bs_bs_banner
doi:10.1111/jog.12549
J. Obstet. Gynaecol. Res. Vol. 41, No. 3: 392–401, March 2015
Role of OATP1B3 in the transport of bile acids assessed using first-trimester trophoblasts Ziru Yan*, Eqiong Li*, Lingfei He, Jianhua Wang, Xiaojun Zhu, Hanzhi Wang and Zhengping Wang School of Medicine, Zhejiang University, Hangzhou, China
Abstract Aims: The aim of this study was to investigate the transport of two kinds of bile acids by organic anion transporting polypeptide 1B3 (OATP1B3) using first-trimester trophoblasts. The mechanisms of damage to fetuses with intrahepatic cholestasis of pregnancy were investigated, providing new potential strategies for targeted therapies aimed at reducing fetal risk. Material and Methods: The expression of OATP1B3 was knocked down by lentiviral vector-mediated RNA interference, and silencing efficiency was assessed using real-time polymerase chain reaction and Western blotting. The cytotoxicity of two bile acids (glycocholic acid [GCA] and glycochenodeoxycholic acid [GCDCA]) was assessed using the MTT method. Transport of bile acids was assessed by establishing an in vitro trophoblast monolayer model using polyester Transwell-clear inserts, and the concentration of bile acids in the upper compartment was assessed using high-pressure liquid chromatography. Results: GCA and GCDCA (10 and 20 μM) were not cytotoxic to the SWAN cell line (P > 0.05). RNAi treatment decreased the mRNA and protein expressions of OATP1B3 by 94.42% and 49.51%, respectively (P < 0.05). The bile acid transport curves were similar in the control and negative RNAi groups, whereas those in the RNAi group differed significantly from those in the control and negative RNAi groups. The concentration of GCA and GCDCA in the upper compartment was significantly lower in the RNAi group than in the control and negative RNAi groups. Conclusions: OATP1B3 expression in trophoblasts was confirmed indirectly by its ability to transport the bile acids GCA and GCDCA. Key words: bile acids, lentivirus, MTT method, organic anion transporting polypeptides, placenta.
Introduction Intrahepatic cholestasis of pregnancy (ICP) is a specific complication that develops in the second and third trimesters of pregnancy and disappears spontaneously after parturition. It is characterized by jaundice, pruritus, elevated serum aminotransferases and especially elevated bile acids. To date, the cause and pathogenesis
of ICP have remained elusive and incompletely understood. It appears to be a multifactorial disease.1 Bile acids have the capacity to destroy the cell membrane and show time- and concentration-dependent cytotoxicity against cultured liver cells, red blood cells, and cardiovascular endothelial cells.2 Owing to the toxicity of bile acids, the morbidity and mortality of perinatal fetuses increases in patients with ICP, which is
Received: December 7 2013. Accepted: July 25 2014. Reprint request to: Dr Zhengping Wang, Women’s Hospital, School of Medicine, Zhejiang University, No. 2 Xueshi Road, Hangzhou, 310006, China. Email: [email protected] *These authors contributed equally to this study.
392
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
Transmembrane transfer of bile acids
associated with disorders such as fetal distress, preterm labor, intrauterine fetal growth restriction and intrauterine death. The fetal liver is able to synthesize bile acids during the second trimester of pregnancy, although the metabolism of bile acids is not fully understood. Bile acids are synthesized in the fetal liver and transported to the maternal blood across the placenta. The hepatobiliary system of the pregnant mother, together with the kidney, constitutes the main route for the elimination of several endogenous and xenobiotic compounds into the bile and urine, respectively. This suggests that the placenta plays an important role in the transport of bile acids between the fetus and mother. Organic anion transporting polypeptides (OATP) constitute a multi-specific transmembrane transporting carrier family. They transport various endo- and xenobiotics, including bile acids, bilirubin, thyroid hormones, steroids, several toxins and numerous drugs. Eleven human OATP have been identified to date.3 OATP are widely expressed in the human liver, placenta, kidney, brain, lung, small intestine, testis, and skeletal muscle.4–11 Certain OATP in the placenta of humans or mice are involved in the transport of bile acids.12,13 OATP1B3 is highly expressed in the human liver and placenta,14,15 and may play an important role in the transport of bile acids in the placenta. However, the specific function of OATP1B3 in the transport of bile acids has not been described to date. The present study was designed to investigate the characteristics of bile acid transport by OATP1B3.
Methods Human trophoblast cell culture The trophoblast cell line SWAN, which was isolated from human first-trimester placentas, was used to investigate the expression of genes involved in the transport of placenta bile acids. The SWAN cell line has a high expression of OATP1B3 and represents a valuable model for in vitro trophoblast studies.16 The SWAN cell line used in the present study was provided by the Women’s Reproductive Health Laboratory of Zhejiang province, Key Laboratory of Reproductive Genetics, Ministry of Education (Zhejiang University, Hangzhou, China), and cultured in complete Dulbecco’s Modified Eagle’s Medium and Ham’s F-12 Nutrient Mixture (DMEM/F12) (Gibco), supplemented with 10% FCS (Tianhang Biological technology). Cells were kept at 37°C under 5% CO2 and 95%
air. Cells were doubled every 2–3 days when they had grown to subconfluence. Cells were harvested by exposure to a trypsin-EDTA solution and then pelleted by centrifugation at 1000 r for 5 min. The cells were used for MTT assays, RNA interference, and establishing in vitro trophoblast monolayer models as described in the following sections.
MTT cytotoxicity assay The viability of the SWAN cell line was assessed using the MTT (3-[4, 5-dimethylthiazol-2-yl]-2, 5diphenyltetrazolium bromide) method, which is based on the reduction of MTT by the mitochondrial dehydrogenase of intact cells to a purple formazan product. Glycocholic acid (GCA) and glycochenodeoxycholic acid (GCDCA) (Sigma-Aldrich) were dissolved separately in ethanol and water. Cells (4 * 103/mL) were plated in 96-well plates and routinely incubated at 37°C prior to use. Cells were divided into four groups as follows: blank group (only serum-free medium), normal control group, bile acids experimental group, and ethanol (bile acid dissolution medium) experimental group. After treatment with GCA (10 and 20 μM) and GCDCA (10 and 20 μM) for 6, 12 and 24 h, 20 μL of MTT (5 mg/mL) was added into each well at pH 7.4. Cells were incubated in the MTT medium for 4 h at 37°C. After solubilization in DMSO and low-speed shock for 10 min, absorbance was measured at 490 nm. The rate of cell viability is defined according to the formula: Cell viability rate = ( OD experimental − OD blank ) ( OD control − OD blank ).
Lentivirus-mediated RNA interference Small interference RNAs (siRNAs) were obtained from Genechem Biotechnoloy Company. We selected one effective target sequence out of four. The effective target sequences of OATP1B3 are shown in Table 1. Lentiviruses were packaged using the GV248 vector with a green fluorescent protein (GFP) and puromycin double marker (Fig. 1) provided by Genechem Biotechnology Company. SWAN cells (3 × 104/mL) were plated in 24-well plates and routinely incubated at 37°C prior to use. When cells reached approximately 30% confluency, lentiviruses diluted in enhanced infection solution were added to the medium (MOI = 20) to infect the cells. Three days later, puromycin, at a final concentration of 4 μg/mL, was added to select a stable
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
393
Z. Yan et al.
Table 1 OATP1B3 target sequence of genetics in experiment Target sequence SLCO1B3/ GV248-RNAi Negative control/ GV248 RNAi Description
5′-CCGGGCTTTAAGATTCCCAGCACTTCTCGAGAAGTGCTGGGAATCTTAAAGCTTTTTG-3′ 5′-AATTCAAAAAGCTTTAAGATTCCCAGCACTTCTCGAGAAGTGCTGGGAATCTTAAAGC-3′ 5′-CCGGTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTG-3′ 5′-AATTCAAAAATTCTCCGAACGTGTCACGTAAGTTCTCTACGTGACACGTTCGGAGAA-3′ Homo sapiens solute carrier organic anion transporter family, member 1B3 (SLCO1B3), mRNA.
and the 2−ΔCT method. The quantification of RNA expression was performed using the 2−ΔCT method as follows: ΔCT = (CTgene of interest – CTinternal control).17,18
Figure 1 Map of GV248 vector with a green fluorescent protein (GFP) and puromycin double marked used for packaging lentiviruses. The sequence: hU6-MCSUbiquitin-EGFP-IRES-puromycin.
cell line. Interference efficiency at the mRNA and protein levels was tested after establishment of a stable cell line.
