Accepted Article
Received Date : 29-Aug-2014 Revised Date : 11-Dec-2014 Accepted Date : 05-Jan-2015 Article type : Research Article
RNAi-mediated silencing of EIF3D alleviates proliferation and migration of glioma U251 and U87MG cells Mingliang Ren, Chun Zhou, Hong Liang, Xuhui Wang, Lunshan Xu* Department of Neurosurgery, Research Institute of Field Surgery, Daping Hospital, Third Military Medical University, Chongqing 400042, China
*Correspondence to: Dr. Lunshan Xu, Department of Neurosurgery, Research Institute of Field Surgery, Daping Hospital, Third Military Medical University, 10 Daping Changjiang Branch Road, Yuzhong District, Chongqing 400042, China. Tel.: +86 13908399921 Fax: +86 02368757977 E-mail: [email protected]
Running title: EIF3D regulates glioma cell growth Keywords: EIF3D, RNA interference, glioma, migration
This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as an 'Accepted Article', doi: 10.1111/cbdd.12542 This article is protected by copyright. All rights reserved.
Accepted Article
Abstract As the most common primary malignant brain tumors, gliomas cause more years of life lost than do any other tumors. Recently, abnormalities of the eukaryotic initiation factors (EIFs) have been reported in gliomas. Yet the role of EIF3D, which encodes a subunit of EIF3 multiprotein complex, remains poorly understood. In this study, we found EIF3D expression was positively correlated with WHO grades of gliomas. Furthermore, we employ lentivirus-mediated RNA interference (RNAi) to examine the physiological role of EIF3D in glioma cells. Decreased EIF3D expression in U251 and U87MG glioma cells caused a delay in cell growth and a disruption in colony formation. In addition, EIF3D knockdown induced G0/G1 phase cell cycle arrest and apoptosis. Cells with suppressed expression of EIF3D had a lower capacity to migrate in the transwell assay. These results suggest that EIF3D plays an important role in glioma development and may serve as a potential therapeutic target for human glioma.
1. Introduction Gliomas account for more than 70% of primary malignant brain tumors, and they are aggressive lethal solid tumors that result in more years of life lost than do any other tumors (1,2). The three main types of gliomas are: astrocytomas, oligodendrogliomas and oligoastrocytomas. Astrocytomas are the most common glioma and they can be graded histologically from low (grade I) to high (grade IV) (3). Grade IV astrocytomas are known as glioblastoma multiforme (GBM), the most common type of glioma, is associated with very poor survival (4). Although great progresses have been made, fewer than 3% of glioblastoma
This article is protected by copyright. All rights reserved.
Accepted Article
patients are still alive at 5 years after diagnosis, and the median survival is only 12 to 15 months for patients with glioblastomas (1,5,6). So far, several factors have been conclusively shown to affect glioma risk, which includes exposure to high doses of ionizing radiation, and inherited mutations (2). Yet, the genetic causes of gliomas remain poorly understood. Eukaryotic mRNA translation can be devided into four steps: initiation, elongation, termination and recycling, the regulation of which is primarily achieved during the initiation process. Initiation of translation is known to be controlled by 12 currently known eukaryotic initiation factors (EIFs) (7). Previous studies have shown that alterations in EIFs are associated with the tumorigenesis of many cancers. For instance, the activity of EIF4E is regulated by the signaling cascade of growth factors; therefore, the aberrations in EIF4E are able to drive tumorigenesis by favoring the translation of specific mRNAs (8-10). Yang et al have reported that EIF4B was a critical substrate of Pim kinases in regulating Abl oncogenicity, indicating that EIF4B might be a potential therapeutic target for the treatment of Abl-induced cancers (11). EIFs have also been shown to play roles in glioblastoma development. Knockdown of EIF3B significantly inhibited proliferation of human U87MG glioma cells (12). Pharmacological inhibition of EIF-5A showed a strong antiproliferative effect in glioblastoma cells (13). EIF3D encodes the subunit D of EIF3 multiprotein complex, the largest complex of the EIFs. Lately, it is reported that the EIF3D is involved in several human cancers, such as colon cancer and melanoma (14,15). However, little is known about the biological function of EIF3D in human glioma. To explore the role of EIF3D in glioma, we
applied
lentivirus-mediated short hairpin RNA (shRNA) to knock down EIF3D expression in human
This article is protected by copyright. All rights reserved.
Accepted Article
glioma cell lines U251 and U87MG. Our data have shown that EIF3D plays an important role in modulating glioma cell growth and migration, thus, make it potential candidate therapeutic target for glioma.
2. Material and methods 2.1 Immunohistochemistry This study was approved by the Committee on Ethics of Biomedical Research, Daping Hospital, Third Military Medical University in Chongqing, China. Thirty-five glioma samples were obtained from April 2011 to November 2012 from the Department of Neurosurgery at the Daping Hospital (5 Grade I cases, 6 Grade II cases, 13 Grade III cases, and
11
Grade
IV
cases).
Immunohistochemistry
was
performed
using
a
diaminobenzidine-based staining technique (Dako ChemMate Envision Kit; Dako Denmark A/S, Glostrup, Denmark). After deparaffinization and rehydration, antigen retrieval was performed with Tris-ethylenediamine tetraacetic acid buffer (0.01 mol/L [pH 9.0]) using a pressure cooker. The tissue sections were preincubated with 0.3% hydrogen peroxide and 20% normal goat serum to block nonspecific reactions. Anti-EIF3D antibody (1:300 dilution; #ab155419, Abcam, Cambridge, UK) was incubated on the slides for 2 h in a humidified chamber. A horseradish peroxidase-conjugated secondary antibody was applied next for 30 min. The sections were stained with diaminobenzidine and counterstained with Mayer’s hematoxylin, washed again, dehydrated in alcohol, cleared in xylene, mounted with Pertex mounting medium (CellPath Ltd, Newtown, Powys, UK), and coverslipped. EIF3D expression was estimated basing on the percentage and intensity of the stained tumor
This article is protected by copyright. All rights reserved.
Accepted Article
cells. The staining percentage was graded as 0 (0%), 1 (1%-20%), 2 (21%-60%), and 3 (61%-100%) and coloring intensity was graded as 0 (no coloring), 1 (stramineous), 2 (buffy), and 3 (dark brown). The addition of the extent and intensity score was used as the final score (0-6). Tumors with final staining scores of 0 to 1, and 2 to 6 were considered to be negative (-), and positive (+), respectively.
2.2 Cell culture Human glioma cell lines U251, U87MG, U373, A172 and U118MG were obtained from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). U251, U373, A172 and U118MG cells were cultured in DMEM (HyClone) supplemented with 10% fetal bovine serum (FBS). U87MG cells were cultured in DMEM supplemented with 10% FBS (HyClone), 1mM sodium pyruvate and 1% NEAA. Cells were cultured at 37°C in a humidified atmosphere of 5% CO2.
2.3 Constructions of lentiviruses and infection The
shRNA
sequence
(5’-
GCGTCATTGACATCTGCATGACTCGAGTCATGCAGATGTCAATGACGCTTTTTT -3’) targeting human EIF3D gene (NM_003753.3) was designed and cloned into a pFH-L vector (Shanghai
Hollybio,
China).
