Environment Health Techniques RNAIII suppresses the expression of LtaS
1
Research Paper RNAIII suppresses the expression of LtaS via acting as an antisense RNA in Staphylococcus aureus Jun Yan*, Yu Liu*, Yaping Gao, Jie Dong, Chunhua Mu, Di Li and Guang Yang Beijing Institute of Basic Medical Sciences, 27 Taiping Road, Beijing 100850, P. R. China
RNAIII is known as the key effector of staphylococcal accessory gene regulator (agr) quorumsensing system, which plays a central role in the pathogenesis of Staphylococcus aureus. As a regulatory RNA, RNAIII regulates multiple targets, including exoproteins and cell-wall-associated proteins. Lipoteichoic acid synthase (LtaS) is involved in the synthesis of lipoteichoic acid (LTA) that is one of the major components of cell wall. The chemical compound targeting to LtaS decreases S. aureus growth via blocking LTA production. Until now, the regulatory mechanism of LtaS expression is still not clear. The level of ltaS mRNA in S. aureus is analyzed by semi-quantitative RT-PCR analysis and qRT-PCR. The protein level of LtaS is determined by Western blotting. The putative interaction sites between RNAIII and LtaS mRNA are predicted. And LtaS-50 UTR-lacZ and LtaS-50 UTR-mutant-lacZ reporter vectors are constructed according to the putative interaction sites. Our data show that the expression of ltaS is regulated by RNAIII in S. aureus. The level of LtaS is significantly higher in the RNAIII deficient strain compared to its parent strain. In the further investigation, 50 UTR of ltaS was predicted to be the putative interaction site of RNAIII. The results of detection of b-galactosidase activities suggest that RNAIII can inhibit the expression level of LtaS through acting on the 50 UTR region of LtaS mRNA. Our finding presents that LtaS is another target of RNAIII and RNAIII suppresses the expression of LtaS via acting as an antisense RNA in S. aureus. Keywords: RNAIII / LtaS / Staphylococcus aureus Received: April 25, 2014; accepted: August 22, 2014 DOI 10.1002/jobm.201400313
Introduction Staphylococcus aureus causes a wide spectrum of diseases and is one of the main causes of community- as well as hospital-acquired infections, with methicillin-resistant S. aureus posing a serious public health threat [1, 2]. The broad range of infections caused by S. aureus is related to a number of virulence factors that allow it to adhere to surface, invade or avoid the immune system, and cause harmful toxic effects to the host [3–5]. The expression of most S. aureus virulence factors is controlled by the agr locus, which encodes a two-component signaling pathway [6, 7]. RNAIII is the intracellular effector of agr system that temporally controls a large number of virulence
These authors contributed equally to this work. Correspondence: Guang Yang, Beijing Institute of Basic Medical Sciences, 27 Taiping Road, Beijing 100850, P. R. China E-mail: [email protected] Phone/Fax: 86 10 68163140
ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
factors, including exoproteins and cell-wall-associated proteins by acting as a regulatory RNA [1, 8–10]. Lipoteichoic acid (LTA) is a glycerol phosphate surface polymer, which is the major component of the cell wall of gram-positive bacteria. Moreover, LTA is involved in the bacterium-host cell interaction as a major immunostimulatory component of S. aureus and has recently been shown to be required for cell growth and division [11–13]. Lipoteichoic acid synthase (LtaS) is a integrated membrane protein with five N-terminal transmembrane helices followed by a large extracellular part (eLtaS), is required for staphylococcal growth and LTA synthesis [14]. Recently, it has been reported that the chemical compound targeting to LtaS can suppress the synthesis of LTA and the growth of S. aureus. Meanwhile, this compound protects mice from S. aureus infection [15]. However, the regulatory mechanism of LtaS expression is still unknown. Here, we identified that the level of LtaS is increased in S. aureus with the deletion of RNAIII. Our further
www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–7
2
Jun Yan et al.
investigation showed that RNAIII could act on the 50 UTR of ltas mRNA and suppress the expression of LtaS.
Material and methods Bacterial strains and growth conditions The strains used in this study are listed in Table 1. Strains were grown in 5 ml of brain heart infusion (BHI) medium (BD) at 37 °C for 12 h with shaking at 200 rpm in a 25-ml test tube. Cells from 1 ml of pre-culture were transferred to 100 ml of BHI medium in a 500-ml flask and incubated at 37 °C on a rotary shaker at 200 rpm with no antibiotics, or with 25 mg ml1 erythromycin, 50 mg ml1 kanamycin, and 40 mg ml1 chloramphenicol. RT-PCR Total bacterial RNA was extracted from S. aureus, which were grown with shaking at 37 °C using Trizol (Invitrogen) as previously described [16]. DNase digestion of 80 ml of total RNA was performed with 10 U of RNase-free DNase I (Promega) and 10 ml of the 10 reaction buffers in a total reaction volume of 100 ml for 30 min at 37 °C. For cDNA synthesis, 1 mg of total RNA was mixed with 500 ng of random hexamer (Promega). Samples were incubated at 65 °C for 10 min with 5 ml of 5 first-strand buffer, 2 ml of 5 mM dNTP, 20 U of RNasin (Takara), 1 ml of M-MLV reverse transcriptase (Promega), and distilled water to a total volume of 25 ml. The PCR reaction mixture contained 12.5 ml of 2 PCR mix (GenePharma), 0.3 mM of gene-specific forward and reverse primers, and 1 ml of template, made up to a final volume of 25 ml with distilled water. The primers are shown in Table 2. Cycling parameters were set as follows: initial activation step at 95 °C for 10 min, denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, and extension at 72 °C for 40 s. 16S rRNA was used as the
