FEMS Pathogens and Disease, 73, 2015, ftv006 doi: 10.1093/femspd/ftv006 Advance Access Publication Date: 21 January 2015 Research Article
RESEARCH ARTICLE
Role of uropathogenic Escherichia coli outer membrane protein T in pathogenesis of urinary tract infection Xiao Long He1,# , Qin Wang1,# , Liang Peng2 , Ya-Rong Qu1 , Santhosh Puthiyakunnon1 , Xiao-Lu Liu1 , Chang Ye Hui3 , Swapna Boddu1 , Hong Cao1,∗ and Sheng-He Huang1,4 1
Department of Microbiology, School of Public Health & Tropical Medicine, Southern Medical University, Guangzhou 510515, China, 2 Department of Clinical Laboratory, The Second Affiliated Hospital of Guangzhou Medical University, Guangzhou 510260 China, 3 Shenzhen Prevention and Treatment Center for Occupational Disease, Shenzhen, Guangdong 518001, China and 4 Children’s Hospital Los Angeles, University of Southern California, Los Angeles 90027, USA ∗ Corresponding author: Department of Microbiology, School of Public Health & Tropical Medicine, Southern Medical University, Guangzhou 510515, China. Tel: +86-020-6164-8723; Fax: +86-020-6164-8307; E-mail: [email protected] # Contributed equally to this work. One sentence summary: The article shown that OmpT plays a multifaceted role in pathogenesis of urinary tract infection, including increased bacterial adhesiveness/invasiveness, formation of IBCs and upregulated proinflammatory cytokines. Editor: Eric Oswald
ABSTRACT OmpT is one of the members of the outer membrane protein family that has been identified as a virulence factor in most of the uropathogenic Escherichia coli (UPEC). However, the exact role of OmpT in the urinary tract infections (UTIs) remains unclear. To determine the role of OmpT in the pathogenesis of UPEC, an isogenic deletion mutant of ompT (COTD) was constructed by the λ Red recombination. Human bladder epithelial cell line 5637(HBEC 5637) was used to evaluate the ability of bacterial adhesion/invasion. A murine model of UTI was established to study the formation of intracellular bacterial communities (IBCs) in the process of UTIs. The cytokines were also examined during the pathogenesis. The results showed that the COTD strain was deficient in bacterial adhesion and invasion as well as in IBC formation compare to the parent strain. ELISA quantification analysis of cytokines showed that the levels of TNF-α, IL-6 and IL-8 in the serum, bladder and kidney tissues of the mice infected with COTD were lower than that of the CFT073 group. In summary, these results suggest that OmpT plays a multifaceted role in pathogenesis of UTI, including increased bacterial adhesiveness/invasiveness, formation of IBCs and upregulated proinflammatory cytokines. Keywords: OmpT; UPEC; UTIs; human bladder epithelial cells; IBCs
INTRODUCTION Uropathogenic Escherichia coli (UPEC), the most common pathotype of extraintestinal pathogenic E. coli, is the major causative agent of urinary tract infection (UTI) (Stapleton and Stamm 1997;
Svanborg and Godaly 1997; Foxman and Brown 2003; Zhang and Foxman 2003) causing up to 90% of community-acquired infections and 50% of hospital-acquired infections (Ronald et al., 2001; Ronald 2003). The majority of urinary tract pathogens originates in the intestinal tract and ascends through the urethra up to
Received: 21 August 2014; Accepted: 9 January 2015 C FEMS 2015. All rights reserved. For permissions, please e-mail: [email protected].