The
non-targeting
shRNA
sequence
(5’-
CTAGCCCGGTTCTCCGAACGTGTCACGTATCTCGAGATACGTGACACGTTCGGAG AATTTTTTTAAT -3’) was used as control. To rule out the possible off-targets effects of shRNA,
another
This article is protected by copyright. All rights reserved.
shRNA
(5’-
Accepted Article
GACGACATGGATAAGAATGAACTCGAGTTCATTCTTATCCATGTCGTCTTTTTT -3’) against EIF3D was used to get comparable results. The vectors containing target sequence or non-targeting sequence were transfected into 293T cells, along with pVSVG-I and pCMV△R8.92 packing vectors (Shanghai Hollybio, China). Lentiviruses were harvested after purification and precipitation 72 h later. Fluorescence microscopy was used to determine the transfection efficiency. For cell infection, U251 and U87MG cells were incubated with lentiviruses targeting EIF3D (Lv-shEIF3D) or control lentiviruses (Lv-shCon) for 72 h (MOI=10).
2.4 RNA extraction and quantitative RT-PCR Total RNA was extracted by Trizol reagent according to the manufacturer’s protocol (Invitrogen, Carlsbad, CA). Two μg RNA was reverse transcribed into cDNAs by using M-MLV Reverse Transcriptase Kit (Promega). In qRT-PCR, two sets of primers were used: EIF3D,
forward:
5’-
CTGGAGGAGGGCAAATACCT
-3’,
reverse:
5’-
CTCGGTGGAAGGACAAACTC -3’; Actin, forward: 5’- GTGGACATCCGCAAAGAC -3’, reverse: 5’- AAAGGGTGTAACGCAACTA -3’.
The PCR reaction system was 10 µl 2X
SYBR premix ex-taq, 0.8 µl primers (2.5 µM), 5 µl cDNA and ddH2O up to final 20 µl volume. PCR cycle conditions were 95°C for 1 min, and 40 cycles of 95°C for 5 s and 60°C for 20 s. The relative expression of EIF3D mRNA was normalized to the expression level of Actin mRNA by using comparative threshold cycle (ct) method, in which fold difference = 2–(
ct of target gene–
ct of reference)
. The results were analyzed with the Light Cycler Software
version 3.5 (Roche Diagnostics).
This article is protected by copyright. All rights reserved.
Accepted Article
2.5 Western blot analysis Cell lysates were extracted from indicated cells. The total cell lysates were separated on SDS-PAGE gels and then transferred onto PVDF membranes (Millipore Corp., Bedford). Primary antibody against EIF3D (1:1000 dilution; #ab155419, Abcam), Caspase-3 (1:1000 dilution; #9661L, Cell Signaling Technology), PARP (1:500 dilution; #9542, Cell Signaling Technology) or GAPDH (1:3000 dilution; #Sc-32233, Santa Cruz, CA, USA) was incubated with blots overnight at 4°C. Then the horseradish peroxidase-conjugated goat anti-rabbit IgG (1:5000 dilution; #Sc-2054, Santa Cruz) or goat anti-mouse IgG (1:5000 dilution; #Sc-2005, Santa Cruz) were applied at room temperature for 2 h. Signals were developed with enhanced chemiluminescence. The levels of GAPDH were used as the control.
2.6 MTT assay The cells with three treatments (Con, Lv-shCon and Lv-shEIF3D) were plated onto 96-well plates at a density of 2.2×103 cells/well. At the time indicated, the cells were subjected to MTT detection. Briefly, 10 μL of 5 mg/mL MTT (Sigma Chemi- cal Co., St. Louis, MO) in PBS was added into each well and incubated for 4 hours at 37°C in dark. Formazan crystals were dissolved in acidic isopropanol (100 μL, 10% SDS, 5% isopropanol and 0.01 mol/L HCl). After 10 minutes at room temperature to ensure that all crystals were dissolved, the plates were read on a scanning multiwell spectrophotometer (ELISA-reader). The cell proliferation curves were drawn according to the absorbance.
This article is protected by copyright. All rights reserved.
Accepted Article
2.7 Colony formation assay U251 or U87MG cells in three groups (Con, Lv-shCon and Lv-shEIF3D) were trypsinized and re-cultured into 6-well plates with a density of 800 cells/well or 600 cells/well, respectively. To form natural colonies, the cell samples were allowed to grow for 10 (U251 cells) or 8 (U87MG cells) days. At the end of indicated time points, the plates were washed with PBS, and the colonies were stained with crystals violet. The 6-well plate and stained cell colonies were photographed, and the number of colonies (>50 cells/colony) in each group were counted under microscope.
2.8 Flow cytometry analysis The cell cycle distribution was analyzed using flow cytometry with PI staining. In brief, U251 or U87MG cells that infected with the lentivirus constructs for 3 days were seeded in 6-cm dishes (2×105 cells/dish) and cultured for 40 h at 37°C, respectively. Cells were harvested after trypsinization, washed with PBS, and fixed with 70% cold ethanol. The fixed samples were collected by centrifugation and re-suspended in PI/RNase/PBS (100 μg/mL propidium iodide and 10 μg/mL RNase A) solution for at 30 min at room temperature in dark. About 1 × 106 cells were subjected to flow cytometry analysis by a FACs caliber II sorter and Cell Quest FACS system (BD Biosciences, USA). The percentages of cells in cell cycle phases (G0/G1, S and G2/M) were then statistically analyzed.
This article is protected by copyright. All rights reserved.
Accepted Article
2.9 Transwell assay Migration assay was performed as previously described (16) using Transwell chambers (Corning, NY, USA). Briefly, cells were seeded into the upper chamber at a density of 1×105 cells/well in 200 µl of serum-free medium, and 500 μl of medium containing 10% FBS was added to the lower chamber as a chemoattractant. After incubation for 16 h at 37°C in 5% CO2, the cells remaining on the upper surface of the filter were removed and those that migrated to the lower compartment were fixed with methanol and stained with crystal violet. Cells were counted visually in five random fields under a light microscope (10 x objective lens), and an average of the cell numbers counted in these five fields was calculated. In addition, the cells that migrated to the lower compartment were dissociated, lysed and quantified at 570 nm using a spectrophotometer.
2.10 Statistical analysis The Student’s t-test was used for statistical analysis. Data were presented as mean ± SD of three independent experiments. A P value of less than 0.05 was considered statistically significant.
3. Results 3.1 EIF3D is highly expressed in glioma tissues To investigate the role of EIF3D in glioma tissues, we examined the expression levels of EIF3D in 35 glioma samples with different pathologic grades by immunohistochemical staining. The histo-pathologic differentiation of gliomas is determined according to the
This article is protected by copyright. All rights reserved.
Accepted Article
criteria of the World Health Organization (WHO) classification (17). WHO grade I and II are well differentiated and considered as low grade, while WHO grade III and IV are poorly differentiated and considered as high grade, with high grade being more malignant and aggressive. Representative photographs of positive EIF3D staining in WHO grade II and III gliomas are shown (Fig. 1). The rate of positive EIF3D expression in high grade gliomas (70.8%) was significantly higher than that in low grade gliomas (27.3%) (P=0.0271, Table 1). Our results indicated that EIF3D is highly expressed in glioma tissues, especially in high grade gliomas.
3.2 Knockdown of EIF3D expression by RNAi in glioma cells Firstly, the mRNA levels of EIF3D were analyzed in five human glioma cell lines (U251, U87MG, U373, A172 and U118MG). As revealed in Fig. 2A, the expression of EIF3D was relatively higher in U251 and U87MG cells. Hence, these two cell lines were selected and subjected to the following RNAi experiments. For EIF3D knockdown, a lentivirus mediated RNAi system was employed. Lentiviruses containing shRNA sequences targeting EIF3D or control were transfected into both U251 and U87MG cells. The transfection efficiency was determined by fluorescence microscopy (Fig. 2B and C). To ensure the silencing effect of Lv-shEIF3D on endogenous EIF3D expression, qRT-PCR and western blot analysis were applied in both U251 and U87MG cells. Data shows that the knockdown efficiency of U251 and U87MG cells was about 75% and 54%, respectively (Fig. 2D-G). Besides, another shRNA targeting EIF3D also remarkably suppressed the expression of EIF3D mRNA in U251 cells (Fig. S1A).