Determination of RNAi efficiency by real-time reverse transcription polymerase chain reaction Total RNA was extracted using the Trizol reagent (Invitrogen Biotechnology) following the manufacturers’ instructions. RNA was converted to cDNA using a PrimeScript RT reagent kit (Takara Biotechnology). Real-time SYBR Green polymerase chain reaction (PCR) was performed using the two-step method on the ABI 7900HT Fast real-time PCR System (Applied Biosystems). The thermocycler parameters were as follows: 95°C for 10 s, 40 cycles of 95°C for 5 s, and 60°C for 30 s. Glycolytic glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the endogenous control reference. Gene-specific oligonucleotide primers are described in Table 2. Data were analyzed using the comparative threshold cycle (CT) method
394
Determination of RNAi efficiency by Western blotting Protein was extracted from SWAN cells with the RIPA lysis solution (Beyotime Institute of Biotechnology) according to the manufacturers’ instructions. Protein samples (25 μg) were separated by 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto PVDF membranes (Millipore Corporation). The membranes were blocked in 5% (w/v) milk in TBST for 1 h at room temperature and then incubated with primary antibodies against OATP1B3 (1:400, sc-98981, human origin) and GAPDH (1:1000, Cat2251-1) for 1 h at room temperature or overnight at 4°C, and subsequently incubated in horseradish peroxidase-conjugated secondary antibodies (1:8000 for OATP1B3 and 1:5000 for GAPDH) for 1 h at room temperature. An enhanced chemiluminescence reagent (Biological Industries) was used to visualize the signal, which was exposed to film. The intensity of bands was quantified with a densitometer (Image Quant LAS 4000 Mini, GE Healthcare) equipped with Quantity One software (GE Healthcare). Use of polyester Transwell-clear inserts to establish in vitro trophoblast monolayer models Transendothelial electrical resistance measurement: Normal SWAN cells and RNAi SWAN cells (1.12 × 105/ mL) were plated in 12-well polyester (PET) membrane Transwell culture plates (Corning), and 0.5 mL and 1.5 mL DMEM/F12 medium containing 10% FCS was added to the upper and lower compartments, respectively (Fig. 2). The cells were cultured for 4, 8, and 12 h, and 1, 2, 3, 4, 5, 6, 7 and 8 days. The real-time cell electronic sensing system (EMD Millipore Corporation) was used to test the transendothelial electrical resistance (TEER) according to the manufacturer’s
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
Transmembrane transfer of bile acids
Table 2 Primers, products size and annealing temperature Genes
Primers (forward and reverse)
Products size (bp)
Annealing temperature (°C)
OATP1B3
GTCCAGTCATTGGCTTTGCA CAACCCAACGAGAGTCCTTAGG GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTC
111
60
GAPDH
87
bp, base pair; GAPDH, glycolytic glyceraldehydes-3-phosphate dehydrogenase; OATP1B3, organic anion transporting polypeptide 1B3.
with medium without FCS and maintained at 37°C for 1 h. Normal cells, negative RNAi cells, and RNAi cells were plated in the Transwell plates. GCA (10 μM) and GCDCA (10 μM) were added to the upper compartment, and samples were collected from the upper and lower compartments after 0, 20, 40, 60, 80, 100 and 120 min. The concentration of the two bile acids in the upper compartment was analyzed by high-pressure liquid chromatography (HPLC) using an Agilent 1100 system (Agilent Technologies).
Figure 2 Diagram of in vitro monolayer cells model. Three main sections were involved: upper compartment, microporous membrane, lower compartment. Upper and lower compartment were disported by the cells (normal cells, NC-RNAi cells, RNAi-cells) on microporous membrane.
instructions, and the tightness of the monolayer cells was determined. The TEER value is defined according to the formula:
Resistance (cm ) = (R sample − R blank ) × membrane area (cm 2 ) 2
(The membrane area of a 12-well Transwell culture plate is 1.12 cm2).
OATP1B3 bile acid transport studies and high-pressure liquid chromatography analysis Transwell inserts were used to study OATP1B3mediated bile acid transport. An initial equilibration period was used to improve cell attachment by adding absolute medium to the multiple well plates and to the Transwell inserts followed by overnight incubation. Then, the absolute medium in the plates was replaced
Chromatography conditions The chromatography column used was SB-C18 (250 mm × 4.6 mm, 5 μm) (Zorbax, Agilent Technologies). The mobile phase for GCA was acetonitrile/ phosphate buffer (PH 3.0, 80/20), and that for GCDCA was acetonitrile/phosphate buffer (PH 3.0, 70/30). The temperature was 25°C, flow rate was 1.0 mL/min, and detection wavelength was 203 nm. Sample preparation for HPLC An aliquot of 800 μL of each sample was collected and filtered through a 0.2-μm Millipore filter. Then, 20 μL of each sample was subjected to HPLC. Statistical analysis Data analysis was performed using spss 16.0, and the statistical comparisons among groups were carried out using the independent-samples t-test, one-way anova, random blocks design anova, and multiple-factor repetitive measurement. Two-sided tests were performed. P < 0.05 was considered statistically significant.
Results MTT cytotoxicity assay The results of the MTT assay showed no significant cytotoxicity in cells incubated with GCA (10 and 20 μM) or GCDCA (10 and 20 μM) for 6, 12 and 24 h compared with the control group (P > 0.05) (Fig. 3a, b).
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
395
Z. Yan et al.
Figure 4 Abundance of mRNA expression of OATP1B3 in SWAN cells in blank group, negative RNAi group (NC-RNAi) and RNAi group (OATP1B3-RNAi). Values are expressed as mean ± standard deviation (n = 3). *P < 0.05 vs negative RNAi group.
compared to that in the negative RNAi group (Fig. 4). No significant differences in mRNA levels were observed between the negative RNAi group and the blank group (P > 0.05).
Figure 3 (a) Cell viability rate after treatment with glycocholic acid (GCA) for different times. Values are means ± standard deviation (SD), n = 4, P < 0.05 com, CGA10; , CGA20. pared with the control. (b) Cell viability rate after treatment with glycochenodeoxycholic acid (GCDCA) for different times. Values are means ± SD, n = 4, P < 0.05 compared with the control. Experiments were repeated 3 times , GCDCA10; , GCDCA20. with similar results.
GCA and GCDCA were used at a concentration of 10 μM for transport studies.
Efficiency of RNA interference mRNA expression of OATP1B3 The mRNA levels of OATP1B3 were significantly downregulated in the RNAi group compared to those in the negative RNAi group and the blank group (P < 0.05), with a 94.42% decrease in the RNAi group
396
Protein expression of OATP1B3 The protein levels of OATP1B3 were significantly downregulated in the RNAi group compared to those in the negative RNAi group and the blank group (P < 0.05), with a 49.51% decrease in the experimental group compared to that in the negative RNAi group (Fig. 5). No significant differences in OATP1B3 protein levels were observed between the negative RNAi group and the blank group (P > 0.05). Transendothelial electrical impedance of SWAN monolayer cells Normal cells and RNAi cells were plated in 12-well Transwell plates and incubated for 0, 4, 8 and 12 h, and 1–8 days. The growth conditions of cells were observed using an inverted microscope (Fig. 6a). The transendothelial electrical resistance was monitored at each time-point (Table 3, Fig. 6b), and the growth of cells appeared to reach a plateau at 12 h in the normal and RNAi groups. The TEER values at 0, 4 and 8 h were significantly different from those at 12 h to 8 days (P < 0.05). The TEER values between 12 h and 1–8 days showed no significant differences (P > 0.05). The TEER values at each time-point were not different between the normal and RNAi groups (P > 0.05). The addition of GCA or GCDCA did not affect the
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
Transmembrane transfer of bile acids
Figure 5 Abundance of protein expression of OATP1B3 in SWAN cells in blank group, negative RNAi group (NC-RNAi) and RNAi group (OATP1B3-RNAi). Values are expressed as mean ± standard deviation (n = 3). *P < 0.05 vs negative RNAi group.
TEER value. We selected the wells with a TEER value ≥ 31.90 ± 1.47 Ω/cm2 in the normal group and a TEER value ≥ 30.24 ± 0.97 Ω/cm2 in the RNAi group as monolayer cell models for transport studies.
GCA and GCDCA transport analysis GCA and GCDCA at a final concentration of 10 μM were added to the medium in the upper compartment without FCS. After incubation at 37°C, with 5% CO2 for 0, 20, 40, 60, 80, 100 and 120 min, samples in the upper and lower compartments were collected and analyzed using HPLC (Tables 4 and 5). Transport curves were drawn according to the concentration of GCA and GCDCA in the upper compartment samples (Fig. 7a, b). The bile acid transport curves were almost identical between the normal group and the negative RNAi group, whereas those of the RNAi group were significantly different from those of the normal group and the negative RNAi group (P < 0.05). In these two groups, the concentration of GCA and GCDCA in the upper compartment was significantly lower than that of the RNAi group.