1
2
FEMS Pathogens and Disease, 2015, Vol. 73, No. 3
the bladder. In 95% of UTI, in the initial site of infection is the urinary bladder (Schilling, Lorenz and Hultgren 2002; Shigemura et al., 2009). UPEC strains exhibit a number of virulence traits to survive and invade the urinary epithelium. One important way is through interaction with the host innate immune system. The urinary tract epithelial cells can secrete antimicrobial peptides and cytokines (IL-6 and IL-8) when UPEC invade and eventually can trigger the inflammatory cascade during the pathophysiological process of UTI (Song and Abraham 2008; Hilbert et al., 2012). UPEC could also implement long-term persistence in the bladder cells through development of intracellular bacterial communities (IBCs) to escape host defenses. The IBCs characterized as a protected niche of invaded UPEC (Reisner et al., 2003; Mysorekar and Hultgren 2006) can escape from innate host surveillance, antibiotic therapy and clearance by micturition (Mulvey, Schilling and Hultgren 2001; Wright, Seed and Hultgren 2005; Schwartz et al., 2011). Besides, epidemiological analysis and clinical studies have shown that almost all UPEC strains are type B2 (DebRoy et al., 2010). Different from the rectum source E. coli, UPEC could express O antigen and have many UTI-related virulence factors, such as fimH (type1 fimbriae), pap (P fimbriae), papG (adhesin), allele III, sfa/foc, sfaS (S fimbriae), hlyA (hemolysin), fyuA (yersiniabacillin), iha (iron-regulated adhesin), iron (siderophore) and ompA (outer membrane protein A)(Foxman et al., 1995; Marrs et al., 2002; Johnson et al., 2005a; Ejrnaes 2011). These virulence factors are involved in adhesion, invasion, bacterial resistance to host immune defense and metabolic pathways in the pathogenic process of UPEC. OmpT, an aspartyl protease found on the outer membrane of E. coli, is a member of the family of omptin proteases that are present in some Gram-negative bacteria, such as OmpT in E. coli, SopA in Shigella flexneri, PgtE in Salmonella enterica and Pla in Yersinia pestis (Kramer et al., 2000). The in vitro enzymatic experiments showed that OmpT can hydrolyze protamine in a short time to avoid being killed by protamine (Stumpe et al., 1998; Hui et al. 2010). About 90% of clinically isolated UPEC strains carry ompT gene that is shown to be one of the most commonly expressed UTIs virulence genes (Foxman et al., 1995; Johnson et al., 2003). The epidemiological analysis showed that ompT may be functionally associated with kpsMT, cnf1, sfa and prf, while ompT is not closely linked genetically to these virulence factors (Foxman et al., 1995), which contribute to the pathological damage and inflammatory response of the bladder and kidney. However, the role of OmpT in urinary tract pathogenesis has not been fully confirmed. In order to study the role of ompT in the pathogenesis of UTI induced by UPEC, we constructed an isogenic deletion mutant of ompT by the λ Red recombineering technology. Our data suggest that adhesion, invasion, IBCs formation and inflammation are attenuated in UTI caused by the UPEC strain-lacking ompT.
MATERIALS AND METHODS Bacterial strains, plasmids and reagents Escherichia coli strains CFT073 and DH5α were used in this study. All strains were grown in Luria Bertani (LB) medium at 37◦ C. A LacZ staining kit was purchased from Beyotime Institute of Biotechnology (Shanghai, China). Plasmids pKD46, pET28a and pSTV29 were used in this study. The human bladder epithelial cell line 5637 (HBEC 5637) was purchased from ATCC Bioresource Center (USA) and was used as the in vitro cell model of adhesion and invasion assays. All cell culture reagents were purchased from Thermo Scientific (Beijing, China). All other chemicals in this study were purchased from Sigma Chemical Company (St. Louis, MO, USA).
Construction of isogenic mutant of ompT in E. coli CFT073 To define the role of OmpT in the pathogenesis of UTI, an isogenic ompT deletion mutant of E. coli CFT073 (COTD) was constructed using the λ RED homologous recombination system as described by Lee et al. (2009) and Zhao et al. (2012). Briefly, the linear DNA fragment was amplified from pET28a by PCR with primers (ompT Kan F2 and ompT Kan R2) (Table 1), the expected size of the fragment (1602 bp) was confirmed by PCR. After transformation of the DNA fragment into E. coli CFT073/pKD46, positive colonies were selected on LB agar with kanamycin. The primers OmpT F2/OmpT R2 and OmpT F1/OmpT R1 were used (Table 1). The mutants with the expected size (2066 bp) were confirmed by PCR. The complementation strain of COTD (COTD/pST) with ompT gene was constructed by subcloning the complete coding region of ompT into a low copy number expression plasmid (pSTV29). At last, the mutant was confirmed by DNA sequencing. In order to appraise whether the mutant of ompT displays grown impairment, CFT073, COTD and COTD (pST) were inoculated in the identical conditions and their growth curve was made. Briefly, CFT073, COTD and COTD(pST) were inoculated in with LB broth; the growth curves were determined by measuring the optical density (OD) at 600 nm at different time points (data not shown).