This article is protected by copyright. All rights reserved.
Accepted Article
3.3 Knockdown of EIF3D suppresses glioma cell proliferation To investigate the biological role of EIF3D in human glioma cells, an MTT assay was performed. The proliferation of U251 cells treated with Lv-shEIF3D began to decrease since day 3. On day 5, the absorbance value in Lv-shEIF3D group (0.327±0.004) was remarkably reduced, as compared to that of Con (0.898±0.032) and Lv-shCon (0.951±0.028) groups (Fig. 3A). While in U87MG cells, the inhibitory effect of EIF3D knockdown was less significant, since the absorbance value in Lv-shEIF3D, Con and Lv-shCon and groups were 0.452±0.006, 0.573±0.013 and 0.533±0.012, respectively (Fig. 3B). Moreover, the Lv-shCon treated cells have no significant difference in cell proliferation as compared to the non-treated cells. The similar result was observed in U251 cells treated with another Lv-shEIF3D. The absorbance value in Lv-shEIF3D group (0.247±0.007) was remarkably reduced, as compared to that of Con (0.549±0.013) and Lv-shCon (0.543±0.017) groups (Fig. S1B). We further studied the relative long term effect of EIF3D knockdown in the glioma cell proliferation by using a colony formation assay. As shown in Fig. 4A and B, silencing of EIF3D expression in U251 cells resulted in a substantial reduction in colony formation as compared to Lv-shCon (P=0.0023) or Con (P=0.0057). The strong growth inhibitory effect of Lv-shEIF3D was confirmed in U87MG cells as well (Fig. 4C and D).
3.4 Decreased EIF3D expression induces cell cycle arrest To confirm that EIF3D was capable of regulate cell cycle directly, we then assayed cell cycle distribution by flow cytometry. U251 and U87MG cells with three different treatments (Con, Lv-shCon and Lv-shEIF3D) were collected and subjected to FACS analysis. The percentages
This article is protected by copyright. All rights reserved.
Accepted Article
of U251 cells treated with Lv-shEIF3D in G0/G1 and S phases were 59.96 ± 0.52 % and 33.60 ± 0.37%, while that of Lv-Con group were 48.58 ± 0.24 % and 45.82 ± 0.80 %, indicating that silencing of EIF3D expression increased cell populations in G0/G1 phase and decreased that in S phase. Also, there is no significant difference between Con and Lv-shCon groups in cell cycle distribution (Fig. 5A and B). Similarly, our data shows that EIF3D knockdown resulted in G0/G1 cell cycle arrest in U87MG cells as well (Fig. 5C and D).
3.5 Knockdown of EIF3D enhances glioma cell apoptosis To confirm that EIF3D was capable of regulate cell apoptosis, we then detected the expression alterations of some apoptotic markers by western blot. Knockdown of EIF3D resulted in obvious increases in Caspase-3 and cleaved PARP levels (Fig. 6A and B). These results suggested that knockdown of EIF3D could induce cell apoptosis via upregulation of Caspase-3 and cleavage of PARP in U251 and U87MG cells.
3.6 Knockdown of EIF3D suppresses glioma cell migration To determine whether EIF3D is involved in directing the migration of human U251 glioma cells, we also used the transwell assay. Nearly one third times as many Lv-shEIF3D treated cells (37.1 ± 5.3) migrated as compared to Con (105.6 ± 1.4) and Lv-shCon (107.4 ± 7.9) groups (Fig. 7A and B). Then the migrated cells were stained by cristal violet, dissoved and analyzed by spectrophotometer. The absorbance value was also remarkably reduced by knockdown of EIF3D, as compared to two control groups (Fig. 7C).
This article is protected by copyright. All rights reserved.
Accepted Article
4. Discussion Gene expression is shaped by translational control. The understanding of the modalities of translation factors in the modification of gene expression have provide us with therapeutic scenarios (10). EIF3, is a multiprotein complex consisting of 13 distinct subunits (EIF3A to M). It stabilizes the eIF2-GTP-Met-tRNAi(Met) ternary complex ternary and promotes mRNA binding to the 40 S ribosomal (18). EIF3D is a gene that encodes the major RNA binding subunit of the EIF3 complex and EIF3D protein associates with the subunit p170 of EIF3. To date, little is known about the biological function of EIF3D in various tumors including gliomas. In this study, we found EIF3D expression was positively correlated with WHO grades of gliomas, suggesting the involvement of EIF3D in the progression of glioma. Recently, loss of function analysis of EIF3B have revealed that inhibition of EIF3B expression significantly suppressed proliferation of U87MG cells and the inhibitory effect was associated with G1 arrest. To further test the physiological role of EIF3D in glioma cells, a lentivirus mediated loss of function study on EIF3D was carried. Consistent with previous studies showing that knockdown of EIF3D potently suppressed proliferation of HCT116 colon cancer cells, A375 and A431 melanoma cells (14,15), our data also showed that reduction of EIF3D resulted in significant delay of proliferation and decreased colony formation capacity in both U251 and U87MG glioma cells. Moreover, cell cycle analysis revealed that the growth inhibitory effect was associated with a substantial increase in G1 phase and a decrease in S phase. This was in accordance with previous study showing that EIF3B is involved in the modulation of G1 checkpoint in glioma cells (12). Nevertheless, knockdown of EIF3D led to G2/M phase arrest in colon cancer cells (15) and
This article is protected by copyright. All rights reserved.
Accepted Article
21.
Harris, T. E., Chi, A., Shabanowitz, J., Hunt, D. F., Rhoads, R. E., and Lawrence, J. C., Jr. (2006) mTOR-dependent stimulation of the association of eIF4G and eIF3 by insulin. Embo J 25, 1659-1668
22.
Lagirand-Cantaloube, J., Offner, N., Csibi, A., Leibovitch, M. P., Batonnet-Pichon, S., Tintignac, L. A., Segura, C. T., and Leibovitch, S. A. (2008) The initiation factor eIF3-f is a major target for atrogin1/MAFbx function in skeletal muscle atrophy. Embo J 27, 1266-1276
23.
Hui, D. J., Bhasker, C. R., Merrick, W. C., and Sen, G. C. (2003) Viral stress-inducible protein p56 inhibits translation by blocking the interaction of eIF3 with the ternary complex eIF2.GTP.Met-tRNAi. J Biol Chem 278, 39477-39482
Figure legends Figure 1. Immunohistochemical analysis of EIF3D expression in human glioma tissues. Representative photographs are shown of positive EIF3D immunostaining (arrows) in WHO grade II and III gliomas. Magnification, ×200.
Figure 2. Lentivirus stably expressing shRNA targeting EIF3D is successfully constructed. (A) The mRNA levels of EIF3D in five glioma cell lines were determined by qRT-PCR. (B) Infection was observed to be efficient at 96 h and over 80% U251 and U87MG cells presented to be GFP positive in Con, Lv-shCon and Lv-shEIF3D groups.
Magnification,
×100. (C,E) The mRNA levels of EIF3D in U251 and U87MG cells were analyzed by qRT-PCR. Actin gene was used as internal control. (D,F) The protein expression levels of
This article is protected by copyright. All rights reserved.
Accepted Article
Conflict of Interest The authors declare that they have no competing interests.
References 1.
Ohgaki, H. (2009) Epidemiology of brain tumors. Methods Mol Biol 472, 323-342
2.