Figure 6 (a) Growth condition of SWAN cells on the polyester membrane of 12-well transwell plates observed under inverted microscope (×100). (b) The transendothelial electrical resistance (TEER) value of normal SWAN monolayer cells model and RNAi monolayer cells model at different times. The growth of cells appeared to reach a plateau at the 12-h point. Values are expressed as mean ± standard deviation , normal group; , RNAi group. (n = 3).
Discussion To date, several studies have investigated the categories, function, and regulatory metabolism of bile acid transporters in the liver; however, little is known about their characteristics in the placenta. Studies have shown that OATP,4,19–21 NTCP,22 BSEP,23 MRP,24–30 MDR, FIC1,31 and TGR5(Gpbar-1)32 participate in bile acid transport in the human liver. OATP are Na+ and ATPindependent transporters.33,34 In the human placenta, the presence of OATP, MDR3, FIC1, BSEP,35 BCRP,14 and TGR5 (Gpbar-1)32 was demonstrated but not that of NTCP.35 High expression of OATP2B1, OATP1B3, BCRP, and FIC1 was detected in trophoblasts isolated from human term placentas, whereas the expression of
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
397
Z. Yan et al.
Table 3 TEER values of SWAN monolayer cells tested at different times Time
Normal group
RNAi group
4h 8h 12 h 1 day 2 days 3 days 4 days 5 days 6 days 7 days 8 days
14 ± 0 23.15 ± 1.80 31.92 ± 1.94 31.73 ± 2.26 31.73 ± 1.80 32.11 ± 1.62 32.30 ± 1.80 32.30 ± 1.71 32.11 ± 1.41 31.73 ± 1.29 31.17 ± 1.41
12.88 ± 1.12 21.09 ± 0.32 30.24 ± 0.97 32.48 ± 1.12 30.99 ± 1.17 31.36 ± 0.97 31.73 ± 1.17 31.36 ± 0.00 31.55 ± 0.32 30.80 ± 0.56 32.48 ± 1.12
TEER value was obtained at 4, 8, 12 h, 1–8 days after SWAN cells were plated in 12-well transwell plates. Results are expressed as mean ± standard deviation (n = 3). TEER, transendothelial electrical resistance.
OATP1A2 and MDR3 is downregulated, and OATP1B1 is not detectable.14 The expression of OATP1B3 is higher than that of OATP1A2 and OATP1B1 both in the human liver and placenta.15 In our research, we chose OATP1B3 as the study objective because it is highly expressed in the human placenta. CA, GCA, GUDCA, TCA, TCDCA, TDCA, and TUDCA have been shown to be the substrates of OATP1B3 in the human liver.19,36,37 In the present study, we indirectly found that OATP1B3 is involved in the transport of GCA and GCDCA, and we showed for the first time that GCDCA is a substrate of OATP1B3. We compared the RNAi group with the negative RNAi group and showed that GCA and GCDCA transport was significantly decreased in the RNAi group compared to that in the negative RNAi group. However, a certain amount of GCA and GCDCA was transported in the RNAi group. It is possible that a small amount
Table 4 Concentration of GCA in the samples collected at different times in the upper compartment (μM) Time (min)
Blank
Normal
NC-RNAi
OATP1B3RNAi
0 20 40 60 80 100 120
9.88 ± 0.26 9.48 ± 0.62 9.92 ± 0.11 9.77 ± 0.47 9.60 ± 0.79 9.61 ± 0.41 9.54 ± 0.80
9.62 ± 0.32 5.24 ± 0.41 3.95 ± 0.73 8.50 ± 0.43 8.60 ± 0.39 8.76 ± 0.46 8.84 ± 0.69
9.41 ± 0.34 6.15 ± 0.64 5.15 ± 0.82 7.22 ± 0.43 8.86 ± 0.16 8.40 ± 0.39 9.26 ± 0.32
9.42 ± 0.38 7.80 ± 0.69 9.73 ± 1.28 9.69 ± 0.86 9.31 ± 0.18 9.29 ± 0.06 9.64 ± 0.12
GCA (10 μM) added to the upper compartment for 0, 20, 40, 60, 80, 100 and 120 min were collected for assay. There were four groups: blank group without cells, normal group, negative samples control RNAi group, OATP1B3 RNAi group. The results are expressed as mean ± standard deviation (n = 3). GCA, glycocholic acid.
Table 5 Concentration of GCDCA in the samples collected at different times in the upper compartment (μM) Time (min)
Blank
Normal
NC-RNAi
OATP1B3RNAi
0 20 40 60 80 100 120
8.76 ± 0.40 8.73 ± 0.59 8.76 ± 0.70 8.64 ± 0.30 9.13 ± 0.60 8.60 ± 0.75 8.83 ± 0.53
9.58 ± 0.28 7.56 ± 0.18 4.88 ± 0.80 7.35 ± 0.16 7.34 ± 0.35 7.47 ± 0.16 7.42 ± 0.33
9.39 ± 0.06 6.17 ± 0.38 5.20 ± 0.09 7.04 ± 0.09 7.13 ± 0.43 8.20 ± 0.48 7.93 ± 0.18
9.38 ± 0.21 8.71 ± 0.13 8.93 ± 0.21 8.83 ± 0.58 8.88 ± 0.49 8.62 ± 0.41 8.69 ± 0.12
After GCDCA was added to the upper compartment for 0 min, 20 min, 40 min, 60 min, 80 min, 100 min and 120 min, samples were collected for assay. There were four groups: blank group without cell, normal group, negative control RNAi group and OATP1B3 RNAi group. The results are expressed as mean ± standard deviation (n = 3). GCDCA, glycochenodeoxycholic acid.
398
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
Transmembrane transfer of bile acids
Figure 7 (a) Transport curves of glycocholic acid (GCA) according to the concentration of GCA in the samples in the upper compartment obtained at different times. The results are expressed as mean ± standard deviation (SD) (n = 3). (b) The transport curves of glycochenodeoxycholic acid (GCDCA) according to the concentration of GCDCA in the samples in the upper compartment obtained at different times. The results , blank (without are expressed as mean ± SD (n = 3). , normal; , NC-RNAi; , OATP1B3-RNAi. cell);
GCA/GCDCA can diffuse freely through the membrane, although it did not affect the final results. Our results indicated that OATP1B3 may play an important role in the transport of GCA and GCDCA in the human placenta. In the peripheral blood of pregnant women with ICP, TCA and GCA are the most abundant bile acids, followed by TCDCA, GCDCA, TDCA, GDCA, TUDCA and GUDCA, with the least abundant being TLCA and GLCA. Compared with normal pregnant women, CA, TCA, TCDCA, TLCA, TUDCA, GCA and GCDCA are increased, whereas CDCA, DCA, LCA, UDCA, GLCA and GUDCA show no significant differences.38 In our previous study, we demonstrated that the expression
of OATP1A2 and OATP1B3 is downregulated in ICP placentas compared with the normal placenta.39 It was reported that OATP may have a bidirectional transport function.34,40 Based on these findings, we speculated that bile acids, such as GCA and GCDCA, may be significantly increased in the serum of pregnant women with ICP because of the bidirectional transport function of OATP1B3, which implies that high concentrations of GCA and GCDCA could be transported towards the fetus. Downregulation of OATP1B3 expression in ICP placentas may reduce the transport of GCA and GCDCA in the placenta; this could decrease the concentration of bile acids transported from the maternal serum to the fetus. On the other hand, downregulation of OATP1B3 expression and an increase in the concentration of bile acids in the maternal blood may impair the transport of GCA and GCDCA in the fetal blood to the maternal blood for metabolism and excretion. This may cause the accumulation of bile acids in the fetal blood, and the cytotoxicity of the accumulated bile acids could increase the risk to the fetus. We used lentiviral vector-mediated RNA interference technology in our research to knock down OATP1B3 expression in an efficient, specific and stable manner. This vector is the preferred tool for RNAi experiments, and it is one of the principal tools for investigation involving gene therapy and vector research in transgenic animals.41 We successfully selected a stably transfected cell line with high interference efficiency using puromycin and gene expression level detection. In addition, we used human trophoblasts to establish a monolayer cell model in vitro to study the transport of substrates. In conclusion, GCA and GCDCA at concentrations below 20 μM are not cytotoxic against human trophoblasts. OATP1B3 expression in a trophoblast cell line was confirmed by its ability to transport the bile acids GCA and GCDCA.
Acknowledgment This study was financially supported by ZJNSF (No Y2100411).
Disclosure There is no financial interest with any companies in this manuscript.