endogenous reference gene. All samples were amplified in triplicate. Quantitative PCR (qPCR) The qPCR reaction mixture contained 12.5 ml of 2 SYBR green PCR mix (Fermentas), 0.5 mM of gene-specific forward and reverse primers, and 0.5 ml of template, made up to a final volume of 25 ml with distilled water. Cycling parameters were set as follows: initial activation step at 95 °C for 15 min, denaturation at 95 °C for 10 s, annealing at 58°C for 30 s, and extension at 72 °C for 20 s. Melting curve analysis was performed at from 58 to 95 °C with stepwise fluorescence acquisition at every 1 °C s1. Melting curves observed for each gene were confirmed to correspond to the correct amplicon size by agarose gel electrophoresis of the PCR products. The levels of gene expression were calculated by relative quantification using gyrb as the endogenous reference gene. All samples were amplified in triplicate and the data analysis was carried out using the MxPro qPCR system software (Stratagene). Preparation of S. aureus proteins The cell extract was prepared as follows. Cells were grown with shaking at 37 °C at 200 rpm. Equal numbers of cells were collected at indicated time and then resuspended in 100 ml Tris–EDTA buffer containing lysostaphin (100 mg ml1, Sigma–Aldrich). After incubation for 30 min at 37 °C, the mixture was sonicated on ice three times for 30 s each. Protein samples (15 ml) were mixed with SDS–PAGE loading buffer and then subjected to 15% SDS–PAGE. Extracellular protein profiles were determined as follows. Briefly, S. aureus cells were grown at 37 °C and growth culture was centrifuged at 6000g for 10 min at 4 °C. The supernatant was collected and filtered through a 0.22 mm filter to remove residual cells. Culture
Table 1. Bacterial strains and plasmids. Strain or plasmid Strains S. aureus 8325-4 COL RNAIII-m RNAIII-r E. coli DH5a Plasmids pOS1 pOS1-lacZ pOS1-UltaS-lacZ pOS1-mUltaS-lacZ
Comments
Source or reference
Wild-type Clinical isolate 8325-4 with a rnaIII::kan mutation, KanR The restoration of RNAIII activity in RNAIII-m, EmrR
[31] Dr. William M. Shafer [23] [23]
A host strain for cloning
Transgene
E. coli–S. aureus shuttle vector, CmR pOS1 contains a copy of lacZ encoding b-galactosidase without promoter and 5‘UTR UTR of ltaS-lacZ fusion (UltaS::lacZ) shuttle vector, a derivative of pOS1 UTR of mutant ltaS-lacZ fusion (mUltaS::lacZ) shuttle vector, a derivative of pOS1
[32] [23] This study This study
ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–7
RNAIII suppresses the expression of LtaS
3
Table 2. Primers. Primer/sequence
Oligonucleotide sequence (50 –30 )
16S RTF 16S R UltaS-lacZF UltaS-lacZR mUltaS-lacZR RNAIIIF RNAIIIR LtaS RTF LtaS RTR RNAIII RTF RNAIII RTR Up-RNAIIIF-EcoRI Up-RNAIIIR-KpnI DownRNAIIIF-KpnI Down-RNAIIIR-SalI rs-RNAIIIF rs-RNAIIIR gyrb RTF gyrb RTR
GCCTAATACATGCAAGT CATGTTATCCGGCATTAG GATATGCATGAATTCAATAATACTGTGTTTTATCT ATCATCGCGGATCCCCCTTTTTTTGTGAACTCAT TTTTTGTGAACTCATGATTCTTATTTTCGTTATTA AGATCACAGAGATGTGATGG CAAAAGGCCGCGAGCTTGGG TTAGCCAACTGAATCTGC GATGCCTCTTTCACTTTT CCTAGATCACAGAGATGTGATGG AATACATAGCACTGAGTCCAAGG CATCCGGAATTCTATTACTAAAGGTAAAAGTA ATTACAGGTACCAGTTATATTAAAACATGCTA ATAACTGGTACCTGTAATGAAGAAGGGATGAG ACACGCGTCGACATGATTTACGTTTTCCAGAA TCTAGATAGTCGACATTTACCTATATTTTTAGCT GATATGCATGAATTCGCCCGAAATAATATTTAACA TTATGGTGCTGGGCAAATACA CACCATGTAAACCACCAGATA
supernatant from equal numbers of cells was precipitated by adjusting filtered supernatants to 10% tricarboxylic acid (TCA) and incubated at 4 °C for 4 h. After centrifugation (12,000 g, 10 min), precipitated proteins were washed twice in ice-cold 96% ethanol, air dried. The proteins were resolved in an appropriate volume of a solution containing 7 M urea, 2 M thiourea. Protein samples (15 ml) were mixed with SDS–PAGE loading buffer and then subjected to 15% SDS–PAGE. Western blotting !?A3B2 tlsb=-.01w?>The protein samples were subjected to 15% SDS–PAGE and the proteins were blotted onto Hybond-ECL nitrocellulose membrane (Amersham Biosciences). The membrane was blocked in 5% non-fat dry milk at 37 °C for 2 h, probed with1:500 diluted polyclonal rabbit anti-eLtaS antibodies (prepared by ourselves) for 1 h at room temperature, and washed twice in PBS with 0.5% Tween 20 (PBST). Then the membrane was incubated in a 1:5000 solution of HRP-conjugated goat anti-rabbit secondary antibody at room temperature for 1 h. After further washing with PBST, the membrane was assayed by the enhanced chemiluminescence (ECL) Western blotting detection system. Construction of lacZ reporter vector The UltaS fragment was amplified by PCR from S. aureus 8325-4 chromosomal DNA with primers UltaS-lacZF and UltaS-lacZR and the mUltaS fragment was amplified with primers UltaS-lacZF and mUltaS-lacZR (Table 2). The PCR products were ligated into EcoRI and BamHI-digested pOS1-lacZ plasmid DNA resulting in the in-frame fusion ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
of lacZ to the amplified fragments. The recombinant plasmids were transformed into DH5a, then electrotransfected to S. aureus RN4220. The plasmid was isolated from RN4220, then electrotransfected S. aureus 8325-4 and DRNAIII. b-Galactosidase assay S. aureus cells containing lacZ fusions were grown in BHI broth as described above, and 1 ml culture was centrifuged. The cells were prepared for the assay as described before with some modification [17]. Briefly, the pellet was washed in PBS, and then the cells were adjusted to an OD600nm of 1 in a volume of 500 ml. The cells were sedimented by centrifugation and the pellet was resuspended in 500 ml lysis buffer (0.01 M potassium phosphate buffer, pH 7.8, 0.015 M EDTA, 1% Triton X-100) containing lysostaphin at the final concentration of 20 mg ml1, and incubated at 37 °C for 30 min, with gentle shaking. The culture was centrifuged at 20,000g for 30 min. The supernatant was subjected to galactosidase assays according to the method described by Miller [18]. Construction of RNAIII deletion mutant (DRNAIII) The mutant was constructed using the method described previously [23]. In order to create a deletion mutant of RNAIII in the chromosome of 8325-4, two regions of DNA flanking the RNAIII gene were amplified by PCR using the primers (Up-RNAIIIF-EcoRI and Up-RNAIIIR-KpnI; DownRNAIIIF-KpnI and Down-RNAIIIR-SalI) with restriction sites listed in Table 2. The upstream fragment (502 bp) was digested with EcoRI and KpnI, and the downstream fragment (591 bp) was digested with KpnI and SalI. The
www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–7
4
Jun Yan et al.
