with a DIG-labelled DNA probe of a miRNA for 20 h at 428C. To identify the unedited and edited WSSV-miR-N12, locked nucleic acid (LNA)-modified oligonucleotide probes were used in northern blot [38]. The LNA-modified oligonucleotide probes (unedited WSSVmiR-N12, 50 -DIG-TATTCTTATTCTCTCGATAA-30 ; edited WSSV-miR-N12, 50 -DIG-TATTCTCATTCTCTC GATAA-30 ) were modified with LNA at the fifth and seventh bases. RNAs were detected according to the DIG High Prime DNA Labeling and Detection Starter Kit II manual (Roche). To evaluate the frequency of viral miRNA editing, the quantities of unedited and edited viral miRNA were obtained using IMAGE PROPLUS 6.0 software. The percentage of the frequency of viral miRNA editing was examined.

4.7. Quantitative real-time PCR To quantify WSSV virions in shrimp, the WSSV genome was extracted from virus-infected shrimp haemocytes using a TIANmp Genomic DNA kit (Tiangen Biotech Co. Ltd, Beijing, China) according to the manufacturer’s protocols, and then 150 ng of genomic DNA was subjected to quantitative real-time PCR. The primers were 50 -CCACCAATTCTACT CATGTACCAAA-30 and 50 -TCCTTGCAATGGGCAAAATC30 . The TaqMan probe was 50 -FAM-CTGGGTTACGAGTCT AA-TAMRA-30 . A linearized plasmid containing a 1400-bp DNA fragment from the WSSV genome was quantified and serially diluted 10-fold as an internal standard for real-time PCR. The PCR mixture contained 5 ml of Premix Ex Taq (Takara, Japan), 0.5 ml of extracted DNA template or the internal standard plasmid, 0.2 ml of 10 mM primers and 0.15 ml of 10 mM TaqMan fluorogenic probes. PCR was carried out at 958C for 1 min followed by 45 cycles at 958C for 15 s, 528C for 30 s and 728C for 30 s.

4.8. Prediction of genes targeted by microRNAs miRNA target genes were predicted by employing the transcriptome sequence of the shrimp Ago1 complex using two independent computational algorithms, including TargetScan 5.1 (http://www.targetscan.org) and miRanda (http://www.microrna.org/). Based on the sequence analysis of the transcriptome sequencing data of the shrimp Ago1 complex, the shrimp genes and WSSV genes in the Ago1 complex were obtained and used for the prediction of genes targeted by miRNAs. TargetScan was used to search for miRNA seed matches (nucleotides 2– 8 from the 50 -end of miRNA), while miRanda was used to match the entire miRNA sequence with the parameters free energy less than 220 kcal mol21 and score greater than 50. Finally, the data predicted by both algorithms were combined and overlaps were calculated.

4.9. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes Analysis GO analysis was performed as previously described [26]. Briefly, the coding sequences of transcripts retrieved from the Ago1 complex were extracted and used as queries to search the protein sequences collected in the GO database with the blast E-value of less than 1  1025 [39]. The best hit GO identities were assigned to the transcripts. Then the