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
399
Z. Yan et al.
References 1. Saleh MM, Abdo KR. Intrahepatic cholestasis of pregnancy: Review of the literature and evaluation of current evidence. J Womens Health 2007; 16: 833–841. 2. Ostrow JD. In vitro studies of bile salt toxicity. Hepatology 1994; 19: 1538–1539. 3. Hagenbuch B, Gui C. Xenobiotic transporters of the human organic anion transporting polypeptides (OATP) family. Xenobiotica 2008; 38: 778–801. 4. Kullak-Ublick GA, Hagenbuch B, Stieger B et al. Molecular and functional characterization of an organic anion transporting polypeptide cloned from human liver. Gastroenterology 1995; 109: 1274–1282. 5. Lee W, Glaeser H, Smith LH et al. Polymorphisms in human organic anion-transporting polypeptide 1A2 (OATP1A2): Implications for altered drug disposition and central nervous system drug entry. J Biol Chem 2005; 280: 9610– 9617. 6. Glaeser H, Bailey DG, Dresser GK et al. Intestinal drug transporter expression and the impact of grapefruit juice in humans. Clin Pharmacol Ther 2007; 81: 362–370. 7. Hagenbuch B. Cellular entry of thyroid hormones by organic anion transporting polypeptides. Best Pract Res Clin Endocrinol Metab 2007; 21: 209–221. 8. Huber RD, Gao B, Sidler Pfandler MA et al. Characterization of two splice variants of human organic anion transporting polypeptide 3A1 isolated from human brain. Am J Physiol Cell Physiol 2007; 292: C795–C806. 9. Adachi H, Suzuki T, Abe M et al. Molecular characterization of human and rat organic anion transporter OATP-D. Am J Physiol Renal Physiol 2003; 285: 1188–1197. 10. Sato K, Sugawara J, Sato T et al. Expression of organic anion transporting polypeptide E (OATP-E) in human placenta. Placenta 2003; 24: 144–148. 11. Tamai I, Nezu J, Uchino H et al. Molecular identification and characterization of novel members of the human organic anion transporter (OATP) family. Biochem Biophys Res Commun 2000; 273: 251–260. 12. St-Pierre MV, Kullak-Ublick GA, Hagenbuch B, Meier PJ. Identification of bile salt transporters in rat and human placenta. J Hepatol (1999) 30: 141–141 (Abstract). 13. Marin JJ, Macias RI, Vallejo M et al. The influence of ursodeoxycholic acid and maternal cholestasis on the bile acid transport across the placenta. In: Leuschner U, Berg PA, Holtmeier J (eds). Bile Acids and Pregnancy. Frankfurt: Kluwer, 2003; 46–52. 14. Serrano MA, Macias RI, Briz O et al. Expression in human trophoblast and choriocarcinoma cell lines, BeWo, Jeg-3, and Jar of genes involved in the hepatobiliary-like excretory function of the placenta. Placenta 2007; 28: 107– 117. 15. Briz O, Serrano MA, Maclas RI, Gonzalez-Gallego J, Marin JJ. Role of organic anion-transporting polypeptides, OATP-A, OATP-C and OATP-8, in the human placenta-maternal liver tandem excretory pathway for foetal bilirubin. Biochem J 2003; 371: 897–905. 16. Straszewski-Chavez SL, Abrahams VM, Alvero AB et al. The isolation and characterization of a novel telomerase immortalized first trimester trophoblast cell line, Swan 71. Placenta 2009; 30: 939–948.
400
17. Livak KJ, Schmittgen TD. Analysis of relative genes expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001; 25: 402–408. 18. Schmittgen TD, Livak KJ. Analyzing real-time PCR data by comparative CT method. Nat Protoc 2008; 3: 1101– 1108. 19. Kullak-Ublick GA, Ismair MG, Stieger B et al. Organic aniontransporting polypeptide B (OATP-B) and its functional comparison with three OATPs of human liver. Gastroenterology 2001; 120: 525–533. 20. Konig J, Cui Y, Nies AT et al. Localization and genomic organization of a new hepatocellular organic anion transporting polypeptide. J Biol Chem 2000; 275: 23161–23168. 21. Abe T, Kakyo M, Tokui T et al. Identification of a novel gene family encoding human liver-specific organic anion transporter LST-1. J Biol Chem 1999; 274: 17159–17163. 22. Hagenbuch B, Meier PJ. Molecular cloning, chromosomal localization and functional characterization of a human liver Na+/bile acid cotransporter. J Clin Invest 1994; 93: 1326–1331. 23. Strautnieks SS, Bull LN, Knisely AS et al. A gene encoding a liver-specific ABC transporter is mutated in progressive familial intra-hepatic cholestasis. Nat Genet 1998; 20: 233–238. 24. Cui Y, Konig J, Buchholz JK et al. Drug resistance and ATPdependent conjugate transport mediated by the apical multidrug resistance protein, MRP2, permanently expressed in human and canine cells. Mol Pharmacol 1999; 55: 929–937. 25. Evers R, Kool M, van Deemter L et al. Drug export activity of the human canalicular multispecific organic anion transporter in polarized kidney MDCK cells expressing cMOAT (MRP2) cDNA. J Clin Invest 1998; 101: 1310–1319. 26. Paulusma CC, Kool M, Bosma PJ et al. A mutation in the human canalicular multispecific organic anion transporter gene causes the Dubin-Johnson syndrome. Hepatology 1997; 25: 1539–1542. 27. Konig J, Rost D, Cui Y et al. Characterization of the human multidrug resistance protein isoform MRP3 localized to the basolateral hepatocyte membrane. Hepatology 1999; 29: 1156– 1163. 28. Kool M, van der Linden M, de Haas M et al. MRP3, an organic anion transporter able to transport anti-cancer drugs. Proc Natl Acad Sci U S A 1999; 96: 6914–6919. 29. Zeng H, Liu G, Rea PA et al. Transport of amphipathic anions by human multidrug resistance protein 3. Cancer Res 2000; 60: 4779–4784. 30. Roelofsen H, Vos TA, Schippers IJ et al. Increased levels of the multidrug resistance protein in lateral membranes of proliferating hepatocyte-derived cells. Gastroenterology 1997; 112: 511–521. 31. Wagner M, Zollner G, Trauner M. New molecular insights into the mechanisms of cholestasis. J Hepatol 2009; 51: 565– 580. 32. Keitel V, Spomer L, Marin JJG et al. Effect of maternal cholestasis on TGR5 expression in human and rat placenta at term. Placenta 2013; 34: 810–816. 33. Arrese M, Trauner M. Molecular aspects of bile formation and cholestasis. Trends Mol Med 2003; 9: 558–564. 34. Mahagita C, Grassl SM, Piyachaturawat P, Ballatori N. Human organic anion transporter 1B1 and 1B3 function as bidirectional carriers and do not mediate GSH bile acid cotransport. Am J Physiol Gastrointest Liver Physiol 2007; 293: G271–G278.
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
Transmembrane transfer of bile acids
35. Patel P, Weerasekera N, Hitchins M et al. Semi quantitative expression analysis of MDR3, FIC1, BSEP, OATP-A, OATP-C, OATP-D, OATP-E and NTCP gene transcripts in 1st and 3rd trimester human placenta. Placenta 2003; 24: 39–44. 36. Briz O, Romero MR, Martinez-Becerra P et al. OATP8/1B3mediated cotransport of bile acids and glutathione: An export pathway for organic anions from hepatocytes? J Biol Chem 2006; 281: 30326–30335. 37. Maeda K, Kambara M, Tian Y et al. Uptake of ursodeoxycholate and its conjugates by human hepatocytes: Role of Na(+) – taurocholate cotransporting polypeptide (NTCP), organic anion transporting polypeptide (OATP) 1B1 (OATP-C), and oatp 1B3 (OATP8). Mol Pharm 2006; 3: 70–77.
38. Tribe RM, Dann AT, Kenyon AP et al. Longitudinal profiles of 15 serum bile acids in patients with intrahepatic cholestasis of pregnancy. Am J Gastroenterol 2010; 105: 585–595. 39. Wang H, Yan Z, Dong M et al. Alteration in placental expression of bile acids transporters OATP1A2, OATP1B1, OATP1B3 in intrahepatic cholestasis of pregnancy. Arch Gynecol Obstet 2012; 285: 1535–1540. 40. Macias RI, Marin JJ, Serrano MA. Excretion of biliary compounds during intrauterine life. World J Gastroenterol 2009; 15: 817–828. 41. Morris KV, Rossi JJ. Lentiviral-mediated delivery of siRNAs for antiviral therapy. Gene Ther 2006; 13: 553– 558.