two fragments were cloned together into pMD19T digested with EcoRI and SalI. The resulting construct was digested with KpnI, and then a 1.6-kb kanamycin cassette, which was amplified from the plasmid of pTZTRAP::kan provided by Dr. Balaban N was inserted. The resulting plasmid was digested with EcoRI and SalI, and a fragment harboring kanamycin resistance between the upstream and downstream fragments was ligated into pAUL-A digested with EcoRI and SalI to create plasmid pAUL-A-DRNAIII. pAUL-A has a temperature-sensitive origin of replication that is active in S. aureus at 30 °C but not at 42 °C. The recombinant plasmid initially isolated from Escherichia coli, was introduced into S. aureus RN4220 by electroporation and colonies resistant to kanamycin and erythromycin were selected after growth at 30 °C. The resistant clones were subjected to a temperature shift to 42 °C to select the plasmid integration into the chromosome. Bacteria resistant to kanamycin but sensitive to erythromycin were selected. The mutation was confirmed by PCR, and followed by transduction into strains 8325-4 with phageF11 to create the mutant strains (RNAIII-m) from which the coding region of RNAIII was deleted (Table 1). Restoring RNAIII activity Primers rs-RNAIIIF and rs-RNAIIIR (listed in Table 2) were designed to PCR-amplify a 1096 bp fragment encompassing the gene encoding for RNAIII, the promoter region and termination site with SalI/EcoRI sites. S. aureus 8325-4 chromosomal DNA was used as the template. The PCR product (“whole RNAIII”) was digested and cloned into the SalI/EcoRI digested pMAD, which could replicate in E. coli at 37 °C and in S. aureus at 30 °C and could be used as a suicide vector when grown at 42 °C in S. aureus. The resulting plasmid (pMAD-rs-RNAIII) was transformed into E. coli DH5a. Cells were selected on LB plates containing 100 mg ml1 ampicillin. Plasmid was isolated from positive clones and used to transform S. aureus RN4220 cells. The transformants were selected on tryptic soy agar plates containing 10 mg ml1 erythromycin at 30 °C. Then the plasmid was isolated from the positive clone (RN4220 containing pMAD-rs-RNAIII) and transformed to DRNAIII-8325. The transformants were selected on tryptic soy agar plates containing 10 mg ml1 erythromycin at 30 °C for 48 h, and then transferred to 42 °C for 12 h. The restoring colonies (RNAIIIr) were confirmed by PCR (primers:rs-RNAIIIF/rs-RNAIIIR) and RT-PCR (primers:RNAIII RT-F/RNAIII RT-R) (Table 2). Statistical analysis All quantitative data were analyzed using Student t-tests. p < 0.05 was considered to be statistically significant. ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
Results RNAIII down-regulates the expression of LtaS S. aureus LtaS is a membrane integrated protein. The expression of several membrane proteins is negatively regulated by RNAIII. RNAIII has been identified to regulate the target mRNAs at post-exponential phase and stationary phase [19, 20]. So, we compared the level of ltaS in the RNAIII mutant (RNAIII-m) with its parent strain (8325-4) at exponential phase (6 h) and stationary phase (12 h). The results showed that the level of ltaS was increased in the RNAIII-m strain at the two phases. Meanwhile, the level of ltaS could be recovered in the RNAIII restored strain (RNAIII-r) (Fig. 1A). Given that the level of RNAIII at lag phase of S. aureus growth is lower than post-exponential phase, we compared the level of ltaS at these two growth phases in 8325-4 and COL. It was
Figure 1. ltaS mRNA was gradually elevated in the S. aureus strain with RNAIII deletion. (A) Detection of the level of ltaS in different strains. Total RNAs of S. aureus 8325-4 and RNAIII mutant (RNAIII-m) cultured for 6 and 12 h were extracted, and the levels of ltas mRNA and RNAIII were detected by RT-PCR. 16s rRNA was used as the endogenous reference gene. The results represented a mean of three independent experiments. (B, C) Detection of the level of ltas at the different growth phases in two strains. Total RNA at lag phase and post-exponential (post-exp) phase from 8325-4 (B) and COL (C) was extracted. And the level of ltaS mRNA was determined by qPCR.
www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–7
RNAIII suppresses the expression of LtaS
showed that the level of ltaS was negatively correlated with the level of RNAIII in two strains (Fig. 1B and C). S. aureus peptidase SpsB can hydrolyze the residues 215 Ala-Leu-Ala217 of LtaS to release eLtaS into the supernatant [21, 22]. In the further investigation, specific antibodies against eLtaS were prepared following the expression and purification of eLtaS proteins. And then the expression levels of eLtaS in the supernatant or bacterial total proteins of different S. aureus strains were detected using Western blotting. Compared to its parent strain, the level of eLtaS in the supernatant and bacterial total proteins was significantly increased in RNAIII mutant strain. Moreover, the restoration of eLtaS was observed in the RNAIII restored strain (RNAIII-r) (Fig. 2).
5
Figure 3. Sequence alignment and schematic diagram of construction of reporter vectors. The sequence similarities between RNAIII and 50 UTR of ltas mRNA were analyzed. Some nucleotides in 50 UTR of ltas mRNA were replaced to disrupt the formation of duplex between RNAIII and ltas mRNA.
RNAIII acts on the 50 UTR of ltas mRNA RNAIII functions as a regulatory RNA through acting on the target mRNA to regulate the translation and mRNA stabilization of targets [8, 9, 19, 23]. In our further investigation, the sequence similarities between RNAIII and ltas mRNA were analyzed. It was predicted that the 428–444 nt of RNAIII [19, 24] could form duplex with the 50 UTR of ltas mRNA (Fig. 3). Then the 50 UTR of ltas mRNA was fused with lacZ and the fusion was transformed into WT (8325-4) strain and RNAIII-m strain, respectively. The b-galactosidase activities of UltaS-lacZ in RNAIII-m strain were significantly higher than that in WT strain (Fig. 4). To further verify whether LtaS expression was regulated by RNAIII, the mutant of ltas mRNA with point substitution disrupting the base-pairing sites (Fig. 3) was fused with lacZ and the fusion vector was transformed into WT and RNAIII-m strains. It was found that the bgalactosidase activities of mUltaS-lacZ were not signifi-
Figure 2. eLtaS protein was gradually elevated in the supernatant and total proteins of S. aureus strain with RNAIII deletion. The supernatant or bacterial total proteins were extracted and the levels of eLtaS protein in different strains were detected by Western blotting. ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
Figure 4. Determination of the b-galactosidase activities in different strains. The fragment containing 50 UTR and the coding sequence of the first six amino acids of LtaS was fused with lacZ to generate reporter vector of UltaS-lacZ. The mutant fragment was fused with lacZ to generate reporter vector of mUltaS-lacZ. The activities of b-galactosidase was determined in the RNAIII-m (RNAIII mutant strain) and WT (8325-4) strains. The results represented a mean of three independent experiments.
www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–7
6
Jun Yan et al.
cantly altered in the RNAIII-m and its parent strains (Fig. 4). All these results suggested that RNAIII might act on the 50 UTR of ltaS and regulate the expression of ltaS.
blocking RNAIII may aggravate the infection. Both cell membrane proteins and secreted toxins usually are involved in the pathogenesis of S. aureus, so it may be not feasible to inhibit S. aureus infection via targeting to RNAIII.
Discussion LtaS plays an essential role in LTA synthesis and the growth of S. aureus. And the regulation of the expression of LtaS is unknown. In the present study, we reveal that RNAIII can act on the 50 UTR of ltaS mRNA to regulate the expression of LtaS. Our investigation elucidates that LtaS is a new target of RNAIII. LTA is one of major envelope components of Grampositive bacteria [25]. S. aureus LTA is a polymer of 1,3linked glycerol phosphate subunits that are tethered to Glc2-DAG, which is conserved in several human pathogens, including B. anthracis, Enterococcus faecalis, Listeria monocytogenes, and Streptococcus agalactiae [26, 27]. Besides as the component of the envelope, LTA released from bacteria can bind to target cells, either non-specifically, to membrane phospholipids, or specifically, to CD14 and to Toll-like receptors and share endotoxin (lipopolysaccharide) many of its pathogenic properties [28]. There are three proteins identified to be involved in the synthesis of LTA (YpfP, LtaA, and LtaS) [11, 29, 30]. Deletion of LtaS from genome of S. aureus leads to reduction of LTA biosynthesis and slow growth [11]. So blocking the activities of LtaS may inhibit S. aureus infection. Richter et al. [15] has reported that the chemical compounds targeting to LtaS could protect mice from S. aureus infection. RNAIII is a 514 nt RNA molecule that contains 14 hairpin structures connected by unpaired nucleotides [19]. Besides it contains the coding region of d-hemolysin, it acts a regulatory RNA to regulate the expression of several targets at post-transcriptional stage [1]. The targets of RNAIII include the secreted proteins and cell membrane protein [1, 8–10]. It is of note that RNAIII usually downregulates the expression of cell membrane targets, but upregulates the expression of secreted proteins [8–10]. LtaS is a cell membrane protein. Our data showed that RNAIII negatively regulated the expression of LtaS, which is in accordance with other cell membrane targets. Combined with previous results of other groups, the data suggest that the RNAIII plays the different role in the different types of diseases caused by S. aureus. If secreted toxins regulated by RNAIII are foremost for the disease, blocking RNAIII will decrease the infection. On the other hands, when the cell membrane targets regulated by RNAIII are essential for the disease, ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
Acknowledgments This work was supported by grants from Chinese National Natural Science Funds (http://www.nsfc.gov.cn) (31370170 and 31170074).
