PLANT SIGNALING & BEHAVIOR 2016, VOL. 11, NO. 5, e1180492 (3 pages) http://dx.doi.org/10.1080/15592324.2016.1180492
SHORT COMMUNICATION
Role of reactive oxygen species produced by NADPH oxidase in gibberellin biosynthesis during barley seed germination Kyohei Kaia, Shinsuke Kasaa, Masatsugu Sakamotoa, Nozomi Aokia, Gaku Watabea, Takashi Yuasab, Mari Iwaya-Inouea, and Yushi Ishibashia a Crop Science Laboratory, Faculty of Agriculture, Kyushu University, Hakozaki, Higashi-ku, Fukuoka, Japan; bDepartment of Agricultural and Environmental Sciences, Faculty of Agriculture, University of Miyazaki, Miyazaki, Japan
ABSTRACT
NADPH oxidase catalyzes the production of the superoxide anion (O2¡), a reactive oxygen species (ROS), and regulates the germination of barley (Hordeum vulgare L.). Diphenyleneiodonium (DPI) chloride, an NADPH oxidase inhibitor, delayed barley germination, and exogenous H2O2 (an ROS) partially rescued it. Six enzymes, ent-copalyl diphosphate synthase (CPS), ent-kaurene synthase (KS), ent-kaurene oxidase (KO), ent-kaurenoic acid oxidase (KAO), GA20-oxidase (GA20ox) and GA3-oxidase (GA3ox), catalyze the transformation of trans-geranylgeranyl diphosphate to active gibberellin, which promotes germination. Exogenous H2O2 promoted the expressions of HvKAO1 and HvGA3ox1 in barley embryos. These results suggest that ROS produced by NADPH oxidase are involved in gibberellin biosynthesis through the regulation of HvKAO1 and HvGA3ox1.
Introduction Reactive oxygen species (ROS) act as signal molecules in plants, regulating growth and development, programmed cell death, hormone signaling, and responses to biotic and abiotic stresses.1–4 ROS play a key role in seed dormancy, after-ripening, and germination.5,6 Excess accumulation of ROS in seed causes oxidative damage, which reduces germination ability, but insufficiency suppresses germination. The ideal range of ROS levels is described as the “oxidative window” for germination.7 Plasma membrane NADPH oxidase is a critical enzyme involved in ROS generation. We revealed that the H2O2 produced by NADPH oxidase regulates germination of barley through the regulation of gibberellin (GA) and abscisic acid contents.8,9 Here, we focused on the relationship between ROS and GA biosynthesis enzymes. Six enzymes catalyze GA biosynthesis from trans-geranylgeranyl diphosphate: ent-copalyl diphosphate synthase (CPS), ent-kaurene synthase (KS), ent-kaurene oxidase (KO), ent-kaurenoic acid oxidase (KAO), GA20-oxidase, (GA20ox) and GA3-oxidase (GA3ox).10,11 To determine which of these are regulated by NADPH oxidase-derived ROS, we investigated their response to the ROS by using quantitative RT-PCR analysis.
ARTICLE HISTORY
Received 11 March 2016 Revised 12 April 2016 Accepted 13 April 2016 KEYWORDS
Gibberellin; NADPH oxidase; reactive oxygen species; seed germination
seeds treated with 1 mM DPI C 100 mM H2O2, an ROS, reached 25% after 18 h and 75% within 5 d (Fig. 1). These results confirm that ROS produced by NADPH oxidase promotes barley seed germination.8 GA, a plant hormone, releases seed dormancy and promotes germination.12 To study the relationship between ROS and GA, we examined the expression of GA biosynthesis genes in barley embryos by quantitative RT-PCR. We extracted total RNAs from embryos after 18-h imbibition, by which time germination rates differed significantly among treatments (P < 0.01; Fig. 1). Among the genes encoding the
Results and discussion The germination rate of barley seeds soaked in distilled water reached 47% after 18 h and 96% within 5 d (Fig. 1). To reveal the effect of ROS, we treated some seeds with diphenyleneiodonium (DPI) chloride, an NADPH oxidase inhibitor. The germination rate of seeds treated with 1 mM DPI reached 14% after 18 h and 56% within 5 d. That of other CONTACT Yushi Ishibashi © 2016 Taylor & Francis Group, LLC
[email protected]
Figure 1. Germination rates of barley seeds treated with distilled water (control), 1 mM diphenyleneiodonium (DPI), or 1 mM DPI C 100 mM H2O2. Values labeled with the same letter do not differ significantly (P < 0.01, Tukey’s test). Values are means § SD of 5 replications.