14

Open Biol. 5: 150126

4.6. Northern blot

The coding sequences of Ago1 complex transcripts were predicted using GLIMMER3 software, developed by LC Sciences (Houston, USA). To assess the expressions of mRNAs, three genes encoding phosphoglucosamine mutase, stress-associated Ramp4 and nucleotide excision repair protein were selected at random and 150 ng of extracted RNA from the Ago1 complex was subjected to quantitative real-time PCR. Shrimp b-actin was used as a standard control to calculate the expression level of a gene. The primers and TaqMan probes were synthesized ( phosphoglucosamine mutase gene, primers 50 -GGTCTTCTTCGATGAACAA-30 and 50 GGGAATATTGTGACGAGTG-30 , TaqMan probe 50 -FAMTCATTCTTAGCGCCTGCGA CA-30 -Eclipse; stress-associated Ramp4 gene, primers 50 -ACCAGGAAATGAAACTCA-30 and 50 -CCGGCAATATTGAACATC-30 , TaqMan probe 50 -FAM AGCCGACTACGACGAACAAGAA-30 -Eclipse; nucleotide excision repair protein gene, primers 50 -GACCAGCACTAACTA TTATG-30 and 50 -CCTCTTAATAGTAA CATATTGAATC-30 , TaqMan probe 50 -FAM-AACACCTATGCTG CCACTCCT-30 Eclipse; b-actin gene, primers 50 -CGAGCACGGCATCGTTACTA-30 and 50 -TTGTAGAAAGTGTGATG CCAGATCT-30 , TaqMan probe 50 -FAM-CTGGGACGACATGGA-30 -Eclipse). Reactions were prepared in a total volume of 10 ml containing 5 ml Premix Ex Taq (Takara, Japan), 0.5 ml cDNA template, 0.2 ml 10 mM primers and 0.15 ml 10 mM TaqMan fluorogenic probes. PCR was carried out at 958C for 1 min followed by 40 cycles at 958C for 15 s, 528C for 45 s, and 728C for 45 s. The expression level of wsv399 mRNA or ADAR mRNA was examined using quantitative real-time PCR with wsv399-specific primers (50 -TGAGCACTGACGACCATACGAGA-30 and 50 -T GGAGGTGAACAGGGAAGGAGAA-30 ) or ADAR-specific primers (50 -GACAGCCCTGTACAT ATG30 and 50 -CTGACAACATCCAAACTTG-30 ). Shrimp b-actin was used as a control.

rsob.royalsocietypublishing.org

http://www.ncbi.nlm.nih.gov) and the WSSV genome sequence (GenBank accession no. AF332093.1), allowing one or two mismatches between each pair of sequences. Hairpin structure of novel miRNA candidates was predicted using MFOLD online software (http://frontend.bioinfo.rpi.edu/ applications/mfold/) with default parameters. The longer RNAs were analysed using TRINITY software and the Illumina paired end method developed by LC Sciences (Houston, USA). After the removal of repetitive and low-quality reads, the remaining high-quality reads were aligned to the shrimp assembled ESTs in the National Center for Biotechnology Information (as the M. japonicus genome was not listed) or to the WSSV genome (GenBank accession no. AF332093.1).

4.10. Analysis of white spot syndrome virus-miR-N12 RNA editing site

4.11. Cloning and sequence analysis of shrimp adenosine deaminase acting on RNA gene Total RNAs were extracted from shrimp haemocytes using a mirVanaPTMP miRNA isolation kit according to the manufacturer’s instructions (Ambion, USA). The first-strand cDNA template was synthesized using Prime Script 1st Strand cDNA Synthesis Kit (Takara, Japan). Rapid amplification of cDNA ends (RACEs) was performed for the full-length ADAR gene sequence using a 50 /30 RACE kit (Roche, USA). The full-length sequence of shrimp ADAR gene was obtained and deposited in GenBank (accession no. AHK23065.1). The ADAR domains were analysed using the SMART program (http://smartembl-heidelberg.de/). Neighbour-joining phylogenetic tree analysis of ADAR proteins was performed with the MEGA5.1 program. The GenBank accession numbers of the ADAR proteins were indicated as follows: Xenopus (Silurana) tropicalis, XP_002943575.2; Gallus gallus, XP_001232162.2; Danio rerio, NP_571671.1; Drosophila melanogaster, NP_001245476.1; Apis mellifera, NP_001091684.1; Homo sapiens, NP_056656.2; Mus musculus, CAJ18531.1; Caenorhabditis elegans, AAC25097.1; Zootermopsis nevadensis, KDR24469.1. Bootstrap analysis was conducted for 1000 replicates to define the confidence of tree branch positions.