Conflict of interests statement The authors declare that they have no competing financial interests.
References [1] Chevalier, C., Boisset, S., Romilly, C., Masquida, B. et al., 2010. Staphylococcus aureus RNAIII binds to two distant regions of coa mRNA to arrest translation and promote mRNA degradation. PLoS Pathog., 6, e1000809. [2] Liu, C.I., Liu, G.Y., Song, Y., Yin, F. et al., 2008. A cholesterol biosynthesis inhibitor blocks Staphylococcus aureus virulence. Science, 319, 1391–1394. [3] Bien, J., Sokolova, O., Bozko, P., 2011. Characterization of virulence factors of Staphylococcus aureus: novel function of known virulence factors that are implicated in activation of airway epithelial proinflammatory response. J. Pathog., 2011, 601905. [4] Lowy, F.D., 1998. Staphylococcus aureus infections. N. Engl. J. Med., 339, 520–532. [5] Holmes, A., Ganner, M., McGuane, S., Pitt, T.L. et al., 2005. Staphylococcus aureus isolates carrying Panton-Valentine leucocidin genes in England and Wales: frequency, characterization, and association with clinical disease. J. Clin. Microbiol., 43, 2384–2390. [6] Jarraud, S., Mougel, C., Thioulouse, J., Lina, G. et al., 2002. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (Alleles), and human disease. Infect. Immun., 70, 631–641. [7] Cheung, A.L., Eberhardt, K.J., Chung, E., Yeaman, M.R. et al., 1994. Diminished virulence of a sar-/agr-mutant of Staphylococcus aureus in the rabbit model of endocarditis. J. Clin. Invest., 94, 1815–1822. [8] Novick, R.P., Ross, H.F., Projan, S.J., Kornblum, J. et al., 1993. Synthesis of staphylococcal virulence factors is controlled by a regulatory RNA molecule. EMBO J., 12, 3967–3975. [9] Morfeldt, E., Taylor, D., von Gabain, A., Arvidson, S., 1995. Activation of alpha-toxin translation in Staphylococcus aureus by the trans-encoded antisense RNA, RNAIII. EMBO J., 14, 4569–4577.
www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–7
RNAIII suppresses the expression of LtaS
[10] Boisset, S., Geissmann, T., Huntzinger, E., Fechter, P. et al., 2007. Staphylococcus aureus RNAIII coordinately represses the synthesis of virulence factors and the transcription regulator Rot by an antisense mechanism. Genes Dev., 21, 1353–1366. [11] Gründling, A., Schneewind, O., 2007. Synthesis of glycerol phosphate lipoteichoic acid in Staphylococcus aureus. Proc. Natl. Acad. Sci. USA, 104, 8478–8483. [12] Oku, Y., Kurokawa, K., Matsuo, M., Yamada, S. et al., 2009. Pleiotropic roles of polyglycerolphosphate synthase of lipoteichoic acid in growth of Staphylococcus aureus cells. J. Bacteriol., 191, 141–151. [13] Morath, S., Geyer, A., Hartung, T., 2001. Structure– function relationship of cytokine induction by lipoteichoic acid from Staphylococcus aureus. J. Exp. Med., 193, 393–398. [14] Lu, D., Wörmann, M.E., Zhang, X., Schneewind, O. et al., 2009. Structure-based mechanism of lipoteichoic acid synthesis by Staphylococcus aureus LtaS. Proc. Natl. Acad. Sci. USA, 106, 1584–1589. [15] Richter, S.G., Elli, D., Kim, H.K., Hendrickx, A.P. et al., 2013. Small molecule inhibitor of lipoteichoic acid synthesis is an antibiotic for gram-positive bacteria. Proc. Natl. Acad. Sci. USA, 110, 3531–3536. [16] Korem, M., Gov, Y., Kiran, M.D., Balaban, N., 2005. Transcriptional profiling of target of RNAIII-activating protein, a master regulator of Staphylococcal virulence. Infect. Immun., 73, 6220–6228. [17] Harraghy, N., Kormanec, J., Wolz, C., Homerova, D. et al., 2005. Sae is essential for expression of the staphylococcal adhesins Eap and Emp. Microbiology, 151, 1789–1800. [18] Miller, J.H., 1972. Experiments in molecular genetics, in: Miller, J. H. (Ed.), Assays of Lac Operon Enzymes: bGalactosidase Permease, Repressor, Transacetylase, a Complementation, Cold Spring Harbor Laboratory Press, NY, 352–355. [19] Benito, Y., Kolb, F.A., Romby, P., Lina, G. et al., 2000. Probing the structure of RNAIII, the Staphylococcus aureus agr regulatory RNA, and identification of the RNA domain involved in repression of protein A expression. RNA, 6, 668–679. [20] Huntzinger, E., Boisset, S., Saveanu, C., Benito, Y. et al., 2005. Staphylococcus aureus RNAIII and the endoribonu-
ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
7
clease III coordinately regulate spa gene expression. EMBO J., 24, 824–835. [21] Karatsa-Dodgson, M., Wörmann, M.E., Gründling, A., 2010. In vitro analysis of the Staphylococcus aureus lipoteichoic acid synthase enzyme using fluorescently labeled lipids. J. Bacteriol., 192, 5341–5349. [22] Wörmann, M.E., Reichmann, N.T., Malone, C.L., Horswill, A.R. et al., 2011. Proteolytic cleavage inactivates the Staphylococcus aureus lipoteichoic acid synthase. J. Bacteriol., 193, 5279–5291. [23] Liu, Y., Mu, C., Ying, X., Li, W. et al., 2011. RNAIII activates map expression by forming an RNA–RNA complex in Staphylococcus aureus. FEBS Lett., 585, 899–905. [24] Geisinger, E., Adhikari, R.P., Jin, R., Ross, H.F. et al., 2006. Inhibition of rot translation by RNAIII, a key feature of agr function. Mol. Microbiol., 61, 1038–1048. [25] van de Wetering, J.K., van Eijk, M., van Golde, L.M., Hartung, T. et al., 2001. Characteristics of surfactant protein A and D binding to lipoteichoic acid and peptidoglycan, 2 major cell wall components of grampositive bacteria. J. Infect. Dis., 184, 1143–1151. [26] Fischer, W., Mannsfeld, T., Hagen, G., 1990. On the basic structure of poly(glycerophosphate) lipoteichoic acids. Biochem. Cell Biol., 68, 33–43. [27] McCarty, M., Morse, S.I., 1964. Cell wall antigens of grampositive bacteria. Adv. Immunol., 27, 249–286. [28] Ginsburg, I., 2002. Role of lipoteichoic acid in infection and inflammation. Lancet Infect. Dis., 2, 171–179. [29] Kiriukhin, M.Y., Debabov, D.V., Shinabarger, D.L., Neuhaus, F.C., 2001. Biosynthesis of the glycolipid anchor in lipoteichoic acid of Staphylococcus aureus RN4220: role of YpfP, the diglucosyldiacylglycerol synthase. J. Bacteriol., 183, 3506–3514. [30] Gründling, A., Schneewind, O., 2007. Genes required for glycolipid synthesis and lipoteichoic acid anchoring in Staphylococcus aureus. J. Bacteriol., 189, 2521–2530. [31] Novick, R.P., 1967. Properties of a cryptic high-frequency transducing phage in Staphylococcus aureus. Virology, 33, 155–166. [32] Schneewind, O., Mihaylova-Petkov D., Model P., 1993. Cell wall sorting signals in surface proteins of gram-positive bacteria. EMBO J., 12, 4803–4811.
