Biochemical and Biophysical Research Communications 470 (2016) 881e887

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc

SUMOylation regulates nuclear localization and stability of TRAIP/RNF206 I. Seul Park a, 1, Ye gi Han a, 1, Hee Jin Chung a, 1, Yong Woo Jung b, Yonghwan Kim c, **, Hongtae Kim a, * a b c

Department of Biological Sciences, Sungkyunkwan University (SKKU), Suwon 440-746, South Korea College of Pharmacy, Korea University, Sejong City 339-700, South Korea Department of Biological Sciences, Sookmyung Women's University, Seoul 04310, South Korea

a r t i c l e i n f o

a b s t r a c t

Article history: Received 19 January 2016 Accepted 22 January 2016 Available online 25 January 2016

TRAIP/RNF206 plays diverse roles in cell cycle progression, DNA damage response, and DNA repair pathways. Physiological importance of TRAIP is highlighted by the identification of pathogenic mutations of TRAIP gene in patients diagnosed with primordial dwarfism. Although the diverse functions of TRAIP in the nucleus have been well characterized, molecular mechanism of TRAIP retention in the nucleus has not been determined. Here, we discovered that TRAIP is post-translationally modified by the small ubiquitin-like protein (SUMO). In addition, we identified five SUMOylation sites in TRAIP, and successfully generated SUMOylation deficient mutant of TRAIP. In an attempt to define the functional roles of TRAIP SUMOylation, we discovered that SUMOylation deficient TRAIP is not retained in the nucleus. In addition, protein stability of SUMOylation deficient TRAIP is lower than wild type TRAIP, demonstrating that SUMOylation is critical for both proper subcellular localization and protein stability of TRAIP. Taken together, these findings improve the understanding clinical implication of TRAIP in various diseases including primordial dwarfism and cancers. © 2016 Elsevier Inc. All rights reserved.

Keywords: TRAIP SUMOylation Subcellular localization Protein degradation

1. Introduction Posttranslational modifications triggered by various cellular circumstances are important for biological processes including protein stability control, subcellular localization, transcriptional regulation, DNA damage signaling cascades and DNA repairs [1e4]. Small-ubiquitin-like modifier (SUMO) is one of the reversible posttranslational protein modifiers which is attached to and removed from a target protein by SUMO proteases [5,6]. SUMOylation involves E1-activating enzyme (SAE 1/2), E2-conjugating enzyme (UBC9) and a number of E3-ligating enzymes. Similar to other posttranslational modifications, SUMOylation is implicated in functions, stability and subcellular localization of target proteins [7e9].

* Corresponding author. 300, Cheoncheon-dong, Jangan-gu, Suwon 440-746, South Korea. ** Corresponding author. 100 Cheongpa-Ro 47 Gil, Yongsan-Gu, Seoul 140-742, South Korea. E-mail addresses: [email protected] (Y. Kim), [email protected] (H. Kim). 1 These authors contributed equally to this paper. http://dx.doi.org/10.1016/j.bbrc.2016.01.141 0006-291X/© 2016 Elsevier Inc. All rights reserved.

TRAIP/RNF206 (TNF Receptor Associated factor-Interacting Protein) was initially identified as a TRAF interacting protein, which inhibits the activation of nuclear factor-kappa light chain enhancer of activated B cells (NF-kB), and negatively regulates interferon b (IFN-b) production [10,11]. TRAIP knockout mice showed embryonic lethality [12], and mutation of NOPO, the Drosophila homolog of mammalian TRAIP, lead to developmental failure at the early stage [13]. TRAIP is composed of 469 amino-acids with annotated domains including really interesting new gene (RING), coiled coil, leucine zipper and nuclear localization signal [13]. Due to having the RING domain, initially TRAIP might function as an ubiquitin E3 ligase, but its substrates have not been determined. Recent studies revealed that TRAIP is also implicated in mitotic progression, DNA damage response, and DNA repair pathways [14,15]. The physiological importance of TRAIP has been emphasized by the findings showing that mutations in TRAIP gene are the causative for the human disease, primordial dwarfism [15]. The clinical implication of TRAIP in those diseases might be due to the important functions of TRAIP in cell cycle progression as the loss of TRAIP deteriorates cell proliferations, which results in dwarfism phenotype [15]. Despites of its critical roles in genome maintenance, little is known