4.12. Identification of white spot syndrome virus-miRN12 RNA editing site in insect cells The shrimp ADAR gene was cloned into a pIZ/V5-His vector (Invitrogen, USA) using primers 50 -ATCGAATTCGCCACCATGGATTCCGAGTCTAT-30 and 50 -AGGCCGCGG GATATAAAAACTGTCTTC-30 to express the V5-ADAR fusion protein. The WSSV-miR-N12 precursor was cloned from the WSSV genome using the in vitro Transcription T7 Kit (Takara, Japan) with specific primers (50 -GATCACAC TAAGGATATAA-30 and 50 -CGCCACTAATACGACTC ACTATAGGGGATGCGTGGGTTTGCACA-30 ). The purified RNAs were folded in the folding buffer as previously described [40]. Subsequently different quantities (0, 5 and 12 mg) of plasmid expressing V5-ADAR and the synthesized WSSV-miR-N12 precursor were cotransfected into insect High Five cells (3  105 ml21) (Invitrogen) and cultured at 278C in Express Five serum-free medium (SFM) (Invitrogen) containing L-glutamine (Invitrogen). Two days later, the

4.13. The silencing and overexpression of white spot syndrome virus-miR-N12 in shrimp To evaluate the effects of WSSV-miR-N12 on virus infection, the expression of WSSV-miR-N12 was knocked down in shrimp by injection of AMO. AMO-WSSV-miR-N12 (50 -ATTCTCTCGATAAAA-30 ) targeting WSSV-miR-N12 was synthesized (Sangon Biotech, Shanghai, China) with a phosphorothioate backbone and a 20 -O-methyl modification at the 6th and 12th nucleotides. The sequence of AMO-WSSV-miR-N12 was randomly scrambled generating AMO-WSSV-miR-N12scrambled (50 -TATTCTGTCTAATAG-30 ) as a control. Subsequently, 10 nM of AMOs was co-injected with WSSV (105 copies ml21) into virus-free shrimp (100 ml per shrimp). In order to explore the role of WSSV-miR-N12 editing in virus infection, the unedited WSSV-miR-N12 (50 -UUU UAUCGAGAGAAUAAGAAUAUU-30 and 50 -UAUUCUUA UUCUCUCGAUAAAAUU-30 ) and the edited WSSV-miRN12 (50 -UUUAUCGAGAGAAUGAGAAUAUU-30 and 50 UAUUCUCAUUCUCUCGAUAAAAUU-30 ) were synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China), generating WSSV-miR-N12 mimics. Virus-free shrimp were injected with 30 nM of the unedited or edited WSSV-miR-N12 mimic in addition to WSSV (105 copies ml21). The sequence of WSSV-miR-N12 mimic was randomly scrambled to yield WSSV-miR-N12-mimic-scrambled (50 -UUCUCCGAACGUGU CACGUTT-30 and 50 -ACGUGACACGUUCGGAGAATT-30 ) as a control. WSSV (105 virus copies ml – 1) was used as a positive control. At different time points (0, 6, 12, 24, 36, 48 h) after the injection of AMOs or mimics, the shrimp haemolymph was collected and subjected to northern blotting.

4.14. Shrimp mortality assay To analyse the shrimp mortality, 20 shrimp were collected from each experimental condition in three independent experiments. Shrimp were injected with AMOs (10 nM) or mimics (30 nM). WSSV (105 virus copies ml21) was used as a positive control. Shrimp mortality was monitored daily over a 5-day period.