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
401
Copyright of Journal of Obstetrics & Gynaecology Research is the property of WileyBlackwell and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
doi:10.1111/jog.12549
J. Obstet. Gynaecol. Res. Vol. 41, No. 3: 392–401, March 2015
Role of OATP1B3 in the transport of bile acids assessed using first-trimester trophoblasts Ziru Yan*, Eqiong Li*, Lingfei He, Jianhua Wang, Xiaojun Zhu, Hanzhi Wang and Zhengping Wang School of Medicine, Zhejiang University, Hangzhou, China
Abstract Aims: The aim of this study was to investigate the transport of two kinds of bile acids by organic anion transporting polypeptide 1B3 (OATP1B3) using first-trimester trophoblasts. The mechanisms of damage to fetuses with intrahepatic cholestasis of pregnancy were investigated, providing new potential strategies for targeted therapies aimed at reducing fetal risk. Material and Methods: The expression of OATP1B3 was knocked down by lentiviral vector-mediated RNA interference, and silencing efficiency was assessed using real-time polymerase chain reaction and Western blotting. The cytotoxicity of two bile acids (glycocholic acid [GCA] and glycochenodeoxycholic acid [GCDCA]) was assessed using the MTT method. Transport of bile acids was assessed by establishing an in vitro trophoblast monolayer model using polyester Transwell-clear inserts, and the concentration of bile acids in the upper compartment was assessed using high-pressure liquid chromatography. Results: GCA and GCDCA (10 and 20 μM) were not cytotoxic to the SWAN cell line (P > 0.05). RNAi treatment decreased the mRNA and protein expressions of OATP1B3 by 94.42% and 49.51%, respectively (P < 0.05). The bile acid transport curves were similar in the control and negative RNAi groups, whereas those in the RNAi group differed significantly from those in the control and negative RNAi groups. The concentration of GCA and GCDCA in the upper compartment was significantly lower in the RNAi group than in the control and negative RNAi groups. Conclusions: OATP1B3 expression in trophoblasts was confirmed indirectly by its ability to transport the bile acids GCA and GCDCA. Key words: bile acids, lentivirus, MTT method, organic anion transporting polypeptides, placenta.
Introduction Intrahepatic cholestasis of pregnancy (ICP) is a specific complication that develops in the second and third trimesters of pregnancy and disappears spontaneously after parturition. It is characterized by jaundice, pruritus, elevated serum aminotransferases and especially elevated bile acids. To date, the cause and pathogenesis
of ICP have remained elusive and incompletely understood. It appears to be a multifactorial disease.1 Bile acids have the capacity to destroy the cell membrane and show time- and concentration-dependent cytotoxicity against cultured liver cells, red blood cells, and cardiovascular endothelial cells.2 Owing to the toxicity of bile acids, the morbidity and mortality of perinatal fetuses increases in patients with ICP, which is
Received: December 7 2013. Accepted: July 25 2014. Reprint request to: Dr Zhengping Wang, Women’s Hospital, School of Medicine, Zhejiang University, No. 2 Xueshi Road, Hangzhou, 310006, China. Email: [email protected] *These authors contributed equally to this study.
392
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
Transmembrane transfer of bile acids
associated with disorders such as fetal distress, preterm labor, intrauterine fetal growth restriction and intrauterine death. The fetal liver is able to synthesize bile acids during the second trimester of pregnancy, although the metabolism of bile acids is not fully understood. Bile acids are synthesized in the fetal liver and transported to the maternal blood across the placenta. The hepatobiliary system of the pregnant mother, together with the kidney, constitutes the main route for the elimination of several endogenous and xenobiotic compounds into the bile and urine, respectively. This suggests that the placenta plays an important role in the transport of bile acids between the fetus and mother. Organic anion transporting polypeptides (OATP) constitute a multi-specific transmembrane transporting carrier family. They transport various endo- and xenobiotics, including bile acids, bilirubin, thyroid hormones, steroids, several toxins and numerous drugs. Eleven human OATP have been identified to date.3 OATP are widely expressed in the human liver, placenta, kidney, brain, lung, small intestine, testis, and skeletal muscle.4–11 Certain OATP in the placenta of humans or mice are involved in the transport of bile acids.12,13 OATP1B3 is highly expressed in the human liver and placenta,14,15 and may play an important role in the transport of bile acids in the placenta. However, the specific function of OATP1B3 in the transport of bile acids has not been described to date. The present study was designed to investigate the characteristics of bile acid transport by OATP1B3.
Methods Human trophoblast cell culture The trophoblast cell line SWAN, which was isolated from human first-trimester placentas, was used to investigate the expression of genes involved in the transport of placenta bile acids. The SWAN cell line has a high expression of OATP1B3 and represents a valuable model for in vitro trophoblast studies.16 The SWAN cell line used in the present study was provided by the Women’s Reproductive Health Laboratory of Zhejiang province, Key Laboratory of Reproductive Genetics, Ministry of Education (Zhejiang University, Hangzhou, China), and cultured in complete Dulbecco’s Modified Eagle’s Medium and Ham’s F-12 Nutrient Mixture (DMEM/F12) (Gibco), supplemented with 10% FCS (Tianhang Biological technology). Cells were kept at 37°C under 5% CO2 and 95%
air. Cells were doubled every 2–3 days when they had grown to subconfluence. Cells were harvested by exposure to a trypsin-EDTA solution and then pelleted by centrifugation at 1000 r for 5 min. The cells were used for MTT assays, RNA interference, and establishing in vitro trophoblast monolayer models as described in the following sections.
MTT cytotoxicity assay The viability of the SWAN cell line was assessed using the MTT (3-[4, 5-dimethylthiazol-2-yl]-2, 5diphenyltetrazolium bromide) method, which is based on the reduction of MTT by the mitochondrial dehydrogenase of intact cells to a purple formazan product. Glycocholic acid (GCA) and glycochenodeoxycholic acid (GCDCA) (Sigma-Aldrich) were dissolved separately in ethanol and water. Cells (4 * 103/mL) were plated in 96-well plates and routinely incubated at 37°C prior to use. Cells were divided into four groups as follows: blank group (only serum-free medium), normal control group, bile acids experimental group, and ethanol (bile acid dissolution medium) experimental group. After treatment with GCA (10 and 20 μM) and GCDCA (10 and 20 μM) for 6, 12 and 24 h, 20 μL of MTT (5 mg/mL) was added into each well at pH 7.4. Cells were incubated in the MTT medium for 4 h at 37°C. After solubilization in DMSO and low-speed shock for 10 min, absorbance was measured at 490 nm. The rate of cell viability is defined according to the formula: Cell viability rate = ( OD experimental − OD blank ) ( OD control − OD blank ).
Lentivirus-mediated RNA interference Small interference RNAs (siRNAs) were obtained from Genechem Biotechnoloy Company. We selected one effective target sequence out of four. The effective target sequences of OATP1B3 are shown in Table 1. Lentiviruses were packaged using the GV248 vector with a green fluorescent protein (GFP) and puromycin double marker (Fig. 1) provided by Genechem Biotechnology Company. SWAN cells (3 × 104/mL) were plated in 24-well plates and routinely incubated at 37°C prior to use. When cells reached approximately 30% confluency, lentiviruses diluted in enhanced infection solution were added to the medium (MOI = 20) to infect the cells. Three days later, puromycin, at a final concentration of 4 μg/mL, was added to select a stable
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
393
Z. Yan et al.
Table 1 OATP1B3 target sequence of genetics in experiment Target sequence SLCO1B3/ GV248-RNAi Negative control/ GV248 RNAi Description
5′-CCGGGCTTTAAGATTCCCAGCACTTCTCGAGAAGTGCTGGGAATCTTAAAGCTTTTTG-3′ 5′-AATTCAAAAAGCTTTAAGATTCCCAGCACTTCTCGAGAAGTGCTGGGAATCTTAAAGC-3′ 5′-CCGGTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTG-3′ 5′-AATTCAAAAATTCTCCGAACGTGTCACGTAAGTTCTCTACGTGACACGTTCGGAGAA-3′ Homo sapiens solute carrier organic anion transporter family, member 1B3 (SLCO1B3), mRNA.
and the 2−ΔCT method. The quantification of RNA expression was performed using the 2−ΔCT method as follows: ΔCT = (CTgene of interest – CTinternal control).17,18
Figure 1 Map of GV248 vector with a green fluorescent protein (GFP) and puromycin double marked used for packaging lentiviruses. The sequence: hU6-MCSUbiquitin-EGFP-IRES-puromycin.
cell line. Interference efficiency at the mRNA and protein levels was tested after establishment of a stable cell line.