882

I.S. Park et al. / Biochemical and Biophysical Research Communications 470 (2016) 881e887

about the biochemical properties of TRAIP including posttranslational modifications. In this study, we report for the first time that TRAIP is posttranslationally modified by SUMO, and the SUMOylation is critical for subcellular localization and protein stability of TRAIP. SUMOylation sites of TRAIP were determined. Using SUMOylation deficient mutant of TRAIP, we found that SUMOylation is essential for nuclear retention of TRAIP, and inhibits ubiquitin-mediated TRAIP degradation. Biochemical properties of TRAIP described below will be informative to clarify the clinical implication of TRAIP in diverse diseases including primordial dwarfism and cancers. 2. Materials and methods

Inc.), supplemented with 10% fetal bovine serum (FBS, Invitrogen), 100 units/mL penicillin, and 100 mg/mL streptomycin (Invitrogen). The cells were maintained at 37  C in a humidified atmosphere containing 5% CO2. The control siRNA has been previously described in the literature [16,17]. The TRAIP siRNA sequences were as follows: TRAIP#1: 50 GCAGCAGGAUGAGACCAAAUU 30 ; TRAIP#2: 50 GCAAGUUGCAGACAGUCUAUU 30 . SUMO-1 and SUMO-2 siRNA sequences were as follows: SUMO1#1: 50 GGACAGGAUAGCAGUGAGAUU 30 , SUMO1#2 50 CUGGGAAUGGAGGAAGAAGUU 30 , SUMO2#1 50 GAGGCAUACACCACUUAGUUU 30 , SUMO2 #2 50 GUCAAUGAGGCAGAUCAGAUU 3’. The siRNAs were transfected into HeLa cells using DharmaFECT 1 (Dharmacon, Inc.). The DNA transfection was performed using Lipofectamine 2000 (Invitrogen, USA), as per the instructions of the manufacturer.

2.1. Plasmids and antibodies 2.3. In vitro SUMOylation assay A TRAIP gene was purchased from a South Korean human gene bank. A Myc-tagged TRAIP expression plasmid was cloned into a Myc-tagged mammalian expression vector, and a GFP-tagged TRAIP-SUMO1, 2, 3 expression plasmid was cloned into a GFPtagged mammalian expression vector. The TRAIP point resistant mutants were generated by mutagenesis. An anti-TRAIP antibody was raised by immunizing rabbits with the GST-TRAIP fusion protein. The anti-Flag, -GFP and -b-actin antibodies were purchased from Sigma Inc. An anti-Myc and -HA antibodies were purchased from Roche. Anti-SUMO1 was purchased from Santa Cruz, Inc. AntiSUMO2 was purchased from Abcam. 2.2. Cell culture, siRNAs, and transfection HeLa and human embryonic kidney (HEK) 293T cells cells were cultured in Dulbecco's modified Eagle's medium (DMEM, WelGENE

Myc-TRAIP expression plasmid was transfected into HeLa cells. After 24 h, cell lysates of Myc-TRAIP were mixed with 500 ng of purified GST-SAE1/SAE2, 400 ng of His-Ubc9, and 2 mg His-SUMO-1. Lastly, 2 mM ATP of total volume was added and then incubated at 37  C for 2 h. These products were analyzed by Western blotting with Myc antibody. 2.4. Immunoprecipitation For immunoprecipitation, the cells were washed with ice-cold PBS and then lysed in an NETN buffer (0.5% Nonidet P-40, 20 mM Tris [pH 8.0], 50 mM NaCl, 50 mM NaF, 100 mM Na3VO4, 1 mM DTT, and 50 mg/ml PMSF), at 4  C for 10 min. The crude lysates were cleared by centrifugation, at 14,000 rpm at 4  C for 5 min, and the supernatants were incubated with the protein A agarose-

Fig. 1. SUMOylation of TRAIP. (A) HeLa cells were co-transfected with indicated plasmids. After 24 h, whole cell lysates of transfected cells were analyzed by Western blotting using the indicated antibodies. (B) In vitro SUMOylation assay. HeLa cells were transfected with 5 mg, 10 mg or 15 mg of Myc-TRAIP expression vector. 24 h after transfection, cell lysates were incubated with SUMO buffer (GST-SAE1/2, His-UBC9, His-SUMO1) and 2 mM ATP at 37  C for 2 h followed by Western blotting analysis with anti-Myc antibody. (C) Myc-TRAIP and each of HA-SUMO1, SUMO2 or SUMO3 expression vector were co-transfected into HeLa cells. After 24 h, transfected cells were analyzed by immunofluorescence. SUMO1, SUMO2, SUMO3, and TRAIP foci were indicated. DAPI was used as an indicator for the nucleus.