4.15. The direct interaction between white spot syndrome virus-miR-N12 and its target gene wsv399 To explore the direct interaction between WSSV-miR-N12 and its target gene wsv399, the enhanced green fluorescent protein (EGFP) gene was cloned into a pIZ/V5-His vector (Invitrogen) with EGFP-specific primers (50 -AAGAGCTCGGATCCCCGGG TAC-30 and 50 -AATCTAGAGTCGCGGCCGCTTTA-30 ). To generate the EGFP-wsv399-30 UTR (30 untranslated region) construct, the 30 UTR of wsv399 gene was cloned into the pIZ/ V5-His vector downstream of EGFP gene using sequencespecific primers (50 -GCATCTAGAAATGCCTGGATAAT C-30 and 50 -ATACCGCGGGTTTCCATGATGTGT-30 ). The sequence of wsv399 30 UTR was randomly mutated by PCR with sequence-specific primers (50 -AGGTTCACTAGTTTGCGAUC

15

Open Biol. 5: 150126

The sequence of mature WSSV-miR-N12 was aligned with the WSSV genomic DNA sequence using DNAMAN. The hairpin structure of WSSV-miRNA-N12 was predicted using MFOLD (http://frontend.bioinfo.rpi.edu/applications/ mfold/) with the default parameters.

cells were collected and subjected to western blot analysis and RNA sequencing.

rsob.royalsocietypublishing.org

hypergeometric test statistic was used to calculate the overrepresentation of particular functions or categories in the miRNA targets predicted by TargetScan 5.1. The p-values were corrected for false discovery rate. Deduced genes with homologues in other organisms were used to map to conserved biological pathways using the 239 KEGG.

The recombinant glutathione S-transferases (GST)-Ago1 was purified. To investigate the ability of WSSV-miRNA-N12 to load onto shrimp Ago1 protein, 40 mM of the unedited or edited WSSV-miRNA-N12 was incubated with 12.5, 25, 50 or 100 mM Ago1 protein. Unedited or edited WSSVmiRNA-N12 was synthesized by Shanghai GenePharma Co. Ltd. (Shanghai, China). After incubation in the reaction buffer (0.1 M KCl, 1 mM DTT, 1 mM MgCl2, 10 mM HEPES, pH 7.6) for 30 min at 378C, the mixture was separated on a 5% native polyacrylamide gel at 120 V for 1 h. Then the RNA bands were stained by ethidium bromide and subsequently the proteins were stained with Coomassie blue. To illustrate the interaction between the viral miRNA and its target gene in the miRISC, 40 mM of the unedited or edited WSSV-miRNA-N12 and the 30 UTR of wsv399 gene were incubated with shrimp Ago1 protein. The 30 UTR of wsv399 was cloned with primers 50 -TAATACGACTCACTATAGGGAAT GCCTGGATAATC-30 and 50 -GTAAACTGTTTCCATGAT GTG-30 . Then the 30 UTR of wsv399 was synthesized using

4.17. Synthesis of siRNAs and RNAi assay in shrimp Small interfering RNAs (siRNAs) specifically targeting the wsv399 gene were synthesized using an in vitro T7 transcription kit for siRNA synthesis (TaKaRa, Japan) according to the manufacturer’s instructions. The wsv399-siRNA sequence was 50 -CCGACCTAGATATCTGGATACGACA-30 . As a control, the sequence of wsv399-siRNA was scrambled, generating wsv399-siRNA-scrambled (50 -ATTCATGCTCCGGACATCC 0 GATGAC-3 ). The synthesized siRNAs were dissolved in siRNA buffer (50 mM Tris–HCl, 100 mM NaCl, pH 7.5). Then the synthesized dsRNAs were assessed by agarose gel electrophoresis and quantified by spectrophotometry. The RNA interference (RNAi) assay was conducted by co-injection of siRNA (15 mg) and WSSV (105 copies ml21) into virus-free shrimp. Twenty virus-free shrimp were used for each treatment. At 12 h after the co-injection, these shrimp were injected with the siRNA (15 mg). The injection of WSSV alone served as a positive control. At different times post-infection (0, 12, 24, 36 and 48 h), the shrimp haemocytes were collected and subjected to northern blot analysis and levels of WSSV copies were measured. Mortality of WSSV-infected shrimp was also monitored daily. All the experiments were biologically repeated three times.