Determination of RNAi efficiency by real-time reverse transcription polymerase chain reaction Total RNA was extracted using the Trizol reagent (Invitrogen Biotechnology) following the manufacturers’ instructions. RNA was converted to cDNA using a PrimeScript RT reagent kit (Takara Biotechnology). Real-time SYBR Green polymerase chain reaction (PCR) was performed using the two-step method on the ABI 7900HT Fast real-time PCR System (Applied Biosystems). The thermocycler parameters were as follows: 95°C for 10 s, 40 cycles of 95°C for 5 s, and 60°C for 30 s. Glycolytic glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the endogenous control reference. Gene-specific oligonucleotide primers are described in Table 2. Data were analyzed using the comparative threshold cycle (CT) method
394
Determination of RNAi efficiency by Western blotting Protein was extracted from SWAN cells with the RIPA lysis solution (Beyotime Institute of Biotechnology) according to the manufacturers’ instructions. Protein samples (25 μg) were separated by 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto PVDF membranes (Millipore Corporation). The membranes were blocked in 5% (w/v) milk in TBST for 1 h at room temperature and then incubated with primary antibodies against OATP1B3 (1:400, sc-98981, human origin) and GAPDH (1:1000, Cat2251-1) for 1 h at room temperature or overnight at 4°C, and subsequently incubated in horseradish peroxidase-conjugated secondary antibodies (1:8000 for OATP1B3 and 1:5000 for GAPDH) for 1 h at room temperature. An enhanced chemiluminescence reagent (Biological Industries) was used to visualize the signal, which was exposed to film. The intensity of bands was quantified with a densitometer (Image Quant LAS 4000 Mini, GE Healthcare) equipped with Quantity One software (GE Healthcare). Use of polyester Transwell-clear inserts to establish in vitro trophoblast monolayer models Transendothelial electrical resistance measurement: Normal SWAN cells and RNAi SWAN cells (1.12 × 105/ mL) were plated in 12-well polyester (PET) membrane Transwell culture plates (Corning), and 0.5 mL and 1.5 mL DMEM/F12 medium containing 10% FCS was added to the upper and lower compartments, respectively (Fig. 2). The cells were cultured for 4, 8, and 12 h, and 1, 2, 3, 4, 5, 6, 7 and 8 days. The real-time cell electronic sensing system (EMD Millipore Corporation) was used to test the transendothelial electrical resistance (TEER) according to the manufacturer’s
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
Transmembrane transfer of bile acids
Table 2 Primers, products size and annealing temperature Genes
Primers (forward and reverse)
Products size (bp)
Annealing temperature (°C)
OATP1B3
GTCCAGTCATTGGCTTTGCA CAACCCAACGAGAGTCCTTAGG GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTC
111
60
GAPDH
87
bp, base pair; GAPDH, glycolytic glyceraldehydes-3-phosphate dehydrogenase; OATP1B3, organic anion transporting polypeptide 1B3.
with medium without FCS and maintained at 37°C for 1 h. Normal cells, negative RNAi cells, and RNAi cells were plated in the Transwell plates. GCA (10 μM) and GCDCA (10 μM) were added to the upper compartment, and samples were collected from the upper and lower compartments after 0, 20, 40, 60, 80, 100 and 120 min. The concentration of the two bile acids in the upper compartment was analyzed by high-pressure liquid chromatography (HPLC) using an Agilent 1100 system (Agilent Technologies).
Figure 2 Diagram of in vitro monolayer cells model. Three main sections were involved: upper compartment, microporous membrane, lower compartment. Upper and lower compartment were disported by the cells (normal cells, NC-RNAi cells, RNAi-cells) on microporous membrane.
instructions, and the tightness of the monolayer cells was determined. The TEER value is defined according to the formula:
Resistance (cm ) = (R sample − R blank ) × membrane area (cm 2 ) 2
(The membrane area of a 12-well Transwell culture plate is 1.12 cm2).
OATP1B3 bile acid transport studies and high-pressure liquid chromatography analysis Transwell inserts were used to study OATP1B3mediated bile acid transport. An initial equilibration period was used to improve cell attachment by adding absolute medium to the multiple well plates and to the Transwell inserts followed by overnight incubation. Then, the absolute medium in the plates was replaced
Chromatography conditions The chromatography column used was SB-C18 (250 mm × 4.6 mm, 5 μm) (Zorbax, Agilent Technologies). The mobile phase for GCA was acetonitrile/ phosphate buffer (PH 3.0, 80/20), and that for GCDCA was acetonitrile/phosphate buffer (PH 3.0, 70/30). The temperature was 25°C, flow rate was 1.0 mL/min, and detection wavelength was 203 nm. Sample preparation for HPLC An aliquot of 800 μL of each sample was collected and filtered through a 0.2-μm Millipore filter. Then, 20 μL of each sample was subjected to HPLC. Statistical analysis Data analysis was performed using spss 16.0, and the statistical comparisons among groups were carried out using the independent-samples t-test, one-way anova, random blocks design anova, and multiple-factor repetitive measurement. Two-sided tests were performed. P < 0.05 was considered statistically significant.
Results MTT cytotoxicity assay The results of the MTT assay showed no significant cytotoxicity in cells incubated with GCA (10 and 20 μM) or GCDCA (10 and 20 μM) for 6, 12 and 24 h compared with the control group (P > 0.05) (Fig. 3a, b).
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
395
Z. Yan et al.
Figure 4 Abundance of mRNA expression of OATP1B3 in SWAN cells in blank group, negative RNAi group (NC-RNAi) and RNAi group (OATP1B3-RNAi). Values are expressed as mean ± standard deviation (n = 3). *P < 0.05 vs negative RNAi group.
compared to that in the negative RNAi group (Fig. 4). No significant differences in mRNA levels were observed between the negative RNAi group and the blank group (P > 0.05).
Figure 3 (a) Cell viability rate after treatment with glycocholic acid (GCA) for different times. Values are means ± standard deviation (SD), n = 4, P < 0.05 com, CGA10; , CGA20. pared with the control. (b) Cell viability rate after treatment with glycochenodeoxycholic acid (GCDCA) for different times. Values are means ± SD, n = 4, P < 0.05 compared with the control. Experiments were repeated 3 times , GCDCA10; , GCDCA20. with similar results.
GCA and GCDCA were used at a concentration of 10 μM for transport studies.
Efficiency of RNA interference mRNA expression of OATP1B3 The mRNA levels of OATP1B3 were significantly downregulated in the RNAi group compared to those in the negative RNAi group and the blank group (P < 0.05), with a 94.42% decrease in the RNAi group
396
Protein expression of OATP1B3 The protein levels of OATP1B3 were significantly downregulated in the RNAi group compared to those in the negative RNAi group and the blank group (P < 0.05), with a 49.51% decrease in the experimental group compared to that in the negative RNAi group (Fig. 5). No significant differences in OATP1B3 protein levels were observed between the negative RNAi group and the blank group (P > 0.05). Transendothelial electrical impedance of SWAN monolayer cells Normal cells and RNAi cells were plated in 12-well Transwell plates and incubated for 0, 4, 8 and 12 h, and 1–8 days. The growth conditions of cells were observed using an inverted microscope (Fig. 6a). The transendothelial electrical resistance was monitored at each time-point (Table 3, Fig. 6b), and the growth of cells appeared to reach a plateau at 12 h in the normal and RNAi groups. The TEER values at 0, 4 and 8 h were significantly different from those at 12 h to 8 days (P < 0.05). The TEER values between 12 h and 1–8 days showed no significant differences (P > 0.05). The TEER values at each time-point were not different between the normal and RNAi groups (P > 0.05). The addition of GCA or GCDCA did not affect the
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
Transmembrane transfer of bile acids
Figure 5 Abundance of protein expression of OATP1B3 in SWAN cells in blank group, negative RNAi group (NC-RNAi) and RNAi group (OATP1B3-RNAi). Values are expressed as mean ± standard deviation (n = 3). *P < 0.05 vs negative RNAi group.
TEER value. We selected the wells with a TEER value ≥ 31.90 ± 1.47 Ω/cm2 in the normal group and a TEER value ≥ 30.24 ± 0.97 Ω/cm2 in the RNAi group as monolayer cell models for transport studies.
GCA and GCDCA transport analysis GCA and GCDCA at a final concentration of 10 μM were added to the medium in the upper compartment without FCS. After incubation at 37°C, with 5% CO2 for 0, 20, 40, 60, 80, 100 and 120 min, samples in the upper and lower compartments were collected and analyzed using HPLC (Tables 4 and 5). Transport curves were drawn according to the concentration of GCA and GCDCA in the upper compartment samples (Fig. 7a, b). The bile acid transport curves were almost identical between the normal group and the negative RNAi group, whereas those of the RNAi group were significantly different from those of the normal group and the negative RNAi group (P < 0.05). In these two groups, the concentration of GCA and GCDCA in the upper compartment was significantly lower than that of the RNAi group.