e1180492-2
K. KAI ET AL.
Figure 2. Expression of gibberellin synthesis genes in barley seeds treated with distilled water (control D 1.0), 1 mM diphenyleneiodonium (DPI), or 1 mM DPI C 100 mM H2O2 for 18 h. Values labeled with the same letter do not differ significantly (P < 0.05, Tukey’s test). Values are means § SD of 4 replications.
6 enzymes that catalyze GA biosynthesis, the expressions of HvKAO1 and HvGA3ox1 in embryos treated with 1 mM DPI C 100 mM H2O2 was significantly higher than that in embryos treated with 1 mM DPI alone, and the transcript levels recovered to almost the same level as in the control (Fig. 2). These results suggest that HvKAO1 and HvGA3ox1 expressions are upregulated by ROS. The expression of HvKO1 was increased by DPI treatment and decreased by exogenous H2O2 treatment, the exact opposite expression
profile to that of HvKAO1 and HvGA3ox1 (Fig. 2). In addition, it is interesting that HvKO1 expression increased by DPI treatment and decreased by exogenous H2O2 treatment, thus the expression profile of HvKO1 was precisely opposite as compared to HvKAO1 expression. In tobacco, the regulation of KO transcription is the target of GA negative feedback, and thus KO contributes to GA homeostasis.13 In barley, therefore, these results suggest that GA biosynthesis in seed is reduced by DPI treatment, supporting the notion
Figure 3. Growth of seedlings after germination treated with (A) distilled water (control), (B) 1 mM diphenyleneiodonium (DPI), or (C) 1 mM DPI C 100 mM H2O2 for 7 d. Scale bars are 10 mm. (D) Dry weight. (E) Shoot and root lengths. Values labeled with the same letter do not differ significantly (P < 0.01, Tukey’s test). Values are means § SD of 5 replications.
PLANT SIGNALING & BEHAVIOR
e1180492-3
Table 1. Nucleotide sequences of primers used for qantitative RT-PCR. Gene HvCPS1 HvKS1 HvKO1 HvKAO1 HvGA20ox1 HvGA3ox1 HvActin
Accession number
Forward primer (50 –30 )
Reverse primer (50 –30 )
AY551435 AY551436 AY551434 AY326277 AY551428 AY551430 AY145451
gaccgtattgagcattgtcagaag catgcaaggagctgttctggaaga cagctcaccagctacaagctagac ggatgatgatgatgaaaacggaga gctgcagtgcagggagtgagaaat tgactgacatctcctcatagatca gccgtgctttccctctatg
ggaccaaacaaccaatccaacttg ggatcaaaggttcactgccgcttc aaataaccaaggacaggcgaactc cttgggcgccaatactattgatat gcaaatcttgccatccatccatgc gataacaggtaactgaagcatgca gcttctccttgatgtccctta
that ROS activates GA biosynthesis in imbibed seed. Thus, ROS produced by NADPH oxidase promote GA biosynthesis in barley through promotion of HvKAO1 and HvGA3ox1 genes transcription, thereby accelerating germination. The growth of root hair in Arabidopsis thaliana are regulated by elevation of the concentration of cytoplasmic Ca2C and the localized production of ROS by NADPH oxidase.14–17 The production of O2¡ has been detected in the expansion zone of maize leaf blades, where DPI inhibited growth.18 In our results, the growth of seedlings after germination treated with 1 mM DPI did not recover in the presence of 100 mM H2O2 (Fig. 3). These results suggest that ROS produced by NADPH oxidase have different roles in seed germination and seedling growth.