I.S. Park et al. / Biochemical and Biophysical Research Communications 470 (2016) 881e887

conjugated primary antibodies. The immunocomplexes were washed three times with NETN buffer and subjected to SDS-PAGE. And then Western blotting was performed using the antibodies, which are denoted in the Figure Legends (below).

883

2.5. Immunofluorescence HeLa cells, on coverglasses, were fixed with methanol at 20  C for 30 min. Alternatively, the cells were extracted with a BRB80-T

Fig. 2. Identification of TRAIP SUMOylation sites. (A) Predicted SUMOylation sites of TRAIP suggested by The SUMOplot™ Analysis Program and the SUMOylation Sites Prediction (SUMOsp) tool. (B) A diagram of TRAIP wild type showing the potential SUMOylation sites. (C) A list of TRAIP point mutants used in this study. (D) Indicated Myc-TRAIP expression vector was transfected into HeLa cells with or without HA-SUMO2. The ratio of Myc-TRAIP wild type or point mutants to HA-SUMO2 was 1:3. After 24 h, whole cell lysates were analyzed by Western blotting using the indicated antibodies. (EeF) The indicated combination of expression vectors was transfected into HeLa cells. After 24 h, whole cell lysates were analyzed by Western blotting using the indicated antibodies.

884

I.S. Park et al. / Biochemical and Biophysical Research Communications 470 (2016) 881e887

I.S. Park et al. / Biochemical and Biophysical Research Communications 470 (2016) 881e887

buffer (80 mM PIPES, pH 6.8, 1 mM MgCl2, 5 mM EGTA, and 0.5% Triton X-100) and then fixed with 4% paraformaldehyde for 15 min at room temperature. The fixed cells were then permeabilized and blocked with PBS-BT (1  PBS, 3% BSA, and 0.1% Triton X-100) for 30 min at room temperature. The coverslips were then incubated in primary and secondary antibodies that were diluted in PBS-BT. The images were acquired using an AxioVision 4.8.2 (Carl Zeiss) under a Zeiss Axiovert 200 M microscope with a 1.4 NA plan-Apo 100  oil immersion lens and a HRm CCD camera. The images were obtained using an AutoDeblur v9.1 and AutoVisualizer v9.1 (AutoQuant Imaging). All the images are maximum projections from z stacks of representative cells that were stained for the indicated antigens. The mages for quantification were acquired under a constant exposure in each channel for all of the cells. 3. Results and discussion 3.1. TRAIP is post-translationally modified by SUMO TRAIP has been found to be localized in PML nuclear bodies where a large portion of proteins are SUMOylated [18]. These findings raise a possibility that TRAIP is SUMOylated. To examine the SUMOylation of TRAIP in vivo, HeLa cells were transfected with Myc-TRAIP and each of HA-SUMO1, HA-SUMO2 or HA-SUMO3 expression vectors, and the cell lysates were immunoblotted with anti-Myc antibody. Of interest, we found that SUMOylation of TRAIP is stimulated by the expression of SUMO1, SUMO2 or SUMO3 (Fig. 1A). Consistently, TRAIP SUMOylation was confirmed in vitro SUMOylation assay (Fig. 1B). In addition, immunofluorescence experiment showed that all of SUMO1, SUMO2 and SUMO3 were co-localized with TRAIP in the nucleus (Fig. 1C). Taken together, these findings demonstrate that TRAIP is SUMOylated in the nucleus. 3.2. Identification of TRAIP SUMOylation sites As a post-translational modifier, SUMO regulates various aspects of target proteins. To understand the functional relevance of SUMOylation of TRAIP, we first determined the responsible residues of TRAIP SUMOylation. To this end, we employed the SUMOplot™ Analysis and SUMOylation Sites Prediction (SUMOsp) tools and found that there are putative five SUMO residues with high confidence in TRAIP (Fig. 2AeB). This data spurred us to align the TRAIP amino-acid sequences in mammalian species, and we found that the potential five SUMOylation sites were highly conserved among species, suggesting that those sites are important for the functions of TRAIP (Fig. S1). Based on these results, we generated Myc-TRAIP point mutants TRAIP-K80A, -K127A, -K205A, -K247A and -K462A (Fig. 2C), and co-transfected each of the TRAIP point mutants with HA-tagged SUMO2. As shown in the Fig. 2D, however, SUMOylation of TRAIP-K80A, -K127A, -K205A, -K247A or -K462A single mutant was not altered in comparison with wild type MycTRAIP (Fig. 2D). In order to generate clear SUMOylation defective TRAIP, we further constructed Myc-TRAIP point mutants TRAIP-2A, -3A, -4A and -5A, which were concurrently mutated at two to five SUMOylation sites (Fig. 2C). Cell extracts from HeLa cells expressing each of TRAIP-2A, -3A, -4A or -5A in the presence of SUMO1 or SUMO2 were immunoblotted and we found that TRAIP-2A and -3A mutants have no effect on SUMOylation of TRAIP. However, TRAIP