Schwartzbaum, J. A., Fisher, J. L., Aldape, K. D., and Wrensch, M. (2006) Epidemiology and molecular pathology of glioma. Nat Clin Pract Neurol 2, 494-503; quiz 491 p following 516
3.
Nakada, M., Nakada, S., Demuth, T., Tran, N. L., Hoelzinger, D. B., and Berens, M. E. (2007) Molecular targets of glioma invasion. Cell Mol Life Sci 64, 458-478
4.
Darefsky, A. S., King, J. T., Jr., and Dubrow, R. (2012) Adult glioblastoma multiforme survival in the temozolomide era: a population-based analysis of Surveillance, Epidemiology, and End Results registries. Cancer 118, 2163-2172
5.
Stupp, R., Mason, W. P., van den Bent, M. J., Weller, M., Fisher, B., Taphoorn, M. J., Belanger, K., Brandes, A. A., Marosi, C., Bogdahn, U., Curschmann, J., Janzer, R. C., Ludwin, S. K., Gorlia, T., Allgeier, A., Lacombe, D., Cairncross, J. G., Eisenhauer, E., and Mirimanoff, R. O. (2005) Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N Engl J Med 352, 987-996
6.
Wen, P. Y., and Kesari, S. (2008) Malignant gliomas in adults. N Engl J Med 359, 492-507
7.
Spilka, R., Ernst, C., Mehta, A. K., and Haybaeck, J. (2013) Eukaryotic translation initiation factors in cancer development and progression. Cancer Lett 340, 9-21
This article is protected by copyright. All rights reserved.
Accepted Article
8.
Graff, J. R., Konicek, B. W., Vincent, T. M., Lynch, R. L., Monteith, D., Weir, S. N., Schwier, P., Capen, A., Goode, R. L., Dowless, M. S., Chen, Y., Zhang, H., Sissons, S., Cox, K., McNulty, A. M., Parsons, S. H., Wang, T., Sams, L., Geeganage, S., Douglass, L. E., Neubauer, B. L., Dean, N. M., Blanchard, K., Shou, J., Stancato, L. F., Carter, J. H., and Marcusson, E. G. (2007) Therapeutic suppression of translation initiation factor eIF4E expression reduces tumor growth without toxicity. J Clin Invest 117, 2638-2648
9.
De Benedetti, A., and Harris, A. L. (1999) eIF4E expression in tumors: its possible role in progression of malignancies. Int J Biochem Cell Biol 31, 59-72
10.
Loreni, F., Mancino, M., and Biffo, S. (2013) Translation factors and ribosomal proteins control tumor onset and progression: how? Oncogene
11.
Yang, J., Wang, J., Chen, K., Guo, G., Xi, R., Rothman, P. B., Whitten, D., Zhang, L., Huang, S., and Chen, J. L. (2013) eIF4B phosphorylation by pim kinases plays a critical role in cellular transformation by Abl oncogenes. Cancer Res 73, 4898-4908
12.
Liang, H., Ding, X., Zhou, C., Zhang, Y., Xu, M., Zhang, C., and Xu, L. (2012) Knockdown of eukaryotic translation initiation factors 3B (EIF3B) inhibits proliferation and promotes apoptosis in glioblastoma cells. Neurol Sci 33, 1057-1062
13.
Preukschas, M., Hagel, C., Schulte, A., Weber, K., Lamszus, K., Sievert, H., Pallmann, N., Bokemeyer, C., Hauber, J., Braig, M., and Balabanov, S. (2012) Expression of eukaryotic initiation factor 5A and hypusine forming enzymes in glioblastoma patient samples: implications for new targeted therapies. PLoS One 7, e43468
14.
Li, H., Zhou, F., Wang, H., Lin, D., Chen, G., Zuo, X., Sun, L., Zhang, X., and Yang, S.
This article is protected by copyright. All rights reserved.
Accepted Article
(2014) Knockdown of EIF3D suppresses proliferation of human melanoma cells through G2/M phase arrest. Biotechnology and applied biochemistry 15.
Yu, X., Zheng, B., and Chai, R. (2014) Lentivirus-Mediated Knockdown of Eukaryotic Translation Initiation Factor 3 subunit D Inhibits Proliferation of HCT116 Colon Cancer Cells. Bioscience reports
16.
Eiseler, T., Doppler, H., Yan, I. K., Goodison, S., and Storz, P. (2009) Protein kinase D1 regulates matrix metalloproteinase expression and inhibits breast cancer cell invasion. Breast Cancer Res 11, R13
17.
Louis, D. N., Ohgaki, H., Wiestler, O. D., Cavenee, W. K., Burger, P. C., Jouvet, A., Scheithauer, B. W., and Kleihues, P. (2007) The 2007 WHO classification of tumours of the central nervous system. Acta neuropathologica 114, 97-109
18.
Methot, N., Rom, E., Olsen, H., and Sonenberg, N. (1997) The human homologue of the yeast Prt1 protein is an integral part of the eukaryotic initiation factor 3 complex and interacts with p170. J Biol Chem 272, 1110-1116
19.
Bressenot, A., Marchal, S., Bezdetnaya, L., Garrier, J., Guillemin, F., and Plenat, F. (2009) Assessment of apoptosis by immunohistochemistry to active caspase-3, active caspase-7, or cleaved PARP in monolayer cells and spheroid and subcutaneous xenografts of human carcinoma. The journal of histochemistry and cytochemistry : official journal of the Histochemistry Society 57, 289-300
20.
Choy, L., and Derynck, R. (1998) The type II transforming growth factor (TGF)-beta receptor-interacting protein TRIP-1 acts as a modulator of the TGF-beta response. J Biol Chem 273, 31455-31462
This article is protected by copyright. All rights reserved.
Accepted Article
21.
Harris, T. E., Chi, A., Shabanowitz, J., Hunt, D. F., Rhoads, R. E., and Lawrence, J. C., Jr. (2006) mTOR-dependent stimulation of the association of eIF4G and eIF3 by insulin. Embo J 25, 1659-1668
22.
Lagirand-Cantaloube, J., Offner, N., Csibi, A., Leibovitch, M. P., Batonnet-Pichon, S., Tintignac, L. A., Segura, C. T., and Leibovitch, S. A. (2008) The initiation factor eIF3-f is a major target for atrogin1/MAFbx function in skeletal muscle atrophy. Embo J 27, 1266-1276
23.
Hui, D. J., Bhasker, C. R., Merrick, W. C., and Sen, G. C. (2003) Viral stress-inducible protein p56 inhibits translation by blocking the interaction of eIF3 with the ternary complex eIF2.GTP.Met-tRNAi. J Biol Chem 278, 39477-39482
Figure legends Figure 1. Immunohistochemical analysis of EIF3D expression in human glioma tissues. Representative photographs are shown of positive EIF3D immunostaining (arrows) in WHO grade II and III gliomas. Magnification, ×200.
Figure 2. Lentivirus stably expressing shRNA targeting EIF3D is successfully constructed. (A) The mRNA levels of EIF3D in five glioma cell lines were determined by qRT-PCR. (B) Infection was observed to be efficient at 96 h and over 80% U251 and U87MG cells presented to be GFP positive in Con, Lv-shCon and Lv-shEIF3D groups.
Magnification,
×100. (C,E) The mRNA levels of EIF3D in U251 and U87MG cells were analyzed by qRT-PCR. Actin gene was used as internal control. (D,F) The protein expression levels of
This article is protected by copyright. All rights reserved.