Figure 6 (a) Growth condition of SWAN cells on the polyester membrane of 12-well transwell plates observed under inverted microscope (×100). (b) The transendothelial electrical resistance (TEER) value of normal SWAN monolayer cells model and RNAi monolayer cells model at different times. The growth of cells appeared to reach a plateau at the 12-h point. Values are expressed as mean ± standard deviation , normal group; , RNAi group. (n = 3).
Discussion To date, several studies have investigated the categories, function, and regulatory metabolism of bile acid transporters in the liver; however, little is known about their characteristics in the placenta. Studies have shown that OATP,4,19–21 NTCP,22 BSEP,23 MRP,24–30 MDR, FIC1,31 and TGR5(Gpbar-1)32 participate in bile acid transport in the human liver. OATP are Na+ and ATPindependent transporters.33,34 In the human placenta, the presence of OATP, MDR3, FIC1, BSEP,35 BCRP,14 and TGR5 (Gpbar-1)32 was demonstrated but not that of NTCP.35 High expression of OATP2B1, OATP1B3, BCRP, and FIC1 was detected in trophoblasts isolated from human term placentas, whereas the expression of
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
397
Z. Yan et al.
Table 3 TEER values of SWAN monolayer cells tested at different times Time
Normal group
RNAi group
4h 8h 12 h 1 day 2 days 3 days 4 days 5 days 6 days 7 days 8 days
14 ± 0 23.15 ± 1.80 31.92 ± 1.94 31.73 ± 2.26 31.73 ± 1.80 32.11 ± 1.62 32.30 ± 1.80 32.30 ± 1.71 32.11 ± 1.41 31.73 ± 1.29 31.17 ± 1.41
12.88 ± 1.12 21.09 ± 0.32 30.24 ± 0.97 32.48 ± 1.12 30.99 ± 1.17 31.36 ± 0.97 31.73 ± 1.17 31.36 ± 0.00 31.55 ± 0.32 30.80 ± 0.56 32.48 ± 1.12
TEER value was obtained at 4, 8, 12 h, 1–8 days after SWAN cells were plated in 12-well transwell plates. Results are expressed as mean ± standard deviation (n = 3). TEER, transendothelial electrical resistance.
OATP1A2 and MDR3 is downregulated, and OATP1B1 is not detectable.14 The expression of OATP1B3 is higher than that of OATP1A2 and OATP1B1 both in the human liver and placenta.15 In our research, we chose OATP1B3 as the study objective because it is highly expressed in the human placenta. CA, GCA, GUDCA, TCA, TCDCA, TDCA, and TUDCA have been shown to be the substrates of OATP1B3 in the human liver.19,36,37 In the present study, we indirectly found that OATP1B3 is involved in the transport of GCA and GCDCA, and we showed for the first time that GCDCA is a substrate of OATP1B3. We compared the RNAi group with the negative RNAi group and showed that GCA and GCDCA transport was significantly decreased in the RNAi group compared to that in the negative RNAi group. However, a certain amount of GCA and GCDCA was transported in the RNAi group. It is possible that a small amount
Table 4 Concentration of GCA in the samples collected at different times in the upper compartment (μM) Time (min)
Blank
Normal
NC-RNAi
OATP1B3RNAi
0 20 40 60 80 100 120
9.88 ± 0.26 9.48 ± 0.62 9.92 ± 0.11 9.77 ± 0.47 9.60 ± 0.79 9.61 ± 0.41 9.54 ± 0.80
9.62 ± 0.32 5.24 ± 0.41 3.95 ± 0.73 8.50 ± 0.43 8.60 ± 0.39 8.76 ± 0.46 8.84 ± 0.69
9.41 ± 0.34 6.15 ± 0.64 5.15 ± 0.82 7.22 ± 0.43 8.86 ± 0.16 8.40 ± 0.39 9.26 ± 0.32
9.42 ± 0.38 7.80 ± 0.69 9.73 ± 1.28 9.69 ± 0.86 9.31 ± 0.18 9.29 ± 0.06 9.64 ± 0.12
GCA (10 μM) added to the upper compartment for 0, 20, 40, 60, 80, 100 and 120 min were collected for assay. There were four groups: blank group without cells, normal group, negative samples control RNAi group, OATP1B3 RNAi group. The results are expressed as mean ± standard deviation (n = 3). GCA, glycocholic acid.
Table 5 Concentration of GCDCA in the samples collected at different times in the upper compartment (μM) Time (min)
Blank
Normal
NC-RNAi
OATP1B3RNAi
0 20 40 60 80 100 120
8.76 ± 0.40 8.73 ± 0.59 8.76 ± 0.70 8.64 ± 0.30 9.13 ± 0.60 8.60 ± 0.75 8.83 ± 0.53
9.58 ± 0.28 7.56 ± 0.18 4.88 ± 0.80 7.35 ± 0.16 7.34 ± 0.35 7.47 ± 0.16 7.42 ± 0.33
9.39 ± 0.06 6.17 ± 0.38 5.20 ± 0.09 7.04 ± 0.09 7.13 ± 0.43 8.20 ± 0.48 7.93 ± 0.18
9.38 ± 0.21 8.71 ± 0.13 8.93 ± 0.21 8.83 ± 0.58 8.88 ± 0.49 8.62 ± 0.41 8.69 ± 0.12
After GCDCA was added to the upper compartment for 0 min, 20 min, 40 min, 60 min, 80 min, 100 min and 120 min, samples were collected for assay. There were four groups: blank group without cell, normal group, negative control RNAi group and OATP1B3 RNAi group. The results are expressed as mean ± standard deviation (n = 3). GCDCA, glycochenodeoxycholic acid.
398
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
Transmembrane transfer of bile acids
Figure 7 (a) Transport curves of glycocholic acid (GCA) according to the concentration of GCA in the samples in the upper compartment obtained at different times. The results are expressed as mean ± standard deviation (SD) (n = 3). (b) The transport curves of glycochenodeoxycholic acid (GCDCA) according to the concentration of GCDCA in the samples in the upper compartment obtained at different times. The results , blank (without are expressed as mean ± SD (n = 3). , normal; , NC-RNAi; , OATP1B3-RNAi. cell);
GCA/GCDCA can diffuse freely through the membrane, although it did not affect the final results. Our results indicated that OATP1B3 may play an important role in the transport of GCA and GCDCA in the human placenta. In the peripheral blood of pregnant women with ICP, TCA and GCA are the most abundant bile acids, followed by TCDCA, GCDCA, TDCA, GDCA, TUDCA and GUDCA, with the least abundant being TLCA and GLCA. Compared with normal pregnant women, CA, TCA, TCDCA, TLCA, TUDCA, GCA and GCDCA are increased, whereas CDCA, DCA, LCA, UDCA, GLCA and GUDCA show no significant differences.38 In our previous study, we demonstrated that the expression
of OATP1A2 and OATP1B3 is downregulated in ICP placentas compared with the normal placenta.39 It was reported that OATP may have a bidirectional transport function.34,40 Based on these findings, we speculated that bile acids, such as GCA and GCDCA, may be significantly increased in the serum of pregnant women with ICP because of the bidirectional transport function of OATP1B3, which implies that high concentrations of GCA and GCDCA could be transported towards the fetus. Downregulation of OATP1B3 expression in ICP placentas may reduce the transport of GCA and GCDCA in the placenta; this could decrease the concentration of bile acids transported from the maternal serum to the fetus. On the other hand, downregulation of OATP1B3 expression and an increase in the concentration of bile acids in the maternal blood may impair the transport of GCA and GCDCA in the fetal blood to the maternal blood for metabolism and excretion. This may cause the accumulation of bile acids in the fetal blood, and the cytotoxicity of the accumulated bile acids could increase the risk to the fetus. We used lentiviral vector-mediated RNA interference technology in our research to knock down OATP1B3 expression in an efficient, specific and stable manner. This vector is the preferred tool for RNAi experiments, and it is one of the principal tools for investigation involving gene therapy and vector research in transgenic animals.41 We successfully selected a stably transfected cell line with high interference efficiency using puromycin and gene expression level detection. In addition, we used human trophoblasts to establish a monolayer cell model in vitro to study the transport of substrates. In conclusion, GCA and GCDCA at concentrations below 20 μM are not cytotoxic against human trophoblasts. OATP1B3 expression in a trophoblast cell line was confirmed by its ability to transport the bile acids GCA and GCDCA.
Acknowledgment This study was financially supported by ZJNSF (No Y2100411).
Disclosure There is no financial interest with any companies in this manuscript.