Materials and methods Hordeum vulgare L. ‘Himalaya’ grown at Kyushu University was harvested on 5 June 2010. The grains were stored dry at 4 C until the experiment began. According to Ishibashi et al.,8 20 seeds were placed on filter paper in a 9-cm Petri dish. Each dish received 6 mL of distilled water, 1 mM diphenyleneiodonium chloride (DPI, an NADPH oxidase inhibitor), and 1 mM DPI C 100 mM H2O2. The dishes were incubated in darkness at 22 C, and germinating seeds (with the radicle protruding through the seed coat) were counted daily for 5 d. Total RNA was extracted from germinated embryos at 18 h by using the SDS/phenol/LiCl method. cDNA was synthesized and amplified as previously9 with the primer sequences shown in Table 1.
Disclosure of potential conflicts of interest No potential conflicts of interest were disclosed.
Funding This work was supported by JSPS KAKENHI Grant Number 15K14639.
References 1. Gapper C, Dolan L. Control of plant development by reactive oxygen species. Plant Physiol 2006; 141:341-5; PMID:16760485; http://dx.doi. org/10.1104/pp.106.079079 2. Kwak J, Nguyen V, Schroeder J. The role of reactive oxygen species in hormonal responses. Plant Physiol 2006; 141:323-9; PMID:16760482; http:// dx.doi.org/10.1104/pp.106.079004 3. Breusegem F, Bailey-Serres J, Mittler R. Unraveling the tapestry of networks involving reactive oxygen species in plants. Plant Physiol 2008; 147:978-84; PMID:18612075; http://dx.doi.org/10.1104/pp.108.122325
4. Aoki N, Ishibashi Y, Kai K, Tomokiyo R, Yuasa T, Iwaya-Inoue M. Programmed cell death in barley aleurone cells is not directly stimulated by reactive oxygen species produced in response to gibberellin. J Plant Physiol 2014; 171:615-8; PMID:24709153; http://dx.doi.org/ 10.1016/j.jplph.2014.01.005 5. Oracz K, El-Maarouf-Bouteau H, Farrant J, Cooper K, Beighazi M, Job C, Job D, Corbineau F, Bailly C. ROS production and protein oxidation as a novel mechanism for seed dormancy alleviation. Plant J 2007; 50:452-65; PMID:17376157; http://dx.doi.org/10.1111/j.1365313X.2007.03063.x 6. El-Maarouf-Bouteau H, Bailly C. Oxidative signaling in seed germination and dormancy. Plant Signal Behav 2008; 3:175-82; PMID:19513212; http://dx.doi.org/10.4161/psb.3.3.5539 7. Bailly C, El-Maarouf-Bouteau H, Corbineau F. From intracellular signaling networks to cell death: the dual role of reactive oxygen species in seed physiology. C R Biol 2008; 331:806-14; PMID:18926495; http://dx.doi.org/10.1016/j.crvi.2008.07.022 8. Ishibashi Y, Tawaratsumida T, Zheng S, Yuasa T, Iwaya-Inoue M. NADPH oxidases act as key enzyme on germination and seedling growth in barley (Hordeum vulgare L.). Plant Prod Sci 2010; 13:45-52; http://dx.doi.org/10.1626/pps.13.45 9. Ishibashi Y, Kasa S, Sakamoto M, Aoki N, Kai K, Yuasa T, Hanada A, Yamaguchi S, Iwaya-Inoue M. A role for reactive oxygen species produced by NADPH oxidases in the embryo and aleurone cells in barley seed germination. PLoS One 2015; 10:e0143173; PMID:26579718; http://dx.doi. org/10.1371/journal.pone.0143173 10. Hedden P, Kamiya Y. Gibberellin biosynthesis: Enzymes, genes and their regulation. Annu Rev Plant Physiol Plant Mol Biol 1997; 48:431-60; PMID:15012270; http://dx.doi.org/10.1146/ annurev.arplant.48.1.431 11. Yamaguchi S, Kamiya Y. Gibberellin biosynthesis: its regulation by endogenous and environmental signals. Plant Cell Physiol 2000; 41:251-7; PMID:10805587; http://dx.doi.org/10.1093/pcp/ 41.3.251 12. Bewley JD, Black M. Seeds; Physiology of development and germination. 