Accepted Article
EIF3D in U251 and U87MG cells were analyzed by western blot analysis. GAPDH was used as internal control. ***P
Received Date : 29-Aug-2014 Revised Date : 11-Dec-2014 Accepted Date : 05-Jan-2015 Article type : Research Article
RNAi-mediated silencing of EIF3D alleviates proliferation and migration of glioma U251 and U87MG cells Mingliang Ren, Chun Zhou, Hong Liang, Xuhui Wang, Lunshan Xu* Department of Neurosurgery, Research Institute of Field Surgery, Daping Hospital, Third Military Medical University, Chongqing 400042, China
*Correspondence to: Dr. Lunshan Xu, Department of Neurosurgery, Research Institute of Field Surgery, Daping Hospital, Third Military Medical University, 10 Daping Changjiang Branch Road, Yuzhong District, Chongqing 400042, China. Tel.: +86 13908399921 Fax: +86 02368757977 E-mail: [email protected]
Running title: EIF3D regulates glioma cell growth Keywords: EIF3D, RNA interference, glioma, migration
This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as an 'Accepted Article', doi: 10.1111/cbdd.12542 This article is protected by copyright. All rights reserved.
Accepted Article
Abstract As the most common primary malignant brain tumors, gliomas cause more years of life lost than do any other tumors. Recently, abnormalities of the eukaryotic initiation factors (EIFs) have been reported in gliomas. Yet the role of EIF3D, which encodes a subunit of EIF3 multiprotein complex, remains poorly understood. In this study, we found EIF3D expression was positively correlated with WHO grades of gliomas. Furthermore, we employ lentivirus-mediated RNA interference (RNAi) to examine the physiological role of EIF3D in glioma cells. Decreased EIF3D expression in U251 and U87MG glioma cells caused a delay in cell growth and a disruption in colony formation. In addition, EIF3D knockdown induced G0/G1 phase cell cycle arrest and apoptosis. Cells with suppressed expression of EIF3D had a lower capacity to migrate in the transwell assay. These results suggest that EIF3D plays an important role in glioma development and may serve as a potential therapeutic target for human glioma.
1. Introduction Gliomas account for more than 70% of primary malignant brain tumors, and they are aggressive lethal solid tumors that result in more years of life lost than do any other tumors (1,2). The three main types of gliomas are: astrocytomas, oligodendrogliomas and oligoastrocytomas. Astrocytomas are the most common glioma and they can be graded histologically from low (grade I) to high (grade IV) (3). Grade IV astrocytomas are known as glioblastoma multiforme (GBM), the most common type of glioma, is associated with very poor survival (4). Although great progresses have been made, fewer than 3% of glioblastoma
This article is protected by copyright. All rights reserved.
Accepted Article
patients are still alive at 5 years after diagnosis, and the median survival is only 12 to 15 months for patients with glioblastomas (1,5,6). So far, several factors have been conclusively shown to affect glioma risk, which includes exposure to high doses of ionizing radiation, and inherited mutations (2). Yet, the genetic causes of gliomas remain poorly understood. Eukaryotic mRNA translation can be devided into four steps: initiation, elongation, termination and recycling, the regulation of which is primarily achieved during the initiation process. Initiation of translation is known to be controlled by 12 currently known eukaryotic initiation factors (EIFs) (7). Previous studies have shown that alterations in EIFs are associated with the tumorigenesis of many cancers. For instance, the activity of EIF4E is regulated by the signaling cascade of growth factors; therefore, the aberrations in EIF4E are able to drive tumorigenesis by favoring the translation of specific mRNAs (8-10). Yang et al have reported that EIF4B was a critical substrate of Pim kinases in regulating Abl oncogenicity, indicating that EIF4B might be a potential therapeutic target for the treatment of Abl-induced cancers (11). EIFs have also been shown to play roles in glioblastoma development. Knockdown of EIF3B significantly inhibited proliferation of human U87MG glioma cells (12). Pharmacological inhibition of EIF-5A showed a strong antiproliferative effect in glioblastoma cells (13). EIF3D encodes the subunit D of EIF3 multiprotein complex, the largest complex of the EIFs. Lately, it is reported that the EIF3D is involved in several human cancers, such as colon cancer and melanoma (14,15). However, little is known about the biological function of EIF3D in human glioma. To explore the role of EIF3D in glioma, we
applied
lentivirus-mediated short hairpin RNA (shRNA) to knock down EIF3D expression in human
This article is protected by copyright. All rights reserved.
Accepted Article
glioma cell lines U251 and U87MG. Our data have shown that EIF3D plays an important role in modulating glioma cell growth and migration, thus, make it potential candidate therapeutic target for glioma.
2. Material and methods 2.1 Immunohistochemistry This study was approved by the Committee on Ethics of Biomedical Research, Daping Hospital, Third Military Medical University in Chongqing, China. Thirty-five glioma samples were obtained from April 2011 to November 2012 from the Department of Neurosurgery at the Daping Hospital (5 Grade I cases, 6 Grade II cases, 13 Grade III cases, and
11
Grade
IV
cases).
Immunohistochemistry
was
performed
using
a
diaminobenzidine-based staining technique (Dako ChemMate Envision Kit; Dako Denmark A/S, Glostrup, Denmark). After deparaffinization and rehydration, antigen retrieval was performed with Tris-ethylenediamine tetraacetic acid buffer (0.01 mol/L [pH 9.0]) using a pressure cooker. The tissue sections were preincubated with 0.3% hydrogen peroxide and 20% normal goat serum to block nonspecific reactions. Anti-EIF3D antibody (1:300 dilution; #ab155419, Abcam, Cambridge, UK) was incubated on the slides for 2 h in a humidified chamber. A horseradish peroxidase-conjugated secondary antibody was applied next for 30 min. The sections were stained with diaminobenzidine and counterstained with Mayer’s hematoxylin, washed again, dehydrated in alcohol, cleared in xylene, mounted with Pertex mounting medium (CellPath Ltd, Newtown, Powys, UK), and coverslipped. EIF3D expression was estimated basing on the percentage and intensity of the stained tumor
This article is protected by copyright. All rights reserved.
Accepted Article
cells. The staining percentage was graded as 0 (0%), 1 (1%-20%), 2 (21%-60%), and 3 (61%-100%) and coloring intensity was graded as 0 (no coloring), 1 (stramineous), 2 (buffy), and 3 (dark brown). The addition of the extent and intensity score was used as the final score (0-6). Tumors with final staining scores of 0 to 1, and 2 to 6 were considered to be negative (-), and positive (+), respectively.
2.2 Cell culture Human glioma cell lines U251, U87MG, U373, A172 and U118MG were obtained from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). U251, U373, A172 and U118MG cells were cultured in DMEM (HyClone) supplemented with 10% fetal bovine serum (FBS). U87MG cells were cultured in DMEM supplemented with 10% FBS (HyClone), 1mM sodium pyruvate and 1% NEAA. Cells were cultured at 37°C in a humidified atmosphere of 5% CO2.
2.3 Constructions of lentiviruses and infection The
shRNA
sequence
(5’-
GCGTCATTGACATCTGCATGACTCGAGTCATGCAGATGTCAATGACGCTTTTTT -3’) targeting human EIF3D gene (NM_003753.3) was designed and cloned into a pFH-L vector (Shanghai
Hollybio,
China).