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
399
Z. Yan et al.
References 1. Saleh MM, Abdo KR. Intrahepatic cholestasis of pregnancy: Review of the literature and evaluation of current evidence. J Womens Health 2007; 16: 833–841. 2. Ostrow JD. In vitro studies of bile salt toxicity. Hepatology 1994; 19: 1538–1539. 3. Hagenbuch B, Gui C. Xenobiotic transporters of the human organic anion transporting polypeptides (OATP) family. Xenobiotica 2008; 38: 778–801. 4. Kullak-Ublick GA, Hagenbuch B, Stieger B et al. Molecular and functional characterization of an organic anion transporting polypeptide cloned from human liver. Gastroenterology 1995; 109: 1274–1282. 5. Lee W, Glaeser H, Smith LH et al. Polymorphisms in human organic anion-transporting polypeptide 1A2 (OATP1A2): Implications for altered drug disposition and central nervous system drug entry. J Biol Chem 2005; 280: 9610– 9617. 6. Glaeser H, Bailey DG, Dresser GK et al. Intestinal drug transporter expression and the impact of grapefruit juice in humans. Clin Pharmacol Ther 2007; 81: 362–370. 7. Hagenbuch B. Cellular entry of thyroid hormones by organic anion transporting polypeptides. Best Pract Res Clin Endocrinol Metab 2007; 21: 209–221. 8. Huber RD, Gao B, Sidler Pfandler MA et al. Characterization of two splice variants of human organic anion transporting polypeptide 3A1 isolated from human brain. Am J Physiol Cell Physiol 2007; 292: C795–C806. 9. Adachi H, Suzuki T, Abe M et al. Molecular characterization of human and rat organic anion transporter OATP-D. Am J Physiol Renal Physiol 2003; 285: 1188–1197. 10. Sato K, Sugawara J, Sato T et al. Expression of organic anion transporting polypeptide E (OATP-E) in human placenta. Placenta 2003; 24: 144–148. 11. Tamai I, Nezu J, Uchino H et al. Molecular identification and characterization of novel members of the human organic anion transporter (OATP) family. Biochem Biophys Res Commun 2000; 273: 251–260. 12. St-Pierre MV, Kullak-Ublick GA, Hagenbuch B, Meier PJ. Identification of bile salt transporters in rat and human placenta. J Hepatol (1999) 30: 141–141 (Abstract). 13. Marin JJ, Macias RI, Vallejo M et al. The influence of ursodeoxycholic acid and maternal cholestasis on the bile acid transport across the placenta. In: Leuschner U, Berg PA, Holtmeier J (eds). Bile Acids and Pregnancy. Frankfurt: Kluwer, 2003; 46–52. 14. Serrano MA, Macias RI, Briz O et al. Expression in human trophoblast and choriocarcinoma cell lines, BeWo, Jeg-3, and Jar of genes involved in the hepatobiliary-like excretory function of the placenta. Placenta 2007; 28: 107– 117. 15. Briz O, Serrano MA, Maclas RI, Gonzalez-Gallego J, Marin JJ. Role of organic anion-transporting polypeptides, OATP-A, OATP-C and OATP-8, in the human placenta-maternal liver tandem excretory pathway for foetal bilirubin. Biochem J 2003; 371: 897–905. 16. Straszewski-Chavez SL, Abrahams VM, Alvero AB et al. The isolation and characterization of a novel telomerase immortalized first trimester trophoblast cell line, Swan 71. Placenta 2009; 30: 939–948.
400
17. Livak KJ, Schmittgen TD. Analysis of relative genes expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001; 25: 402–408. 18. Schmittgen TD, Livak KJ. Analyzing real-time PCR data by comparative CT method. Nat Protoc 2008; 3: 1101– 1108. 19. Kullak-Ublick GA, Ismair MG, Stieger B et al. Organic aniontransporting polypeptide B (OATP-B) and its functional comparison with three OATPs of human liver. Gastroenterology 2001; 120: 525–533. 20. Konig J, Cui Y, Nies AT et al. Localization and genomic organization of a new hepatocellular organic anion transporting polypeptide. J Biol Chem 2000; 275: 23161–23168. 21. Abe T, Kakyo M, Tokui T et al. Identification of a novel gene family encoding human liver-specific organic anion transporter LST-1. J Biol Chem 1999; 274: 17159–17163. 22. Hagenbuch B, Meier PJ. Molecular cloning, chromosomal localization and functional characterization of a human liver Na+/bile acid cotransporter. J Clin Invest 1994; 93: 1326–1331. 23. Strautnieks SS, Bull LN, Knisely AS et al. A gene encoding a liver-specific ABC transporter is mutated in progressive familial intra-hepatic cholestasis. Nat Genet 1998; 20: 233–238. 24. Cui Y, Konig J, Buchholz JK et al. Drug resistance and ATPdependent conjugate transport mediated by the apical multidrug resistance protein, MRP2, permanently expressed in human and canine cells. Mol Pharmacol 1999; 55: 929–937. 25. Evers R, Kool M, van Deemter L et al. Drug export activity of the human canalicular multispecific organic anion transporter in polarized kidney MDCK cells expressing cMOAT (MRP2) cDNA. J Clin Invest 1998; 101: 1310–1319. 26. Paulusma CC, Kool M, Bosma PJ et al. A mutation in the human canalicular multispecific organic anion transporter gene causes the Dubin-Johnson syndrome. Hepatology 1997; 25: 1539–1542. 27. Konig J, Rost D, Cui Y et al. Characterization of the human multidrug resistance protein isoform MRP3 localized to the basolateral hepatocyte membrane. Hepatology 1999; 29: 1156– 1163. 28. Kool M, van der Linden M, de Haas M et al. MRP3, an organic anion transporter able to transport anti-cancer drugs. Proc Natl Acad Sci U S A 1999; 96: 6914–6919. 29. Zeng H, Liu G, Rea PA et al. Transport of amphipathic anions by human multidrug resistance protein 3. Cancer Res 2000; 60: 4779–4784. 30. Roelofsen H, Vos TA, Schippers IJ et al. Increased levels of the multidrug resistance protein in lateral membranes of proliferating hepatocyte-derived cells. Gastroenterology 1997; 112: 511–521. 31. Wagner M, Zollner G, Trauner M. New molecular insights into the mechanisms of cholestasis. J Hepatol 2009; 51: 565– 580. 32. Keitel V, Spomer L, Marin JJG et al. Effect of maternal cholestasis on TGR5 expression in human and rat placenta at term. Placenta 2013; 34: 810–816. 33. Arrese M, Trauner M. Molecular aspects of bile formation and cholestasis. Trends Mol Med 2003; 9: 558–564. 34. Mahagita C, Grassl SM, Piyachaturawat P, Ballatori N. Human organic anion transporter 1B1 and 1B3 function as bidirectional carriers and do not mediate GSH bile acid cotransport. Am J Physiol Gastrointest Liver Physiol 2007; 293: G271–G278.
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
Transmembrane transfer of bile acids
35. Patel P, Weerasekera N, Hitchins M et al. Semi quantitative expression analysis of MDR3, FIC1, BSEP, OATP-A, OATP-C, OATP-D, OATP-E and NTCP gene transcripts in 1st and 3rd trimester human placenta. Placenta 2003; 24: 39–44. 36. Briz O, Romero MR, Martinez-Becerra P et al. OATP8/1B3mediated cotransport of bile acids and glutathione: An export pathway for organic anions from hepatocytes? J Biol Chem 2006; 281: 30326–30335. 37. Maeda K, Kambara M, Tian Y et al. Uptake of ursodeoxycholate and its conjugates by human hepatocytes: Role of Na(+) – taurocholate cotransporting polypeptide (NTCP), organic anion transporting polypeptide (OATP) 1B1 (OATP-C), and oatp 1B3 (OATP8). Mol Pharm 2006; 3: 70–77.
38. Tribe RM, Dann AT, Kenyon AP et al. Longitudinal profiles of 15 serum bile acids in patients with intrahepatic cholestasis of pregnancy. Am J Gastroenterol 2010; 105: 585–595. 39. Wang H, Yan Z, Dong M et al. Alteration in placental expression of bile acids transporters OATP1A2, OATP1B1, OATP1B3 in intrahepatic cholestasis of pregnancy. Arch Gynecol Obstet 2012; 285: 1535–1540. 40. Macias RI, Marin JJ, Serrano MA. Excretion of biliary compounds during intrauterine life. World J Gastroenterol 2009; 15: 817–828. 41. Morris KV, Rossi JJ. Lentiviral-mediated delivery of siRNAs for antiviral therapy. Gene Ther 2006; 13: 553– 558.
© 2014 The Authors Journal of Obstetrics and Gynaecology Research © 2014 Japan Society of Obstetrics and Gynecology
401
Copyright of Journal of Obstetrics & Gynaecology Research is the property of WileyBlackwell and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