The assay of proteolytic activities of CFT073, COTD and COTD(pST) Proteolytic activities of the E. coli strains were determined using protamine as a substrate. In order to perform the assay, 500 μl of the protamine solution (0.01 g ml−1 ) was poured into phial with the addition of a 20 clean disk (diameter 6 mm) in advance and stored at 4◦ C. CFT073, COTD and COTD(pST) in the exponential phase were plated into a petri dish respectively, and then fixed the disk into the petri dish and cultured at 37◦ C for 6 h. Each assay was repeated three times.
Table 1. Primers and sequences in ompT deletion. Primer OmpT OmpT OmpT OmpT OmpT OmpT
Sequence Kan F2 Kan R2 F2 R2 F1 R1
AGGTTAAATGCTTACAATATTAGGGGATATTGTTTGCTTTTACCGGTAACAGGTGGCACTTTTCGGGGAAATG CCTCATGCTATTATCGCTAATATGCATCTAAAGGCATGGCACTTGAATAGGTGCGCTCTCCTGTTCCGAC CGTTCAGGCTAGCTTCGTTC ATTGCGAGGCCTTATGTGTC ATACCTGCTCCATTTTTGCTGT AACCTGGACGGATGAAAGTAGA
He et al.
The susceptibility of E. coli strains to protamine was tested as described by Stumpe et al. (1998). Protamine was added at a concentration of 100 mg l−1 to a cell suspension at the exponential phase (A600 ∼ 0.5), then the cells were grown in LB medium at 37◦ C and the growth curves were determined by measuring the OD at 600 nm at different time points.
Adhesion and invasion assays Adherence and invasion assays were performed essentially as described by Elsinghorst (1994). Briefly, the HBEC 5637 confluent monolayers in 24-well plates (approximately 5 × 105 cells well−1 ) were incubated with bacteria (CFT073, COTD, COTD(pST)) at a multiplicity of infection of 100 for 2 h. The monolayers were washed five times with 0.1 mol l−1 sterile PBS and lysed by the addition of 150 μl 0.5% Triton X-100 in each well for 15 min at room temperature. Then 350 μl ddH2 O was added into each well at room temperature for 10 min. Adherent and intracellular bacteria were enumerated by plating 10-fold serial dilutions on LB agar plates. To determine invasion frequencies, after the initial 2 h incubation, the cells were washed three times with 0.1 mol l−1 sterile PBS and treated with gentamicin (final concentration was 200 μg ml−1 ) for 1 h to kill extracellular bacteria. Then the cells were washed three times with sterile PBS, lysed according to the above procedure and the intracellular bacteria were enumerated on LB agar plates. The effect of adherence and invasion of E. coli strains were expressed as relative adhesion and invasion (percentage of the total wild-type strain CFT073 adhered to or internalized by HBEC 5637 cells). Each assay was performed in triplicate wells and repeated five times.
Murine model of acute UTI In order to explore and characterize the role of OmpT in the invasion ability and IBCs formation of E. coli CFT073, COTD and COTD(pST) strains, a murine model of UTI was constructed (Hung, Dodson and Hultgren 2009). Briefly, 7-week-old female C57B/L6 mice susceptible to UPEC were used in our study and randomly divided into three groups. They were deeply anesthetized with an intraperitoneal injection of 0.6% pentobarbital sodium (m/w). An intravenous syringe was used as a urinary catheter inserted through the urethra into the bladder. About 50 μl bacteria suspension (about 1 × 108 CFU at ∼10 μl s−1 ) was injected into the bladder by pushing the syringe plunger in 40 s. After 12 h, bladders were immediately harvested aseptically and processed for IBC enumeration as described below. Animal studies were approved and performed in accordance with the Committee for Animal Studies at Southern Medical University.
Ex vivo IBC enumeration and gentamicin protection assay The IBCs were examined according to the procedure as previously described (Justice et al., 2006). The bladders were removed and stretched on pads by hobnails. The stretched bladders were subjected to lacZ staining according to the manufacturer’ instruction and photographed by light microscopy in whole mount for enumeration of spots representing IBCs. Experiments were repeated three times. For the gentamicin protection assay, mice were inoculated with ∼108 CFU of three strains respectively as described above. After 12 h infection, mice were sacrifficed and bladders were re-
3
moved in sterile PBS. Bladders were splayed and washed three times in 400 ml sterile PBS each time. Bladders were then incubated at 37◦ C for 60 min with 200 μg ml−1 gentamicin to kill the adherent extracellular bacteria. After this incubation, bladders were washed three times in 1 ml fresh sterile PBS. Bladders were homogenized in 1 ml PBS with 0.05% Triton X-100. Then serial diluted samples were plated to LB agar and incubated overnight at 37◦ C for colony enumeration. Experiments were repeated three times.