1994; New York, NY, USA: Plenum Press. 13. Fukazawa J, Nakata M, Ito T, Yamaguchi S, Takahashi Y. The transcription factor RSG regulates negative feedback of NtGA20ox1 encoding GA 20-oxidase. Plant J 2010; 62:1035-45; PMID:20345601; http://dx.doi. org/10.1111/j.1365-313X.2010.04215.x 14. Wymer CL, Bibikova TN, Gilroy S. Cytoplasmic free calcium distribution during the development of root hairs of Arabidopsis thaliana. Plant J 1997; 12:427-39; PMID:9301093; http://dx.doi.org/10.1046/ j.1365-313X.1997.12020427.x 15. Hepler PK, Vidali L, Cheung AY. Polarized cell growth in higher plants. Annu Rev Plant Physiol Mol Biol 2001; 17:159-87; PMID:11687487; http://dx.doi.org/10.1146/annurev.cellbio.17.1.159 16. Foreman J, Demidchik V, Bothwell JH, Mylona P, Miedema H, Torres MA, Linstead P, Costa S, Brownlee C, Jones JD, et al. Reactive oxygen species produced by NADPH oxidase regulate plant cell growth. Nature 2003; 422:442-6; PMID:12660786; http://dx.doi.org/10.1038/ nature01485 17. Carol RJ, Dolan L. The role of reactive oxygen species in cell growth: lessons from root hairs. J Exp Bot 2006; 57:1829-34; PMID:16720604; http:// dx.doi.org/10.1093/jxb/erj201 18. Rodrıguez A, Grunberg K, Taleisnik E. Reactive oxygen species in the elongation zone of maize leaves are necessary for leaf extension. Plant Physiol 2002; 129:1627-32; http://dx.doi.org/10.1104/pp.001222
SHORT COMMUNICATION
Role of reactive oxygen species produced by NADPH oxidase in gibberellin biosynthesis during barley seed germination Kyohei Kaia, Shinsuke Kasaa, Masatsugu Sakamotoa, Nozomi Aokia, Gaku Watabea, Takashi Yuasab, Mari Iwaya-Inouea, and Yushi Ishibashia a Crop Science Laboratory, Faculty of Agriculture, Kyushu University, Hakozaki, Higashi-ku, Fukuoka, Japan; bDepartment of Agricultural and Environmental Sciences, Faculty of Agriculture, University of Miyazaki, Miyazaki, Japan
ABSTRACT
NADPH oxidase catalyzes the production of the superoxide anion (O2¡), a reactive oxygen species (ROS), and regulates the germination of barley (Hordeum vulgare L.). Diphenyleneiodonium (DPI) chloride, an NADPH oxidase inhibitor, delayed barley germination, and exogenous H2O2 (an ROS) partially rescued it. Six enzymes, ent-copalyl diphosphate synthase (CPS), ent-kaurene synthase (KS), ent-kaurene oxidase (KO), ent-kaurenoic acid oxidase (KAO), GA20-oxidase (GA20ox) and GA3-oxidase (GA3ox), catalyze the transformation of trans-geranylgeranyl diphosphate to active gibberellin, which promotes germination. Exogenous H2O2 promoted the expressions of HvKAO1 and HvGA3ox1 in barley embryos. These results suggest that ROS produced by NADPH oxidase are involved in gibberellin biosynthesis through the regulation of HvKAO1 and HvGA3ox1.