www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–7
1
Research Paper RNAIII suppresses the expression of LtaS via acting as an antisense RNA in Staphylococcus aureus Jun Yan*, Yu Liu*, Yaping Gao, Jie Dong, Chunhua Mu, Di Li and Guang Yang Beijing Institute of Basic Medical Sciences, 27 Taiping Road, Beijing 100850, P. R. China
RNAIII is known as the key effector of staphylococcal accessory gene regulator (agr) quorumsensing system, which plays a central role in the pathogenesis of Staphylococcus aureus. As a regulatory RNA, RNAIII regulates multiple targets, including exoproteins and cell-wall-associated proteins. Lipoteichoic acid synthase (LtaS) is involved in the synthesis of lipoteichoic acid (LTA) that is one of the major components of cell wall. The chemical compound targeting to LtaS decreases S. aureus growth via blocking LTA production. Until now, the regulatory mechanism of LtaS expression is still not clear. The level of ltaS mRNA in S. aureus is analyzed by semi-quantitative RT-PCR analysis and qRT-PCR. The protein level of LtaS is determined by Western blotting. The putative interaction sites between RNAIII and LtaS mRNA are predicted. And LtaS-50 UTR-lacZ and LtaS-50 UTR-mutant-lacZ reporter vectors are constructed according to the putative interaction sites. Our data show that the expression of ltaS is regulated by RNAIII in S. aureus. The level of LtaS is significantly higher in the RNAIII deficient strain compared to its parent strain. In the further investigation, 50 UTR of ltaS was predicted to be the putative interaction site of RNAIII. The results of detection of b-galactosidase activities suggest that RNAIII can inhibit the expression level of LtaS through acting on the 50 UTR region of LtaS mRNA. Our finding presents that LtaS is another target of RNAIII and RNAIII suppresses the expression of LtaS via acting as an antisense RNA in S. aureus. Keywords: RNAIII / LtaS / Staphylococcus aureus Received: April 25, 2014; accepted: August 22, 2014 DOI 10.1002/jobm.201400313
Introduction Staphylococcus aureus causes a wide spectrum of diseases and is one of the main causes of community- as well as hospital-acquired infections, with methicillin-resistant S. aureus posing a serious public health threat [1, 2]. The broad range of infections caused by S. aureus is related to a number of virulence factors that allow it to adhere to surface, invade or avoid the immune system, and cause harmful toxic effects to the host [3–5]. The expression of most S. aureus virulence factors is controlled by the agr locus, which encodes a two-component signaling pathway [6, 7]. RNAIII is the intracellular effector of agr system that temporally controls a large number of virulence
These authors contributed equally to this work. Correspondence: Guang Yang, Beijing Institute of Basic Medical Sciences, 27 Taiping Road, Beijing 100850, P. R. China E-mail: [email protected] Phone/Fax: 86 10 68163140
ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
factors, including exoproteins and cell-wall-associated proteins by acting as a regulatory RNA [1, 8–10]. Lipoteichoic acid (LTA) is a glycerol phosphate surface polymer, which is the major component of the cell wall of gram-positive bacteria. Moreover, LTA is involved in the bacterium-host cell interaction as a major immunostimulatory component of S. aureus and has recently been shown to be required for cell growth and division [11–13]. Lipoteichoic acid synthase (LtaS) is a integrated membrane protein with five N-terminal transmembrane helices followed by a large extracellular part (eLtaS), is required for staphylococcal growth and LTA synthesis [14]. Recently, it has been reported that the chemical compound targeting to LtaS can suppress the synthesis of LTA and the growth of S. aureus. Meanwhile, this compound protects mice from S. aureus infection [15]. However, the regulatory mechanism of LtaS expression is still unknown. Here, we identified that the level of LtaS is increased in S. aureus with the deletion of RNAIII. Our further
www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–7
2
Jun Yan et al.
investigation showed that RNAIII could act on the 50 UTR of ltas mRNA and suppress the expression of LtaS.
Material and methods Bacterial strains and growth conditions The strains used in this study are listed in Table 1. Strains were grown in 5 ml of brain heart infusion (BHI) medium (BD) at 37 °C for 12 h with shaking at 200 rpm in a 25-ml test tube. Cells from 1 ml of pre-culture were transferred to 100 ml of BHI medium in a 500-ml flask and incubated at 37 °C on a rotary shaker at 200 rpm with no antibiotics, or with 25 mg ml1 erythromycin, 50 mg ml1 kanamycin, and 40 mg ml1 chloramphenicol. RT-PCR Total bacterial RNA was extracted from S. aureus, which were grown with shaking at 37 °C using Trizol (Invitrogen) as previously described [16]. DNase digestion of 80 ml of total RNA was performed with 10 U of RNase-free DNase I (Promega) and 10 ml of the 10 reaction buffers in a total reaction volume of 100 ml for 30 min at 37 °C. For cDNA synthesis, 1 mg of total RNA was mixed with 500 ng of random hexamer (Promega). Samples were incubated at 65 °C for 10 min with 5 ml of 5 first-strand buffer, 2 ml of 5 mM dNTP, 20 U of RNasin (Takara), 1 ml of M-MLV reverse transcriptase (Promega), and distilled water to a total volume of 25 ml. The PCR reaction mixture contained 12.5 ml of 2 PCR mix (GenePharma), 0.3 mM of gene-specific forward and reverse primers, and 1 ml of template, made up to a final volume of 25 ml with distilled water. The primers are shown in Table 2. Cycling parameters were set as follows: initial activation step at 95 °C for 10 min, denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, and extension at 72 °C for 40 s. 16S rRNA was used as the
endogenous reference gene. All samples were amplified in triplicate. Quantitative PCR (qPCR) The qPCR reaction mixture contained 12.5 ml of 2 SYBR green PCR mix (Fermentas), 0.5 mM of gene-specific forward and reverse primers, and 0.5 ml of template, made up to a final volume of 25 ml with distilled water. Cycling parameters were set as follows: initial activation step at 95 °C for 15 min, denaturation at 95 °C for 10 s, annealing at 58°C for 30 s, and extension at 72 °C for 20 s. Melting curve analysis was performed at from 58 to 95 °C with stepwise fluorescence acquisition at every 1 °C s1. Melting curves observed for each gene were confirmed to correspond to the correct amplicon size by agarose gel electrophoresis of the PCR products. The levels of gene expression were calculated by relative quantification using gyrb as the endogenous reference gene. All samples were amplified in triplicate and the data analysis was carried out using the MxPro qPCR system software (Stratagene). Preparation of S. aureus proteins The cell extract was prepared as follows. Cells were grown with shaking at 37 °C at 200 rpm. Equal numbers of cells were collected at indicated time and then resuspended in 100 ml Tris–EDTA buffer containing lysostaphin (100 mg ml1, Sigma–Aldrich). After incubation for 30 min at 37 °C, the mixture was sonicated on ice three times for 30 s each. Protein samples (15 ml) were mixed with SDS–PAGE loading buffer and then subjected to 15% SDS–PAGE. Extracellular protein profiles were determined as follows. Briefly, S. aureus cells were grown at 37 °C and growth culture was centrifuged at 6000g for 10 min at 4 °C. The supernatant was collected and filtered through a 0.22 mm filter to remove residual cells. Culture
Table 1. Bacterial strains and plasmids. Strain or plasmid Strains S. aureus 8325-4 COL RNAIII-m RNAIII-r E. coli DH5a Plasmids pOS1 pOS1-lacZ pOS1-UltaS-lacZ pOS1-mUltaS-lacZ
Comments
Source or reference
Wild-type Clinical isolate 8325-4 with a rnaIII::kan mutation, KanR The restoration of RNAIII activity in RNAIII-m, EmrR
[31] Dr. William M. Shafer [23] [23]
A host strain for cloning
Transgene
E. coli–S. aureus shuttle vector, CmR pOS1 contains a copy of lacZ encoding b-galactosidase without promoter and 5‘UTR UTR of ltaS-lacZ fusion (UltaS::lacZ) shuttle vector, a derivative of pOS1 UTR of mutant ltaS-lacZ fusion (mUltaS::lacZ) shuttle vector, a derivative of pOS1
[32] [23] This study This study
ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–7
RNAIII suppresses the expression of LtaS
3
Table 2. Primers. Primer/sequence
Oligonucleotide sequence (50 –30 )
16S RTF 16S R UltaS-lacZF UltaS-lacZR mUltaS-lacZR RNAIIIF RNAIIIR LtaS RTF LtaS RTR RNAIII RTF RNAIII RTR Up-RNAIIIF-EcoRI Up-RNAIIIR-KpnI DownRNAIIIF-KpnI Down-RNAIIIR-SalI rs-RNAIIIF rs-RNAIIIR gyrb RTF gyrb RTR
GCCTAATACATGCAAGT CATGTTATCCGGCATTAG GATATGCATGAATTCAATAATACTGTGTTTTATCT ATCATCGCGGATCCCCCTTTTTTTGTGAACTCAT TTTTTGTGAACTCATGATTCTTATTTTCGTTATTA AGATCACAGAGATGTGATGG CAAAAGGCCGCGAGCTTGGG TTAGCCAACTGAATCTGC GATGCCTCTTTCACTTTT CCTAGATCACAGAGATGTGATGG AATACATAGCACTGAGTCCAAGG CATCCGGAATTCTATTACTAAAGGTAAAAGTA ATTACAGGTACCAGTTATATTAAAACATGCTA ATAACTGGTACCTGTAATGAAGAAGGGATGAG ACACGCGTCGACATGATTTACGTTTTCCAGAA TCTAGATAGTCGACATTTACCTATATTTTTAGCT GATATGCATGAATTCGCCCGAAATAATATTTAACA TTATGGTGCTGGGCAAATACA CACCATGTAAACCACCAGATA
supernatant from equal numbers of cells was precipitated by adjusting filtered supernatants to 10% tricarboxylic acid (TCA) and incubated at 4 °C for 4 h. After centrifugation (12,000 g, 10 min), precipitated proteins were washed twice in ice-cold 96% ethanol, air dried. The proteins were resolved in an appropriate volume of a solution containing 7 M urea, 2 M thiourea. Protein samples (15 ml) were mixed with SDS–PAGE loading buffer and then subjected to 15% SDS–PAGE. Western blotting !?A3B2 tlsb=-.01w?>The protein samples were subjected to 15% SDS–PAGE and the proteins were blotted onto Hybond-ECL nitrocellulose membrane (Amersham Biosciences). The membrane was blocked in 5% non-fat dry milk at 37 °C for 2 h, probed with1:500 diluted polyclonal rabbit anti-eLtaS antibodies (prepared by ourselves) for 1 h at room temperature, and washed twice in PBS with 0.5% Tween 20 (PBST). Then the membrane was incubated in a 1:5000 solution of HRP-conjugated goat anti-rabbit secondary antibody at room temperature for 1 h. After further washing with PBST, the membrane was assayed by the enhanced chemiluminescence (ECL) Western blotting detection system. Construction of lacZ reporter vector The UltaS fragment was amplified by PCR from S. aureus 8325-4 chromosomal DNA with primers UltaS-lacZF and UltaS-lacZR and the mUltaS fragment was amplified with primers UltaS-lacZF and mUltaS-lacZR (Table 2). The PCR products were ligated into EcoRI and BamHI-digested pOS1-lacZ plasmid DNA resulting in the in-frame fusion ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
of lacZ to the amplified fragments. The recombinant plasmids were transformed into DH5a, then electrotransfected to S. aureus RN4220. The plasmid was isolated from RN4220, then electrotransfected S. aureus 8325-4 and DRNAIII. b-Galactosidase assay S. aureus cells containing lacZ fusions were grown in BHI broth as described above, and 1 ml culture was centrifuged. The cells were prepared for the assay as described before with some modification [17]. Briefly, the pellet was washed in PBS, and then the cells were adjusted to an OD600nm of 1 in a volume of 500 ml. The cells were sedimented by centrifugation and the pellet was resuspended in 500 ml lysis buffer (0.01 M potassium phosphate buffer, pH 7.8, 0.015 M EDTA, 1% Triton X-100) containing lysostaphin at the final concentration of 20 mg ml1, and incubated at 37 °C for 30 min, with gentle shaking. The culture was centrifuged at 20,000g for 30 min. The supernatant was subjected to galactosidase assays according to the method described by Miller [18]. Construction of RNAIII deletion mutant (DRNAIII) The mutant was constructed using the method described previously [23]. In order to create a deletion mutant of RNAIII in the chromosome of 8325-4, two regions of DNA flanking the RNAIII gene were amplified by PCR using the primers (Up-RNAIIIF-EcoRI and Up-RNAIIIR-KpnI; DownRNAIIIF-KpnI and Down-RNAIIIR-SalI) with restriction sites listed in Table 2. The upstream fragment (502 bp) was digested with EcoRI and KpnI, and the downstream fragment (591 bp) was digested with KpnI and SalI. The
www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–7
4
Jun Yan et al.
two fragments were cloned together into pMD19T digested with EcoRI and SalI. The resulting construct was digested with KpnI, and then a 1.6-kb kanamycin cassette, which was amplified from the plasmid of pTZTRAP::kan provided by Dr. Balaban N was inserted. The resulting plasmid was digested with EcoRI and SalI, and a fragment harboring kanamycin resistance between the upstream and downstream fragments was ligated into pAUL-A digested with EcoRI and SalI to create plasmid pAUL-A-DRNAIII. pAUL-A has a temperature-sensitive origin of replication that is active in S. aureus at 30 °C but not at 42 °C. The recombinant plasmid initially isolated from Escherichia coli, was introduced into S. aureus RN4220 by electroporation and colonies resistant to kanamycin and erythromycin were selected after growth at 30 °C. The resistant clones were subjected to a temperature shift to 42 °C to select the plasmid integration into the chromosome. Bacteria resistant to kanamycin but sensitive to erythromycin were selected. The mutation was confirmed by PCR, and followed by transduction into strains 8325-4 with phageF11 to create the mutant strains (RNAIII-m) from which the coding region of RNAIII was deleted (Table 1). Restoring RNAIII activity Primers rs-RNAIIIF and rs-RNAIIIR (listed in Table 2) were designed to PCR-amplify a 1096 bp fragment encompassing the gene encoding for RNAIII, the promoter region and termination site with SalI/EcoRI sites. S. aureus 8325-4 chromosomal DNA was used as the template. The PCR product (“whole RNAIII”) was digested and cloned into the SalI/EcoRI digested pMAD, which could replicate in E. coli at 37 °C and in S. aureus at 30 °C and could be used as a suicide vector when grown at 42 °C in S. aureus. The resulting plasmid (pMAD-rs-RNAIII) was transformed into E. coli DH5a. Cells were selected on LB plates containing 100 mg ml1 ampicillin. Plasmid was isolated from positive clones and used to transform S. aureus RN4220 cells. The transformants were selected on tryptic soy agar plates containing 10 mg ml1 erythromycin at 30 °C. Then the plasmid was isolated from the positive clone (RN4220 containing pMAD-rs-RNAIII) and transformed to DRNAIII-8325. The transformants were selected on tryptic soy agar plates containing 10 mg ml1 erythromycin at 30 °C for 48 h, and then transferred to 42 °C for 12 h. The restoring colonies (RNAIIIr) were confirmed by PCR (primers:rs-RNAIIIF/rs-RNAIIIR) and RT-PCR (primers:RNAIII RT-F/RNAIII RT-R) (Table 2). Statistical analysis All quantitative data were analyzed using Student t-tests. p < 0.05 was considered to be statistically significant. ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
Results RNAIII down-regulates the expression of LtaS S. aureus LtaS is a membrane integrated protein. The expression of several membrane proteins is negatively regulated by RNAIII. RNAIII has been identified to regulate the target mRNAs at post-exponential phase and stationary phase [19, 20]. So, we compared the level of ltaS in the RNAIII mutant (RNAIII-m) with its parent strain (8325-4) at exponential phase (6 h) and stationary phase (12 h). The results showed that the level of ltaS was increased in the RNAIII-m strain at the two phases. Meanwhile, the level of ltaS could be recovered in the RNAIII restored strain (RNAIII-r) (Fig. 1A). Given that the level of RNAIII at lag phase of S. aureus growth is lower than post-exponential phase, we compared the level of ltaS at these two growth phases in 8325-4 and COL. It was
Figure 1. ltaS mRNA was gradually elevated in the S. aureus strain with RNAIII deletion. (A) Detection of the level of ltaS in different strains. Total RNAs of S. aureus 8325-4 and RNAIII mutant (RNAIII-m) cultured for 6 and 12 h were extracted, and the levels of ltas mRNA and RNAIII were detected by RT-PCR. 16s rRNA was used as the endogenous reference gene. The results represented a mean of three independent experiments. (B, C) Detection of the level of ltas at the different growth phases in two strains. Total RNA at lag phase and post-exponential (post-exp) phase from 8325-4 (B) and COL (C) was extracted. And the level of ltaS mRNA was determined by qPCR.