4.18. Statistical analysis Numerical data were processed using one-way analysis of variation (ANOVA), and Student’s t-test was employed to assess the significant difference. Competing interests. We declare we have no competing interests. Funding. This work was financially supported by the National Natural Science Foundation of China (31430089), National Program on the Key Basic Research Project (2015CB755903) and Laboratory for Marine Biology and Biotechnology of Qingdao National Laboratory for Marine Science and Technology.

References 1.

2.

3.

4.

Chan THM et al. 2014 A disrupted RNA editing balance mediated by ADARs (Adenosine DeAminases that act on RNA) in human hepatocellular carcinoma. Gut 63, 832–843. (doi:10.1136/gutjnl-2012-304037) Laurencikiene J, Ka¨llman AM, Fong N, Bentley DL, O¨hman M. 2006 RNA editing and alternative splicing: the importance of co-transcriptional coordination. EMBO Rep. 7, 303–307. (doi:10.1038/ sj.embor.7400621) Jin YF, Zhang WJ, Li Q. 2009 Origins and evolution of ADAR-mediated RNA editing. IUBMB Life 61, 572–578. (doi:10.1002/iub.207) Mallela A, Nishikura K. 2012 A-to-I editing of protein coding and noncoding RNAs. Crit. Rev.

5.

6.

7.

Biochem. Mol. 47, 493 –501. (doi:10.3109/ 10409238.2012.714350) Wright A, Vissel B. 2012 The essential role of AMPA receptor GluR2 subunit RNA editing in the normal and diseased brain. Front. Mol. Neurosci. 5, 34. (doi:10.3389/fnmol.2012.00034) Wang QD, O’Brien PJ, Chen CX, Cho DSC, Murray JM, Nishikura K. 2000 Altered G protein-coupling functions of RNA editing isoform and splicing variant serotonin2C receptors. J. Neurochem. 74, 1290– 1300. (doi:10.1046/j.1471-4159.2000.741290.x) Levanon EY et al. 2004 Systematic identification of abundant A-to-I editing sites in the human transcriptome. Nat. Biotechnol. 22, 1001–1005. (doi:10.1038/nbt996)

8.

Levanon EY, Hallegger M, Kinar Y, Shemesh R, Djinovic-Carugo K, Rechavi G, Jantsch MF, Eisenberg E. 2005 Evolutionarily conserved human targets of adenosine to inosine RNA editing. Nucleic Acids Res. 33, 1162–1168. (doi:10.1093/nar/gki239) 9. Kim KKY, Kim TTY, Walsh T, Kobayashi Y, Matise TC, Buyske S, Gabriel A. 2004 Widespread RNA editing of embedded Alu elements in the human transcriptome. Genome Res. 14, 1719–1725. (doi:10.1101/gr.285504) 10. Blow MJ, Grocock RJ, Dongen SV, Enright AJ, Dicks E, Futreal PA, Wooster R, Stratton MR. 2006 RNA editing of human microRNAs. Genome Biol. 7, R27. (doi:10.1186/gb-2006-7-4-r27) 11. Kawahara Y, Zinshteyn B, Sethupathy P, Lizasa H, Hatzigeorgiou AG, Nishikura K. 2007 Redirection of

16

Open Biol. 5: 150126

4.16. Electrophoretic mobility shift assay

an in vitro T7 transcription kit (TaKaRa, Japan) according to the manufacturer’s instructions. After incubation in the reaction buffer, the mixture was electrophoresed on a 1% agarose gel at 120 V for 30 min. Then the gel was stained as described above.