The
non-targeting
shRNA
sequence
(5’-
CTAGCCCGGTTCTCCGAACGTGTCACGTATCTCGAGATACGTGACACGTTCGGAG AATTTTTTTAAT -3’) was used as control. To rule out the possible off-targets effects of shRNA,
another
This article is protected by copyright. All rights reserved.
shRNA
(5’-
Accepted Article
GACGACATGGATAAGAATGAACTCGAGTTCATTCTTATCCATGTCGTCTTTTTT -3’) against EIF3D was used to get comparable results. The vectors containing target sequence or non-targeting sequence were transfected into 293T cells, along with pVSVG-I and pCMV△R8.92 packing vectors (Shanghai Hollybio, China). Lentiviruses were harvested after purification and precipitation 72 h later. Fluorescence microscopy was used to determine the transfection efficiency. For cell infection, U251 and U87MG cells were incubated with lentiviruses targeting EIF3D (Lv-shEIF3D) or control lentiviruses (Lv-shCon) for 72 h (MOI=10).
2.4 RNA extraction and quantitative RT-PCR Total RNA was extracted by Trizol reagent according to the manufacturer’s protocol (Invitrogen, Carlsbad, CA). Two μg RNA was reverse transcribed into cDNAs by using M-MLV Reverse Transcriptase Kit (Promega). In qRT-PCR, two sets of primers were used: EIF3D,
forward:
5’-
CTGGAGGAGGGCAAATACCT
-3’,
reverse:
5’-
CTCGGTGGAAGGACAAACTC -3’; Actin, forward: 5’- GTGGACATCCGCAAAGAC -3’, reverse: 5’- AAAGGGTGTAACGCAACTA -3’.
The PCR reaction system was 10 µl 2X
SYBR premix ex-taq, 0.8 µl primers (2.5 µM), 5 µl cDNA and ddH2O up to final 20 µl volume. PCR cycle conditions were 95°C for 1 min, and 40 cycles of 95°C for 5 s and 60°C for 20 s. The relative expression of EIF3D mRNA was normalized to the expression level of Actin mRNA by using comparative threshold cycle (ct) method, in which fold difference = 2–(
ct of target gene–
ct of reference)
. The results were analyzed with the Light Cycler Software
version 3.5 (Roche Diagnostics).
This article is protected by copyright. All rights reserved.
Accepted Article
2.5 Western blot analysis Cell lysates were extracted from indicated cells. The total cell lysates were separated on SDS-PAGE gels and then transferred onto PVDF membranes (Millipore Corp., Bedford). Primary antibody against EIF3D (1:1000 dilution; #ab155419, Abcam), Caspase-3 (1:1000 dilution; #9661L, Cell Signaling Technology), PARP (1:500 dilution; #9542, Cell Signaling Technology) or GAPDH (1:3000 dilution; #Sc-32233, Santa Cruz, CA, USA) was incubated with blots overnight at 4°C. Then the horseradish peroxidase-conjugated goat anti-rabbit IgG (1:5000 dilution; #Sc-2054, Santa Cruz) or goat anti-mouse IgG (1:5000 dilution; #Sc-2005, Santa Cruz) were applied at room temperature for 2 h. Signals were developed with enhanced chemiluminescence. The levels of GAPDH were used as the control.
2.6 MTT assay The cells with three treatments (Con, Lv-shCon and Lv-shEIF3D) were plated onto 96-well plates at a density of 2.2×103 cells/well. At the time indicated, the cells were subjected to MTT detection. Briefly, 10 μL of 5 mg/mL MTT (Sigma Chemi- cal Co., St. Louis, MO) in PBS was added into each well and incubated for 4 hours at 37°C in dark. Formazan crystals were dissolved in acidic isopropanol (100 μL, 10% SDS, 5% isopropanol and 0.01 mol/L HCl). After 10 minutes at room temperature to ensure that all crystals were dissolved, the plates were read on a scanning multiwell spectrophotometer (ELISA-reader). The cell proliferation curves were drawn according to the absorbance.
This article is protected by copyright. All rights reserved.
Accepted Article
2.7 Colony formation assay U251 or U87MG cells in three groups (Con, Lv-shCon and Lv-shEIF3D) were trypsinized and re-cultured into 6-well plates with a density of 800 cells/well or 600 cells/well, respectively. To form natural colonies, the cell samples were allowed to grow for 10 (U251 cells) or 8 (U87MG cells) days. At the end of indicated time points, the plates were washed with PBS, and the colonies were stained with crystals violet. The 6-well plate and stained cell colonies were photographed, and the number of colonies (>50 cells/colony) in each group were counted under microscope.
2.8 Flow cytometry analysis The cell cycle distribution was analyzed using flow cytometry with PI staining. In brief, U251 or U87MG cells that infected with the lentivirus constructs for 3 days were seeded in 6-cm dishes (2×105 cells/dish) and cultured for 40 h at 37°C, respectively. Cells were harvested after trypsinization, washed with PBS, and fixed with 70% cold ethanol. The fixed samples were collected by centrifugation and re-suspended in PI/RNase/PBS (100 μg/mL propidium iodide and 10 μg/mL RNase A) solution for at 30 min at room temperature in dark. About 1 × 106 cells were subjected to flow cytometry analysis by a FACs caliber II sorter and Cell Quest FACS system (BD Biosciences, USA). The percentages of cells in cell cycle phases (G0/G1, S and G2/M) were then statistically analyzed.
This article is protected by copyright. All rights reserved.
Accepted Article
2.9 Transwell assay Migration assay was performed as previously described (16) using Transwell chambers (Corning, NY, USA). Briefly, cells were seeded into the upper chamber at a density of 1×105 cells/well in 200 µl of serum-free medium, and 500 μl of medium containing 10% FBS was added to the lower chamber as a chemoattractant. After incubation for 16 h at 37°C in 5% CO2, the cells remaining on the upper surface of the filter were removed and those that migrated to the lower compartment were fixed with methanol and stained with crystal violet. Cells were counted visually in five random fields under a light microscope (10 x objective lens), and an average of the cell numbers counted in these five fields was calculated. In addition, the cells that migrated to the lower compartment were dissociated, lysed and quantified at 570 nm using a spectrophotometer.
2.10 Statistical analysis The Student’s t-test was used for statistical analysis. Data were presented as mean ± SD of three independent experiments. A P value of less than 0.05 was considered statistically significant.
3. Results 3.1 EIF3D is highly expressed in glioma tissues To investigate the role of EIF3D in glioma tissues, we examined the expression levels of EIF3D in 35 glioma samples with different pathologic grades by immunohistochemical staining. The histo-pathologic differentiation of gliomas is determined according to the
This article is protected by copyright. All rights reserved.
Accepted Article
criteria of the World Health Organization (WHO) classification (17). WHO grade I and II are well differentiated and considered as low grade, while WHO grade III and IV are poorly differentiated and considered as high grade, with high grade being more malignant and aggressive. Representative photographs of positive EIF3D staining in WHO grade II and III gliomas are shown (Fig. 1). The rate of positive EIF3D expression in high grade gliomas (70.8%) was significantly higher than that in low grade gliomas (27.3%) (P=0.0271, Table 1). Our results indicated that EIF3D is highly expressed in glioma tissues, especially in high grade gliomas.
3.2 Knockdown of EIF3D expression by RNAi in glioma cells Firstly, the mRNA levels of EIF3D were analyzed in five human glioma cell lines (U251, U87MG, U373, A172 and U118MG). As revealed in Fig. 2A, the expression of EIF3D was relatively higher in U251 and U87MG cells. Hence, these two cell lines were selected and subjected to the following RNAi experiments. For EIF3D knockdown, a lentivirus mediated RNAi system was employed. Lentiviruses containing shRNA sequences targeting EIF3D or control were transfected into both U251 and U87MG cells. The transfection efficiency was determined by fluorescence microscopy (Fig. 2B and C). To ensure the silencing effect of Lv-shEIF3D on endogenous EIF3D expression, qRT-PCR and western blot analysis were applied in both U251 and U87MG cells. Data shows that the knockdown efficiency of U251 and U87MG cells was about 75% and 54%, respectively (Fig. 2D-G). Besides, another shRNA targeting EIF3D also remarkably suppressed the expression of EIF3D mRNA in U251 cells (Fig. S1A).