Introduction Reactive oxygen species (ROS) act as signal molecules in plants, regulating growth and development, programmed cell death, hormone signaling, and responses to biotic and abiotic stresses.1–4 ROS play a key role in seed dormancy, after-ripening, and germination.5,6 Excess accumulation of ROS in seed causes oxidative damage, which reduces germination ability, but insufficiency suppresses germination. The ideal range of ROS levels is described as the “oxidative window” for germination.7 Plasma membrane NADPH oxidase is a critical enzyme involved in ROS generation. We revealed that the H2O2 produced by NADPH oxidase regulates germination of barley through the regulation of gibberellin (GA) and abscisic acid contents.8,9 Here, we focused on the relationship between ROS and GA biosynthesis enzymes. Six enzymes catalyze GA biosynthesis from trans-geranylgeranyl diphosphate: ent-copalyl diphosphate synthase (CPS), ent-kaurene synthase (KS), ent-kaurene oxidase (KO), ent-kaurenoic acid oxidase (KAO), GA20-oxidase, (GA20ox) and GA3-oxidase (GA3ox).10,11 To determine which of these are regulated by NADPH oxidase-derived ROS, we investigated their response to the ROS by using quantitative RT-PCR analysis.
ARTICLE HISTORY
Received 11 March 2016 Revised 12 April 2016 Accepted 13 April 2016 KEYWORDS
Gibberellin; NADPH oxidase; reactive oxygen species; seed germination
seeds treated with 1 mM DPI C 100 mM H2O2, an ROS, reached 25% after 18 h and 75% within 5 d (Fig. 1). These results confirm that ROS produced by NADPH oxidase promotes barley seed germination.8 GA, a plant hormone, releases seed dormancy and promotes germination.12 To study the relationship between ROS and GA, we examined the expression of GA biosynthesis genes in barley embryos by quantitative RT-PCR. We extracted total RNAs from embryos after 18-h imbibition, by which time germination rates differed significantly among treatments (P < 0.01; Fig. 1). Among the genes encoding the
Results and discussion The germination rate of barley seeds soaked in distilled water reached 47% after 18 h and 96% within 5 d (Fig. 1). To reveal the effect of ROS, we treated some seeds with diphenyleneiodonium (DPI) chloride, an NADPH oxidase inhibitor. The germination rate of seeds treated with 1 mM DPI reached 14% after 18 h and 56% within 5 d. That of other CONTACT Yushi Ishibashi © 2016 Taylor & Francis Group, LLC
[email protected]
Figure 1. Germination rates of barley seeds treated with distilled water (control), 1 mM diphenyleneiodonium (DPI), or 1 mM DPI C 100 mM H2O2. Values labeled with the same letter do not differ significantly (P < 0.01, Tukey’s test). Values are means § SD of 5 replications.
e1180492-2
K. KAI ET AL.
Figure 2. Expression of gibberellin synthesis genes in barley seeds treated with distilled water (control D 1.0), 1 mM diphenyleneiodonium (DPI), or 1 mM DPI C 100 mM H2O2 for 18 h. Values labeled with the same letter do not differ significantly (P < 0.05, Tukey’s test). Values are means § SD of 4 replications.
6 enzymes that catalyze GA biosynthesis, the expressions of HvKAO1 and HvGA3ox1 in embryos treated with 1 mM DPI C 100 mM H2O2 was significantly higher than that in embryos treated with 1 mM DPI alone, and the transcript levels recovered to almost the same level as in the control (Fig. 2). These results suggest that HvKAO1 and HvGA3ox1 expressions are upregulated by ROS. The expression of HvKO1 was increased by DPI treatment and decreased by exogenous H2O2 treatment, the exact opposite expression
profile to that of HvKAO1 and HvGA3ox1 (Fig. 2). In addition, it is interesting that HvKO1 expression increased by DPI treatment and decreased by exogenous H2O2 treatment, thus the expression profile of HvKO1 was precisely opposite as compared to HvKAO1 expression. In tobacco, the regulation of KO transcription is the target of GA negative feedback, and thus KO contributes to GA homeostasis.13 In barley, therefore, these results suggest that GA biosynthesis in seed is reduced by DPI treatment, supporting the notion
Figure 3. Growth of seedlings after germination treated with (A) distilled water (control), (B) 1 mM diphenyleneiodonium (DPI), or (C) 1 mM DPI C 100 mM H2O2 for 7 d. Scale bars are 10 mm. (D) Dry weight. (E) Shoot and root lengths. Values labeled with the same letter do not differ significantly (P < 0.01, Tukey’s test). Values are means § SD of 5 replications.