rsob.royalsocietypublishing.org

GGCGAACTCC and 50 -TTAGGACCGTGGGAGTTCGCC GUTCGCAAA-30 ), generating the EGFP-wsv399-30 UTRmutation construct. Recombinant plasmids were confirmed by sequencing. Insect High Five cells (Invitrogen) were cultured at 278C in Express Five SFM medium (Invitrogen) supplemented with L-glutamine (Invitrogen). After culture at about 70% confluence (3  104/well) in a 96-well plate, 200 ng of EGFP, EGFP-wsv399-30 UTR or EGFP-wsv399-30 UTR-mutation construct was transfected into High Five cells. At the same time, the cells were transfected with 50 nM of either a synthesized WSSV-miR-N12 mimic, the edited WSSV-miR-N12 mimic or a synthesized WSSV-miR-N12-mimic-scrambled. The mimics were synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China). At 36 h after transfection, fluorescence was determined by a Flex Station II microplate reader (Molecular Devices, USA; excitation/emission at 480/520 nm, respectively), and normalized to cells not transfected with EGFP, in three independent experiments.

13.

15.

16.

17.

18.

19.

20.

32.

33.

34.

35.

36.

37.

38.

39.

40.

output. Nature 455, 64 –71. (doi:10.1038/ nature07242) Kiriakidou M, Nelson PT, Kouranov A, Fitziev P, Bouyioukos C, Mourelatos Z, Hatzigeorgiou A. 2004 A combined computational –experimental approach predicts human microRNA targets. Gene Dev. 18, 1165– 1178. (doi:10.1101/gad.1184704) Didiano D, Hobert O. 2006 Perfect seed pairing is not a generally reliable predictor for miRNA– target interactions. Nat. Struct. Mol. Biol. 13, 849 –851. (doi:10.1038/nsmb1138) Rigoutsos I. 2009 New tricks for animal microRNAs: targeting of amino acid coding regions at conserved and nonconserved sites. Cancer Res. 69, 3245– 3248. (doi:10.1158/0008-5472. CAN-09-0352) Selbach M, Schwanhausser B, Thierfelder N, Fang Z, Khanin R, Rajewshy N. 2008 Widespread changes in protein synthesis induced by microRNAs. Nature 455, 58– 63. (doi:10.1038/nature07228) Brennecke J, Stark A, Russell RB, Cohen SM. 2005 Principles of microRNA-target recognition. PLoS Biol. 3, 0414–0418. (doi:10.1371/journal.pbio.0030085) Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP, Bartel DP. 2007 MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol. Cell 27, 91 –105. (doi:10.1016/j. molcel.2007.06.017) Valoczi A, Hornyik C, Varga N, Burgyan J, Kauppinen S, Havelda Z. 2004 Sensitive and specific detection of microRNAs by northern blot analysis using LNAmodified oligonucleotide probes. Nucleic Acids Res. 32, e175. (doi:10.1093/nar/gnh171) Consortium GO. 2006 The Gene Ontology (GO) project in 2006. Nucleic Acids Res. 34, D322–D326. (doi:10.1093/nar/gkj021) Tian N, Yang Y, Sachsenmaier N, Muggenhumer D, Bi JP, Waldsich C, Jantsch MF, Jin YF. 2011 A structural determinant required for RNA editing. Nucleic Acids Res. 39, 5669–5681. (doi:10.1093/nar/gkr144)

17

Open Biol. 5: 150126

14.