885

SUMOylation of both SUMO1 and SUMO2 were completely abolished in the cells expressing TRAIP-5A mutant (Fig. 2EeF). 3.3. SUMOylation affects subcellular localization of TRAIP SUMOylation of target proteins ensures proper functions of the target proteins by regulating subcellular localization or protein stability. To gain insight into the functional impacts of the TRAIP SUMOylation, we first examined the subcellular localization of Myc-TRAIP WT and Myc-TRAIP point mutants by performing immunofluorescence assay. To our surprise, we found that TRAIP5A mutant failed to translocate to the nucleus while TRAIP WT and all the other mutants (Myc-TRAIP-K80A, -K127A, -K205A, -K247A, -K462A, -2A, -3A or -4A) were located and formed foci in the nucleus (Fig. 3A). We then generated chimeric TRAIP-WT and -5A mutants (GFP-SUMO1-, 2- or 3-TRAIP-5A and GFP-SUMO1-, 2or 3-TRAIP-5A) by fusing GFP-SUMO1, 2, or 3 to the N-terminus of TRAIP to confirm that SUMOylation defectiveness is the causative for loss of the TRAIP localization to the nucleus. The chimeric strategy was successfully used to mimic constitutive SUMOylation. As expected, we found that all of SUMO1, SUMO2 and SUMO3 fusions with TRAIP-5A restored the nuclear localization of TRAIP (Fig. 3B). These findings demonstrate that SUMOylation of TRAIP is important for its nuclear import. 3.4. SUMOylation regulates protein stability of TRAIP SUMOylation has shown to regulate the stability of target proteins. To see if protein stability of TRAIP is regulated by SUMOylation, cell extracts from 293T cells expressing each of Myc-TRAIP WT, TRAIP mutants (K80A, K127A, K205A, K247A, K462A, 2A, or 3A) and SUMOylation defective TRAIP-5A were subjected to immunoblotting analysis. As shown in the Fig. 4A, we noticed that the expression level of SUMOylation defective mutant, TRAIP-5A, was lower than wild type TRAIP and SUMOylation proficient mutants of TRAIP, suggesting that SUMOylation of TRAIP enhances the stability of TRAIP (Fig. 4A). Protein stability regulation by SUMO is contextdependent. In some cases, SUMOylation promotes proteosomal degradation of the target proteins [19], resulting in protein degradation, but in others, SUMOylation inhibits ubiquitin-mediated protein degradation [20]. To understand the molecular basis of TRAIP stability regulation by SUMO, we first tested the stability of TRAIP WT and TRAIP-5A in response to MG132, an inhibitor of proteasome, and found that inhibition of proteasome activity by MG-132 led to increment of TRAIP stability indicating that TRAIP is the target for degradation by the proteasome with covalent modification of ubiquitins (Fig. 4B). In addition, treatment of cycloheximide (CHX), an inhibitor of protein synthesis, reduced both MycTRAIP wild type and Myc-TRAIP 5A level, but interestingly, protein stability of Myc-TRAIP 5A protein level was rapidly declined compared to wild type Myc-TRAIP (Fig. 4C). Surprisingly Myc-TRAIP 5A, a SUMOylation defective mutant, is ubiquitinated much more than wild type (Fig. 4D). In order to confirm the effects of SUMOylation on TRAIP protein stability, we tested TRAIP expression level using SUMO1 or SUMO2 depleted cells. Both SUMO1 and SUMO2 depleted cells led to faster decline of TRAIP compared to control siRNA transfected cells (Fig. 4E). In views of the results so far achieved, SUMOylation of TRAIP interrupts ubiquitination of TRAIP, thereby restraining the proteasomal degradation of TRAIP. Taken