Cytokine determinations and histological analysis After 12 h of E. coli inoculation, animals were anesthetized and blood samples were collected by cardiac puncture. After perfusion with 20 ml PBS, the bladder and kidneys were cut, and the bladder tissues were cut into two halves. Each half of the tissue was put into a glass homogenizer for homogenizing. The blood samples, bladder and kidney tissue homogenates were centrifuged at 1000 g for 10 min. The supernatants were collected and used for ELISA determination of TNF-α, IL-6 and IL8 according to the manufacturer’s instruction (BD Biosciences, CA, USA). The other half of the bladder and kidney tissues were immersion-fixed overnight in 4% paraformaldehyde, and paraffin embedded, 5-μm thick sections were stained with hematoxylin and eosin for histological evaluation.
Mannose-sensitive hemagglutination assay MSHA were performed as described earlier (Gunther et al., 2002). Blood samples were collected in 1% (wt/vol) acid citrate dextrose from guinea pigs. The erythrocytes were washed four times in PBS and suspended in PBS to 3% (vol/vol) the same day as used. CFT073, COTD and COTD(pST) were passaged statically three times for 48 h each in Luria broth at 37◦ C and then harvested by centrifugation (5000 g, 3 min). Cell pellets were resuspended in PBS to a 109 CFU ml−1 and assayed for expression of type 1 fimbriae by hemagglutination. Bacterial suspensions were serially diluted 2-fold into V-bottom 96-well microtiter plates in duplicate. Equal volumes of 3% (vol/vol) guinea pig erythrocytes were mixed with bacterial suspensions. Mannose was added to a 50 mM final concentration to one row of the duplicated serial dilutions for each bacterial growth condition. Non-agglutinated guinea pig erythrocytes formed tight buttons of cells at the bottom of the plate well, whereas agglutinated erythrocytes formed a diffuse mat of cells across the bottom of the well. The titer was defined as the reciprocal of the highest dilution of bacteria that agglutinated erythrocytes.
Real-time reverse-transcription PCR FimH mRNA expression levels of the bacteria were determined by quantitative real-time RT-PCR. Overnight-cultured E. coli R strains were collected. The total RNA extraction with TRIzol (TaKaRa Biotechnology Co., Ltd) was carried out according to the vendor’s instruction. The purified total RNA was reverse transcripted with the ExScript RT Reagent Kit (TaKaRa Biotechnology Co., Ltd), according to the manufacturer’s instructions. The 16s rRNA was used as an internal control. Primers used for RT-PCR were listed in Table 2. Real-time PCR was performed by employR Premix Ex TaqTM Kit (TaKaRa Biotechnology Co., ing the SYBR Ltd) and was run on the ABI 7500 Real-Time PCR System (Applied Biosystems, CA, USA). The thermal cycling was initiated with a first denaturation step of 3 min at 95◦ C, followed by 40 cycles of 95◦ C for 15 s, 60◦ C for 15 s. Melting curve analysis was
4
FEMS Pathogens and Disease, 2015, Vol. 73, No. 3
Table 2. Primers used in RT-PCR. Primer
Strand
Sequence
16s-rRNA 16s-rRNA FimH FimH
+ − + −
5 -CTCCTACGGGAGGCAGCAG -3 5 -GWATTACCGCGGCKGCTG-3 5 -CGCAACGGTACGATTATTCC-3 5 -CTCCGGTACGTGCGTAATTT-3
performed and concentration values were measured. Negative controls were also included. The detected cycle threshold (Ct) values were interpolated into the standard curves of the plasmid constructs, and the mRNA expression in the samples was calculated by CT.
Statistical analysis All values are expressed as mean ± standard deviation. Statistical analysis was performed with Student’s t-test for compari-
son of two groups, and with ANOVA for multiple comparisons. Differences with P < 0.05 were considered to be statistically significant.