This article is protected by copyright. All rights reserved.
Accepted Article
3.3 Knockdown of EIF3D suppresses glioma cell proliferation To investigate the biological role of EIF3D in human glioma cells, an MTT assay was performed. The proliferation of U251 cells treated with Lv-shEIF3D began to decrease since day 3. On day 5, the absorbance value in Lv-shEIF3D group (0.327±0.004) was remarkably reduced, as compared to that of Con (0.898±0.032) and Lv-shCon (0.951±0.028) groups (Fig. 3A). While in U87MG cells, the inhibitory effect of EIF3D knockdown was less significant, since the absorbance value in Lv-shEIF3D, Con and Lv-shCon and groups were 0.452±0.006, 0.573±0.013 and 0.533±0.012, respectively (Fig. 3B). Moreover, the Lv-shCon treated cells have no significant difference in cell proliferation as compared to the non-treated cells. The similar result was observed in U251 cells treated with another Lv-shEIF3D. The absorbance value in Lv-shEIF3D group (0.247±0.007) was remarkably reduced, as compared to that of Con (0.549±0.013) and Lv-shCon (0.543±0.017) groups (Fig. S1B). We further studied the relative long term effect of EIF3D knockdown in the glioma cell proliferation by using a colony formation assay. As shown in Fig. 4A and B, silencing of EIF3D expression in U251 cells resulted in a substantial reduction in colony formation as compared to Lv-shCon (P=0.0023) or Con (P=0.0057). The strong growth inhibitory effect of Lv-shEIF3D was confirmed in U87MG cells as well (Fig. 4C and D).
3.4 Decreased EIF3D expression induces cell cycle arrest To confirm that EIF3D was capable of regulate cell cycle directly, we then assayed cell cycle distribution by flow cytometry. U251 and U87MG cells with three different treatments (Con, Lv-shCon and Lv-shEIF3D) were collected and subjected to FACS analysis. The percentages
This article is protected by copyright. All rights reserved.
Accepted Article
of U251 cells treated with Lv-shEIF3D in G0/G1 and S phases were 59.96 ± 0.52 % and 33.60 ± 0.37%, while that of Lv-Con group were 48.58 ± 0.24 % and 45.82 ± 0.80 %, indicating that silencing of EIF3D expression increased cell populations in G0/G1 phase and decreased that in S phase. Also, there is no significant difference between Con and Lv-shCon groups in cell cycle distribution (Fig. 5A and B). Similarly, our data shows that EIF3D knockdown resulted in G0/G1 cell cycle arrest in U87MG cells as well (Fig. 5C and D).
3.5 Knockdown of EIF3D enhances glioma cell apoptosis To confirm that EIF3D was capable of regulate cell apoptosis, we then detected the expression alterations of some apoptotic markers by western blot. Knockdown of EIF3D resulted in obvious increases in Caspase-3 and cleaved PARP levels (Fig. 6A and B). These results suggested that knockdown of EIF3D could induce cell apoptosis via upregulation of Caspase-3 and cleavage of PARP in U251 and U87MG cells.
3.6 Knockdown of EIF3D suppresses glioma cell migration To determine whether EIF3D is involved in directing the migration of human U251 glioma cells, we also used the transwell assay. Nearly one third times as many Lv-shEIF3D treated cells (37.1 ± 5.3) migrated as compared to Con (105.6 ± 1.4) and Lv-shCon (107.4 ± 7.9) groups (Fig. 7A and B). Then the migrated cells were stained by cristal violet, dissoved and analyzed by spectrophotometer. The absorbance value was also remarkably reduced by knockdown of EIF3D, as compared to two control groups (Fig. 7C).
This article is protected by copyright. All rights reserved.
Accepted Article
4. Discussion Gene expression is shaped by translational control. The understanding of the modalities of translation factors in the modification of gene expression have provide us with therapeutic scenarios (10). EIF3, is a multiprotein complex consisting of 13 distinct subunits (EIF3A to M). It stabilizes the eIF2-GTP-Met-tRNAi(Met) ternary complex ternary and promotes mRNA binding to the 40 S ribosomal (18). EIF3D is a gene that encodes the major RNA binding subunit of the EIF3 complex and EIF3D protein associates with the subunit p170 of EIF3. To date, little is known about the biological function of EIF3D in various tumors including gliomas. In this study, we found EIF3D expression was positively correlated with WHO grades of gliomas, suggesting the involvement of EIF3D in the progression of glioma. Recently, loss of function analysis of EIF3B have revealed that inhibition of EIF3B expression significantly suppressed proliferation of U87MG cells and the inhibitory effect was associated with G1 arrest. To further test the physiological role of EIF3D in glioma cells, a lentivirus mediated loss of function study on EIF3D was carried. Consistent with previous studies showing that knockdown of EIF3D potently suppressed proliferation of HCT116 colon cancer cells, A375 and A431 melanoma cells (14,15), our data also showed that reduction of EIF3D resulted in significant delay of proliferation and decreased colony formation capacity in both U251 and U87MG glioma cells. Moreover, cell cycle analysis revealed that the growth inhibitory effect was associated with a substantial increase in G1 phase and a decrease in S phase. This was in accordance with previous study showing that EIF3B is involved in the modulation of G1 checkpoint in glioma cells (12). Nevertheless, knockdown of EIF3D led to G2/M phase arrest in colon cancer cells (15) and
This article is protected by copyright. All rights reserved.
Accepted Article
21.
Harris, T. E., Chi, A., Shabanowitz, J., Hunt, D. F., Rhoads, R. E., and Lawrence, J. C., Jr. (2006) mTOR-dependent stimulation of the association of eIF4G and eIF3 by insulin. Embo J 25, 1659-1668
22.
Lagirand-Cantaloube, J., Offner, N., Csibi, A., Leibovitch, M. P., Batonnet-Pichon, S., Tintignac, L. A., Segura, C. T., and Leibovitch, S. A. (2008) The initiation factor eIF3-f is a major target for atrogin1/MAFbx function in skeletal muscle atrophy. Embo J 27, 1266-1276
23.
Hui, D. J., Bhasker, C. R., Merrick, W. C., and Sen, G. C. (2003) Viral stress-inducible protein p56 inhibits translation by blocking the interaction of eIF3 with the ternary complex eIF2.GTP.Met-tRNAi. J Biol Chem 278, 39477-39482
Figure legends Figure 1. Immunohistochemical analysis of EIF3D expression in human glioma tissues. Representative photographs are shown of positive EIF3D immunostaining (arrows) in WHO grade II and III gliomas. Magnification, ×200.
Figure 2. Lentivirus stably expressing shRNA targeting EIF3D is successfully constructed. (A) The mRNA levels of EIF3D in five glioma cell lines were determined by qRT-PCR. (B) Infection was observed to be efficient at 96 h and over 80% U251 and U87MG cells presented to be GFP positive in Con, Lv-shCon and Lv-shEIF3D groups.
Magnification,
×100. (C,E) The mRNA levels of EIF3D in U251 and U87MG cells were analyzed by qRT-PCR. Actin gene was used as internal control. (D,F) The protein expression levels of
This article is protected by copyright. All rights reserved.
Accepted Article
Conflict of Interest The authors declare that they have no competing interests.
References 1.
Ohgaki, H. (2009) Epidemiology of brain tumors. Methods Mol Biol 472, 323-342
2.