Fig. 3. SUMOylation is essential for subcellular localization of TRAIP. Myc-TRAIP-WT, -K80A, -K127A, -K205A, -K245A, -K462A, -2A, -3A, -4A, or -5A point mutants (A), and SUMOconjugated Myc-TRAIP-WT or -5A (B) were individually transfected into HeLa cells. After 24 h, transfected cells were fixed and analyzed by immunofluorescence. The graph represents percentage of the cells with TRAIP localized in the nucleus. The results represent the average of the three independent experiments. Error bars indicate standard deviation. DAPI was used as an indicator for the nucleus.

886

I.S. Park et al. / Biochemical and Biophysical Research Communications 470 (2016) 881e887

Fig. 4. SUMOylation enhances the protein stability of TRAIP. (A) Myc-TRAIP-WT, -K80A, -K127A, -K205A, -K245A, -K462A, -2A, -3A, -4A, or -5A point mutant were individually transfected into HeLa cells. After 24 h, lysates from the transfected cells were analyzed by immunoblotting using indicated antibodies. (B) Western blot analysis of endogenous TRAIP expression levels in the HeLa cells treated with 6 mM of MG132 for the indicated times. (C) Myc-TRAIP-WT or -5A-transfected HeLa cells transfected with Myc-TRAIP-WT or -5A were treated with cycloheximide (CHX) for the indicated times. At each time point (0, 30, 60 or 90 min) after incubation, cells were harvested and the cell lysates were subjected to Western blot analysis using the indicated antibodies. Quantification of relative protein levels represented in the right panel. (D) HeLa cells transfected with the combinations of HA-ubiquitin expression vector and Myc-TRAIP-WT or -5A were treated with 6 mM of MG132 for 6 h. The cell lysates were immunoprecipitated with anti-Myc antibody, followed by Western blotting analysis using the indicated antibodies. Equal volumes of cell lysates were immunoblotted with indicated antibodies shown in the bottom panel. (E) HeLa cells transfected with indicated siRNAs were cells were treated with cycloheximide (CHX) for the indicated times. At each time point (0, 30, 60 or 90 min) after incubation, cells were harvested and the cell lysates were subjected for immunoblot analysis using the indicated antibodies. Quantification of relative protein levels represented in the right panel.

together, these data suggest that protein stability of TRAIP is enhanced by SUMOylation. Given that the uncovered functions of TRAIP in the nucleus, knowledge of protein localization is essential for understanding the roles of TRAIP as a regulator of mitotic progression and a factor involved in the DNA damage response and repair pathways [14,15,18,21,22]. However, the underlying mechanism of TRAIP localization to the nucleus has not been investigated. Here, we showed that SUMO-mediated posttranslational modification of TRAIP is critical for the translocalization of TRAIP to the nucleus. We identified five potential SUMOylation sites of the TRAIP and generated the SUMOylation deficient TRAIP-5A mutant. Of interest, we found that the SUMOylation deficient TRAIP failed to be retained in the nucleus, and the impaired nuclear localization

phenotype of TRAIP-5A was successfully rescued by conjugation of SUMO at the N-terminus of TRAIP-5A, suggesting that SUMO modification of TRAIP is required for its retention in the nucleus. However, it is not clear how the SUMOylation regulates retention of TRAIP in the nucleus. A possible explanation for the nuclear retention of TRAIP might be envisaged by the fact that the distinctive foci of TRAIP in the nucleus are co-localized with PML nuclear bodies [18] where most factors are SUMOylated. Factors forming the PML bodies have found to be involved in the DNA damage response and repair pathways. Since TRAIP is implicated in genome maintenance, it is possible that SUMOylation of TRAIP promotes its localization in the PML nuclear bodies, which results in nuclear retention of TRAIP. The importance of nuclear localization of TRAIP is emphasized by the recent findings showing that