www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–7
RNAIII suppresses the expression of LtaS
showed that the level of ltaS was negatively correlated with the level of RNAIII in two strains (Fig. 1B and C). S. aureus peptidase SpsB can hydrolyze the residues 215 Ala-Leu-Ala217 of LtaS to release eLtaS into the supernatant [21, 22]. In the further investigation, specific antibodies against eLtaS were prepared following the expression and purification of eLtaS proteins. And then the expression levels of eLtaS in the supernatant or bacterial total proteins of different S. aureus strains were detected using Western blotting. Compared to its parent strain, the level of eLtaS in the supernatant and bacterial total proteins was significantly increased in RNAIII mutant strain. Moreover, the restoration of eLtaS was observed in the RNAIII restored strain (RNAIII-r) (Fig. 2).
5
Figure 3. Sequence alignment and schematic diagram of construction of reporter vectors. The sequence similarities between RNAIII and 50 UTR of ltas mRNA were analyzed. Some nucleotides in 50 UTR of ltas mRNA were replaced to disrupt the formation of duplex between RNAIII and ltas mRNA.
RNAIII acts on the 50 UTR of ltas mRNA RNAIII functions as a regulatory RNA through acting on the target mRNA to regulate the translation and mRNA stabilization of targets [8, 9, 19, 23]. In our further investigation, the sequence similarities between RNAIII and ltas mRNA were analyzed. It was predicted that the 428–444 nt of RNAIII [19, 24] could form duplex with the 50 UTR of ltas mRNA (Fig. 3). Then the 50 UTR of ltas mRNA was fused with lacZ and the fusion was transformed into WT (8325-4) strain and RNAIII-m strain, respectively. The b-galactosidase activities of UltaS-lacZ in RNAIII-m strain were significantly higher than that in WT strain (Fig. 4). To further verify whether LtaS expression was regulated by RNAIII, the mutant of ltas mRNA with point substitution disrupting the base-pairing sites (Fig. 3) was fused with lacZ and the fusion vector was transformed into WT and RNAIII-m strains. It was found that the bgalactosidase activities of mUltaS-lacZ were not signifi-
Figure 2. eLtaS protein was gradually elevated in the supernatant and total proteins of S. aureus strain with RNAIII deletion. The supernatant or bacterial total proteins were extracted and the levels of eLtaS protein in different strains were detected by Western blotting. ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
Figure 4. Determination of the b-galactosidase activities in different strains. The fragment containing 50 UTR and the coding sequence of the first six amino acids of LtaS was fused with lacZ to generate reporter vector of UltaS-lacZ. The mutant fragment was fused with lacZ to generate reporter vector of mUltaS-lacZ. The activities of b-galactosidase was determined in the RNAIII-m (RNAIII mutant strain) and WT (8325-4) strains. The results represented a mean of three independent experiments.
www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–7
6
Jun Yan et al.
cantly altered in the RNAIII-m and its parent strains (Fig. 4). All these results suggested that RNAIII might act on the 50 UTR of ltaS and regulate the expression of ltaS.
blocking RNAIII may aggravate the infection. Both cell membrane proteins and secreted toxins usually are involved in the pathogenesis of S. aureus, so it may be not feasible to inhibit S. aureus infection via targeting to RNAIII.
Discussion LtaS plays an essential role in LTA synthesis and the growth of S. aureus. And the regulation of the expression of LtaS is unknown. In the present study, we reveal that RNAIII can act on the 50 UTR of ltaS mRNA to regulate the expression of LtaS. Our investigation elucidates that LtaS is a new target of RNAIII. LTA is one of major envelope components of Grampositive bacteria [25]. S. aureus LTA is a polymer of 1,3linked glycerol phosphate subunits that are tethered to Glc2-DAG, which is conserved in several human pathogens, including B. anthracis, Enterococcus faecalis, Listeria monocytogenes, and Streptococcus agalactiae [26, 27]. Besides as the component of the envelope, LTA released from bacteria can bind to target cells, either non-specifically, to membrane phospholipids, or specifically, to CD14 and to Toll-like receptors and share endotoxin (lipopolysaccharide) many of its pathogenic properties [28]. There are three proteins identified to be involved in the synthesis of LTA (YpfP, LtaA, and LtaS) [11, 29, 30]. Deletion of LtaS from genome of S. aureus leads to reduction of LTA biosynthesis and slow growth [11]. So blocking the activities of LtaS may inhibit S. aureus infection. Richter et al. [15] has reported that the chemical compounds targeting to LtaS could protect mice from S. aureus infection. RNAIII is a 514 nt RNA molecule that contains 14 hairpin structures connected by unpaired nucleotides [19]. Besides it contains the coding region of d-hemolysin, it acts a regulatory RNA to regulate the expression of several targets at post-transcriptional stage [1]. The targets of RNAIII include the secreted proteins and cell membrane protein [1, 8–10]. It is of note that RNAIII usually downregulates the expression of cell membrane targets, but upregulates the expression of secreted proteins [8–10]. LtaS is a cell membrane protein. Our data showed that RNAIII negatively regulated the expression of LtaS, which is in accordance with other cell membrane targets. Combined with previous results of other groups, the data suggest that the RNAIII plays the different role in the different types of diseases caused by S. aureus. If secreted toxins regulated by RNAIII are foremost for the disease, blocking RNAIII will decrease the infection. On the other hands, when the cell membrane targets regulated by RNAIII are essential for the disease, ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
Acknowledgments This work was supported by grants from Chinese National Natural Science Funds (http://www.nsfc.gov.cn) (31370170 and 31170074).
Conflict of interests statement The authors declare that they have no competing financial interests.