Schwartzbaum, J. A., Fisher, J. L., Aldape, K. D., and Wrensch, M. (2006) Epidemiology and molecular pathology of glioma. Nat Clin Pract Neurol 2, 494-503; quiz 491 p following 516
3.
Nakada, M., Nakada, S., Demuth, T., Tran, N. L., Hoelzinger, D. B., and Berens, M. E. (2007) Molecular targets of glioma invasion. Cell Mol Life Sci 64, 458-478
4.
Darefsky, A. S., King, J. T., Jr., and Dubrow, R. (2012) Adult glioblastoma multiforme survival in the temozolomide era: a population-based analysis of Surveillance, Epidemiology, and End Results registries. Cancer 118, 2163-2172
5.
Stupp, R., Mason, W. P., van den Bent, M. J., Weller, M., Fisher, B., Taphoorn, M. J., Belanger, K., Brandes, A. A., Marosi, C., Bogdahn, U., Curschmann, J., Janzer, R. C., Ludwin, S. K., Gorlia, T., Allgeier, A., Lacombe, D., Cairncross, J. G., Eisenhauer, E., and Mirimanoff, R. O. (2005) Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N Engl J Med 352, 987-996
6.
Wen, P. Y., and Kesari, S. (2008) Malignant gliomas in adults. N Engl J Med 359, 492-507
7.
Spilka, R., Ernst, C., Mehta, A. K., and Haybaeck, J. (2013) Eukaryotic translation initiation factors in cancer development and progression. Cancer Lett 340, 9-21
This article is protected by copyright. All rights reserved.
Accepted Article
8.
Graff, J. R., Konicek, B. W., Vincent, T. M., Lynch, R. L., Monteith, D., Weir, S. N., Schwier, P., Capen, A., Goode, R. L., Dowless, M. S., Chen, Y., Zhang, H., Sissons, S., Cox, K., McNulty, A. M., Parsons, S. H., Wang, T., Sams, L., Geeganage, S., Douglass, L. E., Neubauer, B. L., Dean, N. M., Blanchard, K., Shou, J., Stancato, L. F., Carter, J. H., and Marcusson, E. G. (2007) Therapeutic suppression of translation initiation factor eIF4E expression reduces tumor growth without toxicity. J Clin Invest 117, 2638-2648
9.
De Benedetti, A., and Harris, A. L. (1999) eIF4E expression in tumors: its possible role in progression of malignancies. Int J Biochem Cell Biol 31, 59-72
10.
Loreni, F., Mancino, M., and Biffo, S. (2013) Translation factors and ribosomal proteins control tumor onset and progression: how? Oncogene
11.
Yang, J., Wang, J., Chen, K., Guo, G., Xi, R., Rothman, P. B., Whitten, D., Zhang, L., Huang, S., and Chen, J. L. (2013) eIF4B phosphorylation by pim kinases plays a critical role in cellular transformation by Abl oncogenes. Cancer Res 73, 4898-4908
12.
Liang, H., Ding, X., Zhou, C., Zhang, Y., Xu, M., Zhang, C., and Xu, L. (2012) Knockdown of eukaryotic translation initiation factors 3B (EIF3B) inhibits proliferation and promotes apoptosis in glioblastoma cells. Neurol Sci 33, 1057-1062
13.
Preukschas, M., Hagel, C., Schulte, A., Weber, K., Lamszus, K., Sievert, H., Pallmann, N., Bokemeyer, C., Hauber, J., Braig, M., and Balabanov, S. (2012) Expression of eukaryotic initiation factor 5A and hypusine forming enzymes in glioblastoma patient samples: implications for new targeted therapies. PLoS One 7, e43468
14.
Li, H., Zhou, F., Wang, H., Lin, D., Chen, G., Zuo, X., Sun, L., Zhang, X., and Yang, S.
This article is protected by copyright. All rights reserved.
Accepted Article
(2014) Knockdown of EIF3D suppresses proliferation of human melanoma cells through G2/M phase arrest. Biotechnology and applied biochemistry 15.
Yu, X., Zheng, B., and Chai, R. (2014) Lentivirus-Mediated Knockdown of Eukaryotic Translation Initiation Factor 3 subunit D Inhibits Proliferation of HCT116 Colon Cancer Cells. Bioscience reports
16.
Eiseler, T., Doppler, H., Yan, I. K., Goodison, S., and Storz, P. (2009) Protein kinase D1 regulates matrix metalloproteinase expression and inhibits breast cancer cell invasion. Breast Cancer Res 11, R13
17.
Louis, D. N., Ohgaki, H., Wiestler, O. D., Cavenee, W. K., Burger, P. C., Jouvet, A., Scheithauer, B. W., and Kleihues, P. (2007) The 2007 WHO classification of tumours of the central nervous system. Acta neuropathologica 114, 97-109
18.
Methot, N., Rom, E., Olsen, H., and Sonenberg, N. (1997) The human homologue of the yeast Prt1 protein is an integral part of the eukaryotic initiation factor 3 complex and interacts with p170. J Biol Chem 272, 1110-1116
19.
Bressenot, A., Marchal, S., Bezdetnaya, L., Garrier, J., Guillemin, F., and Plenat, F. (2009) Assessment of apoptosis by immunohistochemistry to active caspase-3, active caspase-7, or cleaved PARP in monolayer cells and spheroid and subcutaneous xenografts of human carcinoma. The journal of histochemistry and cytochemistry : official journal of the Histochemistry Society 57, 289-300
20.
Choy, L., and Derynck, R. (1998) The type II transforming growth factor (TGF)-beta receptor-interacting protein TRIP-1 acts as a modulator of the TGF-beta response. J Biol Chem 273, 31455-31462
This article is protected by copyright. All rights reserved.
Accepted Article
21.
Harris, T. E., Chi, A., Shabanowitz, J., Hunt, D. F., Rhoads, R. E., and Lawrence, J. C., Jr. (2006) mTOR-dependent stimulation of the association of eIF4G and eIF3 by insulin. Embo J 25, 1659-1668
22.
Lagirand-Cantaloube, J., Offner, N., Csibi, A., Leibovitch, M. P., Batonnet-Pichon, S., Tintignac, L. A., Segura, C. T., and Leibovitch, S. A. (2008) The initiation factor eIF3-f is a major target for atrogin1/MAFbx function in skeletal muscle atrophy. Embo J 27, 1266-1276
23.
Hui, D. J., Bhasker, C. R., Merrick, W. C., and Sen, G. C. (2003) Viral stress-inducible protein p56 inhibits translation by blocking the interaction of eIF3 with the ternary complex eIF2.GTP.Met-tRNAi. J Biol Chem 278, 39477-39482
Figure legends Figure 1. Immunohistochemical analysis of EIF3D expression in human glioma tissues. Representative photographs are shown of positive EIF3D immunostaining (arrows) in WHO grade II and III gliomas. Magnification, ×200.
Figure 2. Lentivirus stably expressing shRNA targeting EIF3D is successfully constructed. (A) The mRNA levels of EIF3D in five glioma cell lines were determined by qRT-PCR. (B) Infection was observed to be efficient at 96 h and over 80% U251 and U87MG cells presented to be GFP positive in Con, Lv-shCon and Lv-shEIF3D groups.
Magnification,
×100. (C,E) The mRNA levels of EIF3D in U251 and U87MG cells were analyzed by qRT-PCR. Actin gene was used as internal control. (D,F) The protein expression levels of
This article is protected by copyright. All rights reserved.
Accepted Article
EIF3D in U251 and U87MG cells were analyzed by western blot analysis. GAPDH was used as internal control. ***P