I.S. Park et al. / Biochemical and Biophysical Research Communications 470 (2016) 881e887

nuclear expression level of TRAIP is downregulated in human lung adenocarcinoma [18] although cytoplasmic expression level of TRAIP does not show significant differences in the tumor and the matched normal tissues. Therefore, we conjecture that mutations to block SUMOylation of TRAIP may have a potential role in tumorigenesis. SUMOylation is also critical for protein stability of TRAIP. Our results suggest that TRAIP expression level is downregulated by ubiquitin-mediated proteasomal degradation. However, the ubiquitin-mediated TRAIP degradation is inhibited by SUMOylation, which enhance the protein stability of TRAIP. As the clinical implication of TRAIP has been associated with its lower expression in human lung cancer and also mutation in primordial dwarfism, the protein stability of TRAIP is critical for proper cellular functions. Harley et al., identified that TRAIP plays a key role in replication fork progression in the sites of DNA damage during the S phase, and thus proposed that the loss of TRAIP functions prohibits proper cell cycle progression and limits cellular proliferation, resulting in microcephaly and dwarfism phenotype [15]. Besides the SUMOylation of TRAIP, it will be interesting to investigate the molecular basis of ubiquitin-mediated TRAIP degradation, which will shed light on clarifying the clinical implication of TRAIP in various diseases.

[3]

[4]

[5] [6] [7] [8]

[9]

[10]

[11]

[12]

[13]

Acknowledgments [14]

This work was supported by a grant from the National R&D Program for Cancer Control, Ministry for Health, Welfare and Family Affairs, Republic of Korea (HI11C1596) and the Genome Technology to Business Translation Program of the National Research Foundation funded by the Korean government (2014M3C9A2064688).

[15]

[16]

Appendix A. Supplementary data

[17]

Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.bbrc.2016.01.141.

[18]

Transparency document

[19]

Transparency document related to this article can be found online at http://dx.doi.org/10.1016/j.bbrc.2016.01.141.

[20]

References [1] A. Scott, J. Song, R. Ewing, Z. Wang, Regulation of protein stability of DNA methyltransferase 1 by post-translational modifications, Acta. Biochim. Biophys. Sin. 46 (2014) 199e203. [2] L. Lv, Y.-P. Xu, D. Zhao, F.-L. Li, W. Wang, N. Sasaki, Y. Jiang, X. Zhou, T.-T. Li, K.L. Guan, Mitogenic and oncogenic stimulation of K433 acetylation promotes

[21]

[22]