PLANT SIGNALING & BEHAVIOR
e1180492-3
Table 1. Nucleotide sequences of primers used for qantitative RT-PCR. Gene HvCPS1 HvKS1 HvKO1 HvKAO1 HvGA20ox1 HvGA3ox1 HvActin
Accession number
Forward primer (50 –30 )
Reverse primer (50 –30 )
AY551435 AY551436 AY551434 AY326277 AY551428 AY551430 AY145451
gaccgtattgagcattgtcagaag catgcaaggagctgttctggaaga cagctcaccagctacaagctagac ggatgatgatgatgaaaacggaga gctgcagtgcagggagtgagaaat tgactgacatctcctcatagatca gccgtgctttccctctatg
ggaccaaacaaccaatccaacttg ggatcaaaggttcactgccgcttc aaataaccaaggacaggcgaactc cttgggcgccaatactattgatat gcaaatcttgccatccatccatgc gataacaggtaactgaagcatgca gcttctccttgatgtccctta
that ROS activates GA biosynthesis in imbibed seed. Thus, ROS produced by NADPH oxidase promote GA biosynthesis in barley through promotion of HvKAO1 and HvGA3ox1 genes transcription, thereby accelerating germination. The growth of root hair in Arabidopsis thaliana are regulated by elevation of the concentration of cytoplasmic Ca2C and the localized production of ROS by NADPH oxidase.14–17 The production of O2¡ has been detected in the expansion zone of maize leaf blades, where DPI inhibited growth.18 In our results, the growth of seedlings after germination treated with 1 mM DPI did not recover in the presence of 100 mM H2O2 (Fig. 3). These results suggest that ROS produced by NADPH oxidase have different roles in seed germination and seedling growth.
Materials and methods Hordeum vulgare L. ‘Himalaya’ grown at Kyushu University was harvested on 5 June 2010. The grains were stored dry at 4 C until the experiment began. According to Ishibashi et al.,8 20 seeds were placed on filter paper in a 9-cm Petri dish. Each dish received 6 mL of distilled water, 1 mM diphenyleneiodonium chloride (DPI, an NADPH oxidase inhibitor), and 1 mM DPI C 100 mM H2O2. The dishes were incubated in darkness at 22 C, and germinating seeds (with the radicle protruding through the seed coat) were counted daily for 5 d. Total RNA was extracted from germinated embryos at 18 h by using the SDS/phenol/LiCl method. cDNA was synthesized and amplified as previously9 with the primer sequences shown in Table 1.
Disclosure of potential conflicts of interest No potential conflicts of interest were disclosed.
Funding This work was supported by JSPS KAKENHI Grant Number 15K14639.