References [1] Chevalier, C., Boisset, S., Romilly, C., Masquida, B. et al., 2010. Staphylococcus aureus RNAIII binds to two distant regions of coa mRNA to arrest translation and promote mRNA degradation. PLoS Pathog., 6, e1000809. [2] Liu, C.I., Liu, G.Y., Song, Y., Yin, F. et al., 2008. A cholesterol biosynthesis inhibitor blocks Staphylococcus aureus virulence. Science, 319, 1391–1394. [3] Bien, J., Sokolova, O., Bozko, P., 2011. Characterization of virulence factors of Staphylococcus aureus: novel function of known virulence factors that are implicated in activation of airway epithelial proinflammatory response. J. Pathog., 2011, 601905. [4] Lowy, F.D., 1998. Staphylococcus aureus infections. N. Engl. J. Med., 339, 520–532. [5] Holmes, A., Ganner, M., McGuane, S., Pitt, T.L. et al., 2005. Staphylococcus aureus isolates carrying Panton-Valentine leucocidin genes in England and Wales: frequency, characterization, and association with clinical disease. J. Clin. Microbiol., 43, 2384–2390. [6] Jarraud, S., Mougel, C., Thioulouse, J., Lina, G. et al., 2002. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (Alleles), and human disease. Infect. Immun., 70, 631–641. [7] Cheung, A.L., Eberhardt, K.J., Chung, E., Yeaman, M.R. et al., 1994. Diminished virulence of a sar-/agr-mutant of Staphylococcus aureus in the rabbit model of endocarditis. J. Clin. Invest., 94, 1815–1822. [8] Novick, R.P., Ross, H.F., Projan, S.J., Kornblum, J. et al., 1993. Synthesis of staphylococcal virulence factors is controlled by a regulatory RNA molecule. EMBO J., 12, 3967–3975. [9] Morfeldt, E., Taylor, D., von Gabain, A., Arvidson, S., 1995. Activation of alpha-toxin translation in Staphylococcus aureus by the trans-encoded antisense RNA, RNAIII. EMBO J., 14, 4569–4577.
www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–7
RNAIII suppresses the expression of LtaS
[10] Boisset, S., Geissmann, T., Huntzinger, E., Fechter, P. et al., 2007. Staphylococcus aureus RNAIII coordinately represses the synthesis of virulence factors and the transcription regulator Rot by an antisense mechanism. Genes Dev., 21, 1353–1366. [11] Gründling, A., Schneewind, O., 2007. Synthesis of glycerol phosphate lipoteichoic acid in Staphylococcus aureus. Proc. Natl. Acad. Sci. USA, 104, 8478–8483. [12] Oku, Y., Kurokawa, K., Matsuo, M., Yamada, S. et al., 2009. Pleiotropic roles of polyglycerolphosphate synthase of lipoteichoic acid in growth of Staphylococcus aureus cells. J. Bacteriol., 191, 141–151. [13] Morath, S., Geyer, A., Hartung, T., 2001. Structure– function relationship of cytokine induction by lipoteichoic acid from Staphylococcus aureus. J. Exp. Med., 193, 393–398. [14] Lu, D., Wörmann, M.E., Zhang, X., Schneewind, O. et al., 2009. Structure-based mechanism of lipoteichoic acid synthesis by Staphylococcus aureus LtaS. Proc. Natl. Acad. Sci. USA, 106, 1584–1589. [15] Richter, S.G., Elli, D., Kim, H.K., Hendrickx, A.P. et al., 2013. Small molecule inhibitor of lipoteichoic acid synthesis is an antibiotic for gram-positive bacteria. Proc. Natl. Acad. Sci. USA, 110, 3531–3536. [16] Korem, M., Gov, Y., Kiran, M.D., Balaban, N., 2005. Transcriptional profiling of target of RNAIII-activating protein, a master regulator of Staphylococcal virulence. Infect. Immun., 73, 6220–6228. [17] Harraghy, N., Kormanec, J., Wolz, C., Homerova, D. et al., 2005. Sae is essential for expression of the staphylococcal adhesins Eap and Emp. Microbiology, 151, 1789–1800. [18] Miller, J.H., 1972. Experiments in molecular genetics, in: Miller, J. H. (Ed.), Assays of Lac Operon Enzymes: bGalactosidase Permease, Repressor, Transacetylase, a Complementation, Cold Spring Harbor Laboratory Press, NY, 352–355. [19] Benito, Y., Kolb, F.A., Romby, P., Lina, G. et al., 2000. Probing the structure of RNAIII, the Staphylococcus aureus agr regulatory RNA, and identification of the RNA domain involved in repression of protein A expression. RNA, 6, 668–679. [20] Huntzinger, E., Boisset, S., Saveanu, C., Benito, Y. et al., 2005. Staphylococcus aureus RNAIII and the endoribonu-
ß 2014 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
7
clease III coordinately regulate spa gene expression. EMBO J., 24, 824–835. [21] Karatsa-Dodgson, M., Wörmann, M.E., Gründling, A., 2010. In vitro analysis of the Staphylococcus aureus lipoteichoic acid synthase enzyme using fluorescently labeled lipids. J. Bacteriol., 192, 5341–5349. [22] Wörmann, M.E., Reichmann, N.T., Malone, C.L., Horswill, A.R. et al., 2011. Proteolytic cleavage inactivates the Staphylococcus aureus lipoteichoic acid synthase. J. Bacteriol., 193, 5279–5291. [23] Liu, Y., Mu, C., Ying, X., Li, W. et al., 2011. RNAIII activates map expression by forming an RNA–RNA complex in Staphylococcus aureus. FEBS Lett., 585, 899–905. [24] Geisinger, E., Adhikari, R.P., Jin, R., Ross, H.F. et al., 2006. Inhibition of rot translation by RNAIII, a key feature of agr function. Mol. Microbiol., 61, 1038–1048. [25] van de Wetering, J.K., van Eijk, M., van Golde, L.M., Hartung, T. et al., 2001. Characteristics of surfactant protein A and D binding to lipoteichoic acid and peptidoglycan, 2 major cell wall components of grampositive bacteria. J. Infect. Dis., 184, 1143–1151. [26] Fischer, W., Mannsfeld, T., Hagen, G., 1990. On the basic structure of poly(glycerophosphate) lipoteichoic acids. Biochem. Cell Biol., 68, 33–43. [27] McCarty, M., Morse, S.I., 1964. Cell wall antigens of grampositive bacteria. Adv. Immunol., 27, 249–286. [28] Ginsburg, I., 2002. Role of lipoteichoic acid in infection and inflammation. Lancet Infect. Dis., 2, 171–179. [29] Kiriukhin, M.Y., Debabov, D.V., Shinabarger, D.L., Neuhaus, F.C., 2001. Biosynthesis of the glycolipid anchor in lipoteichoic acid of Staphylococcus aureus RN4220: role of YpfP, the diglucosyldiacylglycerol synthase. J. Bacteriol., 183, 3506–3514. [30] Gründling, A., Schneewind, O., 2007. Genes required for glycolipid synthesis and lipoteichoic acid anchoring in Staphylococcus aureus. J. Bacteriol., 189, 2521–2530. [31] Novick, R.P., 1967. Properties of a cryptic high-frequency transducing phage in Staphylococcus aureus. Virology, 33, 155–166. [32] Schneewind, O., Mihaylova-Petkov D., Model P., 1993. Cell wall sorting signals in surface proteins of gram-positive bacteria. EMBO J., 12, 4803–4811.
www.jbm-journal.com
J. Basic Microbiol. 2014, 54, 1–7