21. Yang F, He J, Lin XH, Li Q, Pan D, Zhang XB, Xu X. 2001 Complete genome sequence of the shrimp white spot bacilliform virus. J. Virol. 75, 11 811– 11 820. (doi:10.1128/JVI.75.23.11811-11820.2001) 22. Sanchez-Paz A. 2010 White spot syndrome virus: an overview on an emergent concern. Vet. Res. 41, 43. (doi:10.1051/vetres/2010015) 23. Han F, Xu JY, Zhang XB. 2007 Characterization of an early gene (wsv477) from shrimp white spot syndrome virus (WSSV). Virus Genes 34, 193–198. (doi:10.1007/s11262-006-0053-0) 24. He YD, Yang K, Zhang XB. 2014 Viral microRNAs targeting virus genes promote virus infection in shrimp in vivo. J. Virol. 88, 1104– 1112. (doi:10. 1128/JVI.02455-13) 25. Huang TZ, Zhang XB. 2012 Functional analysis of a crustacean microRNA in host–virus interactions. J. Virol. 86, 12 997–13 004. (doi:10.1128/JVI. 01702-12) 26. Huang TZ, Xu DD, Zhang XB. 2012 Characterization of host microRNAs that respond to DNA virus infection in a crustacean. BMC Genomics 13, 159. (doi:10.1186/1471-2164-13-159) 27. Cullen BR. 2013 MicroRNAs as mediators of viral evasion of the immune system. Nat. Immunol. 14, 205 –210. (doi:10.1038/ni.2537) 28. Farajollahi S, Maas S. 2010 Molecular diversity through RNA editing: a balancing act. Trends Genet. 26, 221– 230. (doi:10.1016/j.tig.2010.02.001) 29. Nishikura K. 2010 Functions and regulation of RNA editing by ADAR deaminases. Annu. Rev. Biochem. 79, 321– 349. (doi:10.1146/annurev-biochem060208-105251) 30. Filipowicz W, Bhattacharyya SN, Sonenberg N. 2008 Mechanisms of post-transcriptional regulation by microRNAs: are the answers in sight? Nat. Rev. Gene. 9, 102 –114. (doi:10.1038/nrg2290) 31. Baek D, Villen J, Shin C, Camargo FD, Gygi SP, Bartel DP. 2008 The impact of microRNAs on protein

rsob.royalsocietypublishing.org

12.

silencing targets by adenosine-to-inosine editing of miRNAs. Science 315, 1137– 1140. (doi:10.1126/ science.1138050) Yang WD, Chendrimada TP, Wang QD, Higuchi M, Seeburg PH, Shiekhatter R, Nishikura K. 2006 Modulation of microRNA processing and expression through RNA editing by ADAR deaminases. Nat. Struct. Mol. Biol. 13, 13–21. (doi:10.1038/nsmb 1041) Axtell MJ, Westholm JO, Lai EC. 2011 Vive la difference: biogenesis and evolution of microRNAs in plants and animals. Genome Biol. 12, 221. (doi:10.1186/gb-2011-12-4-221) Bartel DP. 2009 MicroRNAs: target recognition and regulatory functions. Cell 136, 215– 233. (doi:10. 1016/j.cell.2009.01.002) Carthew RW, Sontheimer EJ. 2009 Origins and mechanisms of miRNAs and siRNAs. Cell 136, 642–655. (doi:10.1016/j.cell.2009.01.035) Kawahara Y, Zinshteyn B, Chendrimada TP, Shiekhatter R, Nishikura K. 2007 RNA editing of the microRNA-151 precursor blocks cleavage by the Dicer-TRBP complex. EMBO Rep. 8, 763– 769. (doi:10.1038/sj.embor.7401011) Wong SK, Lazinski DW. 2002 Replicating hepatitis delta virus RNA is edited in the nucleus by the small form of ADAR1. Proc. Natl Acad. Sci. USA 99, 15 118–15 123. (doi:10.1073/pnas.232416799) He YD, Zhang XB. 2012 Comprehensive characterization of viral miRNAs involved in white spot syndrome virus (WSSV) infection. RNA Biol. 9, 1019–1029. (doi:10.4161/rna.20741) Huang TZ, Cui YL, Zhang XB. 2014 Involvement of viral microRNA in the regulation of antiviral apoptosis in shrimp. J. Virol. 88, 2544 –2554. (doi:10.1128/JVI.03575-13) Marks H, Goldbach RW, Vlak JM, van Hulten MCW. 2004 Genetic variation among isolates of white spot syndrome virus. Arch. Virol. 149, 673–697. (doi:10. 1007/s00705-003-024809)