References 1. Gapper C, Dolan L. Control of plant development by reactive oxygen species. Plant Physiol 2006; 141:341-5; PMID:16760485; http://dx.doi. org/10.1104/pp.106.079079 2. Kwak J, Nguyen V, Schroeder J. The role of reactive oxygen species in hormonal responses. Plant Physiol 2006; 141:323-9; PMID:16760482; http:// dx.doi.org/10.1104/pp.106.079004 3. Breusegem F, Bailey-Serres J, Mittler R. Unraveling the tapestry of networks involving reactive oxygen species in plants. Plant Physiol 2008; 147:978-84; PMID:18612075; http://dx.doi.org/10.1104/pp.108.122325
4. Aoki N, Ishibashi Y, Kai K, Tomokiyo R, Yuasa T, Iwaya-Inoue M. Programmed cell death in barley aleurone cells is not directly stimulated by reactive oxygen species produced in response to gibberellin. J Plant Physiol 2014; 171:615-8; PMID:24709153; http://dx.doi.org/ 10.1016/j.jplph.2014.01.005 5. Oracz K, El-Maarouf-Bouteau H, Farrant J, Cooper K, Beighazi M, Job C, Job D, Corbineau F, Bailly C. ROS production and protein oxidation as a novel mechanism for seed dormancy alleviation. Plant J 2007; 50:452-65; PMID:17376157; http://dx.doi.org/10.1111/j.1365313X.2007.03063.x 6. El-Maarouf-Bouteau H, Bailly C. Oxidative signaling in seed germination and dormancy. Plant Signal Behav 2008; 3:175-82; PMID:19513212; http://dx.doi.org/10.4161/psb.3.3.5539 7. Bailly C, El-Maarouf-Bouteau H, Corbineau F. From intracellular signaling networks to cell death: the dual role of reactive oxygen species in seed physiology. C R Biol 2008; 331:806-14; PMID:18926495; http://dx.doi.org/10.1016/j.crvi.2008.07.022 8. Ishibashi Y, Tawaratsumida T, Zheng S, Yuasa T, Iwaya-Inoue M. NADPH oxidases act as key enzyme on germination and seedling growth in barley (Hordeum vulgare L.). Plant Prod Sci 2010; 13:45-52; http://dx.doi.org/10.1626/pps.13.45 9. Ishibashi Y, Kasa S, Sakamoto M, Aoki N, Kai K, Yuasa T, Hanada A, Yamaguchi S, Iwaya-Inoue M. A role for reactive oxygen species produced by NADPH oxidases in the embryo and aleurone cells in barley seed germination. PLoS One 2015; 10:e0143173; PMID:26579718; http://dx.doi. org/10.1371/journal.pone.0143173 10. Hedden P, Kamiya Y. Gibberellin biosynthesis: Enzymes, genes and their regulation. Annu Rev Plant Physiol Plant Mol Biol 1997; 48:431-60; PMID:15012270; http://dx.doi.org/10.1146/ annurev.arplant.48.1.431 11. Yamaguchi S, Kamiya Y. Gibberellin biosynthesis: its regulation by endogenous and environmental signals. Plant Cell Physiol 2000; 41:251-7; PMID:10805587; http://dx.doi.org/10.1093/pcp/ 41.3.251 12. Bewley JD, Black M. Seeds; Physiology of development and germination. 1994; New York, NY, USA: Plenum Press. 13. Fukazawa J, Nakata M, Ito T, Yamaguchi S, Takahashi Y. The transcription factor RSG regulates negative feedback of NtGA20ox1 encoding GA 20-oxidase. Plant J 2010; 62:1035-45; PMID:20345601; http://dx.doi. org/10.1111/j.1365-313X.2010.04215.x 14. Wymer CL, Bibikova TN, Gilroy S. Cytoplasmic free calcium distribution during the development of root hairs of Arabidopsis thaliana. Plant J 1997; 12:427-39; PMID:9301093; http://dx.doi.org/10.1046/ j.1365-313X.1997.12020427.x 15. Hepler PK, Vidali L, Cheung AY. Polarized cell growth in higher plants. Annu Rev Plant Physiol Mol Biol 2001; 17:159-87; PMID:11687487; http://dx.doi.org/10.1146/annurev.cellbio.17.1.159 16. Foreman J, Demidchik V, Bothwell JH, Mylona P, Miedema H, Torres MA, Linstead P, Costa S, Brownlee C, Jones JD, et al. Reactive oxygen species produced by NADPH oxidase regulate plant cell growth. Nature 2003; 422:442-6; PMID:12660786; http://dx.doi.org/10.1038/ nature01485 17. Carol RJ, Dolan L. The role of reactive oxygen species in cell growth: lessons from root hairs. J Exp Bot 2006; 57:1829-34; PMID:16720604; http:// dx.doi.org/10.1093/jxb/erj201 18. Rodrıguez A, Grunberg K, Taleisnik E. Reactive oxygen species in the elongation zone of maize leaves are necessary for leaf extension. Plant Physiol 2002; 129:1627-32; http://dx.doi.org/10.1104/pp.001222