887

PKM2 protein kinase activity and nuclear localization, Mol. Cell. 52 (2013) 340e352. A. Sadakierska-Chudy, M. Filip, A Comprehensive View of the Epigenetic Landscape. Part II: Histone Post-translational Modification, Nucleosome Level, and Chromatin Regulation by ncRNAs, Neurotox. Res. 27 (2015) 172e197. J.T. Tigno-Aranjuez, D.W. Abbott, Ubiquitination and phosphorylation in the regulation of NOD2 signaling and NOD2-mediated disease, Biochim. Biophys. Acta 1823 (2012) 2022e2028. R.T. Hay, SUMO: a history of modification, Mol. Cell. 18 (2005) 1e12. C. Guo, J.M. Henley, Wrestling with stress: roles of protein SUMOylation and deSUMOylation in cell stress response, IUBMB life 66 (2014) 71e77. R. Geiss-Friedlander, F. Melchior, Concepts in sumoylation: a decade on, Nat. Rev. Mol. Cell. Biol. 8 (2007) 947e956. , D. Reverter, J. Lee, J.G. O'Rourke, J.R. Gareau, J. Ochaba, W. Song, T. Rasko A.M. Monteys, J. Pallos, L. Mee, SUMO-2 and PIAS1 modulate insoluble mutant huntingtin protein accumulation, Cell Rep. 4 (2013) 362e375. B. Liu, J. Liao, X. Rao, S.A. Kushner, C.D. Chung, D.D. Chang, K. Shuai, Inhibition of Stat1-mediated gene activation by PIAS1, Proc. Natl. Acad. Sci. 95 (1998) 10626e10631. S.Y. Lee, S.Y. Lee, Y. Choi, TRAF-interacting protein (TRIP): a novel component of the tumor necrosis factor receptor (TNFR)-and CD30-TRAF signaling complexes that inhibits TRAF2-mediated NF-kB activation, J. Exp. Med. 185 (1997) 1275e1286. A. Regamey, D. Hohl, J.W. Liu, T. Roger, P. Kogerman, R. Toftgård, M. Huber, The tumor suppressor CYLD interacts with TRIP and regulates negatively nuclear factor kB activation by tumor necrosis factor, J. Exp. Med. 198 (2003) 1959e1964. E.S. Park, S. Choi, J.M. Kim, Y. Jeong, J. Choe, C.S. Park, Y. Choi, J. Rho, Early embryonic lethality caused by targeted disruption of the TRAF-interacting protein (TRIP) gene, Biochem. Biophys. Res. Commun. 363 (2007) 971e977. J.A. Merkle, J.L. Rickmyre, A. Garg, E.B. Loggins, J.N. Jodoin, E. Lee, L.P. Wu, L.A. Lee, No poles encodes a predicted E3 ubiquitin ligase required for early embryonic development of Drosophila, Development 136 (2009) 449e459. €schle, S. Hoffmann, S. Smedegaard, K. Nakamura, G.B. Mortuza, M.A. Ra ~ ez de Opakua, Y. Oka, Y. Feng, F.J. Blanco, M. Mann, G. Montoya, A. Groth, Iban S. Bekker-Jensen, N. Mailand, TRAIP is a PCNA-binding ubiquitin ligase that protects genome stability after replication stress, J. Cell. Biol. 212 (2016) 63e75. M.E. Harley, O. Murina, A. Leitch, M.R. Higgs, L.S. Bicknell, G. Yigit, A.N. Blackford, A. Zlatanou, K.J. Mackenzie, K. Reddy, TRAIP promotes DNA damage response during genome replication and is mutated in primordial dwarfism, Nat. Genet. 212 (2015) 63e75. H. Kim, J. Chen, X. Yu, Ubiquitin-binding protein RAP80 mediates BRCA1dependent DNA damage response, Science 316 (2007) 1202e1205. H.J. Cho, E.H. Lee, S.H. Han, H.J. Chung, J.H. Jeong, J. Kwon, H. Kim, Degradation of human RAP80 is cell cycle regulated by Cdc20 and Cdh1 ubiquitin ligases, Mol. Cancer. Res. 10 (2012) 615e625. N.S. Lee, H.J. Chung, H. Kim, S.Y. Lee, J. Ji, Y. Seo, S.H. Han, M. Choi, M. Yun, S. Lee, K. Myung, Y. Kim, H.C. Kang, H. Kim, TRAIP/RNF206 is required for recruitment of RAP80 to sites of DNA damage, Nat. Com. 7 (2016) 10463. L. Shimshon, A. Michaeli, R. Hadar, S.L. Nutt, Y. David, A. Navon, A. Waisman, B. Tirosh, SUMOylation of Blimp-1 promotes its proteasomal degradation, FEBS Lett. 585 (2011) 2405e2409. J. Schimmel, K.M. Larsen, I. Matic, M. van Hagen, J. Cox, M. Mann, J.S. Andersen, A.C. Vertegaal, The ubiquitin-proteasome system is a key component of the SUMO-2/3 cycle, Mol. Cell. Proteomics 7 (2008) 2107e2122. C. Chapard, P. Meraldi, T. Gleich, D. Bachmann, D. Hohl, M. Huber, TRAIP is a regulator of the spindle assembly checkpoint, J. Cell. Sci. 127 (2014) 5149e5156. I.S. Park, K.S. Jo, H.S. Won, H. Kim, Dimerization of TRAF-interacting protein (TRAIP) regulates the mitotic progression, Biochem. Biophys. Res. Commun. 463 (2015) 864e869.

RNF206.

TRAIP/RNF206 plays diverse roles in cell cycle progression, DNA damage response, and DNA repair pathways. Physiological importance of TRAIP is highlig...
2MB Sizes 4 Downloads 12 Views

Recommend Documents