RESULTS The proteolytic activity of CFT073, COTD and COTD(pST) OmpT can rescue E. coli from cleavage by protamine P1. In order to check the proteolytic activity of E. coli strains, an antibiotic susceptibility test was performed by Kirby Bauer’s disk diffusion method as described above and the zone of inhibition for the strains was elucidated (Fig. 1A–C). COTD showed the highest inhibitory zone diameter, indicating its susceptibility to protamine whereas the other two stains, CFT073 and COTD(pST), showed a negligible inhibitory effect, indicating their resistance to protamine (P < 0.01) (Fig. 1D). To further confirm the effect of protamine on the growth rate of the strains, the growing cell suspensions were incubated with
Figure 1. The proteolytic activity of CFT073, COTD and COTD(pST). Inhibitory zones of CFT073 (A), COTD (B) and COTD(pST) (C) showed the susceptibility of the three E. coli strains to protamine. COTD exhibited the highest inhibitory activity whereas the other two stains, CFT073 and COTD(pST), showed the negligible inhibitory activities indicating their resistance to protamine. (∗ P < 0.01).
He et al.
5
Figure 2. The influence of protamine on the growth rates of CFT073, COTD and COTD(pST). The growth rates of strains were determined by measuring the OD after addition of protamine and 16 h of growth in LB agar. Microbial growth curves were plotted for each strain.
protamine at a concentration of 100 mg l−1 as described above and the OD values of the cultures were determined after growing in LB medium. As shown in Fig. 2, the growth rate of COTD was lower than that of CFT073 and COTD(pST), which had equal growth rates after 16 h of incubation.
Adhesion and invasion were reduced in the isogenic deletion mutant of ompT The relative adhesion (%) of CFT073, COTD and COTD(pST) to HBEC 5637 cells was shown in (Fig. 3). Significant group differences were found (F = 84.701, P < 0.01). The adherence rate of the ompT mutant COTD was significantly lower (52.94 ± 8.39%) than that of E. coli CFT073. The relative adhesion in COTD(pST) group was 74.63 ± 6.72% of the wild-type group, indicating that the adhesion defects could be partially complemented by the entire ompT gene. The invasion rates of CFT073, COTD and COTD(pST) were determined as described in the section ‘Materials and methods’. Significant differences in invasiveness were detected between the ompT mutant and its parent or complemented strain (F = 139.416, P < 0.001). The relative invasion rate of COTD (26.30
Figure 4. Invasion of E. coli CFT073, COTD and COTD(pST) into HBEC. The results are expressed as relative invasion (%) of the parent strain CFT073, which is defined as 100% (∗ P < 0.01).
± 10.16%) was significantly lower than that of the parent E. coli (CFT073) and the complemented mutant strain (COTD/pST) (Fig. 4). These results suggested that the ompT locus was required for E. coli CFT073 adhesion to and invasion of HBEC 5637 cells.
OmpT promotes acute UTI and is necessary for IBC formation during acute UTI
Figure 3. Adhesion of E. coli CFT073, COTD and COTD(pST) to HBEC 5637. The results are expressed as relative adhesion (%) of the parent strain CFT073, which is defined as 100% (∗ P < 0.01)
UPEC is an intracellular pathogen that can induce the initial epithelial colonization after infection. To further determine the role of OmpT in uropathogenesis, bladder bacterial loads of the different E. coli strains were evaluated by a murine cystitis model. Female C57B/L6 mice were transurethrally inoculated with ∼1 × 108 CFU of CFT073 (wild-type) or COTD (mutant) or COTD/pST (the complemented mutant). As shown in Fig. 5, the numbers of IBCs detected at 12 h by using β-galactosidase in situ staining was significantly lower after infection with the ompT mutant (28.66 ± 5.19 per bladder) when compared to that of the wild-type CFT073 (47.11 ± 10.8 per bladder)(P < 0.05), suggesting that OmpT is required for IBC formation during UTI.
6
FEMS Pathogens and Disease, 2015, Vol. 73, No. 3
Figure 5. Early IBC formation in female C57B/L6 mice. The numbers of IBCs were detected at 12 h by using β-galactosidase in situ staining. Experiments were repeated at least three times with similar results. Data are mean ± standard deviation (∗ P < 0.05 compare with CFT073).
Figure 7. Invasion of E. coli CFT073, COTD and COTD(pST) into bladder in vivo. Female C57B/L6 mice were inoculated with CFT073, COTD or COTD(pST), and bladders were harvested after 12 h and processed as described in the section ‘Materials and Methods’. Invaded bacteria were determined by serial dilution and plating. COTD was deficient in invasion compared to CFT073. Complementation with pSTV29 almost restores the invasion activity to wild-type levels. Experiments were repeated at least three times with similar results. Data are mean ± standard deviation (∗ P < 0.01 compare with CFT073).
could completely restore the invasion-deficient phenotype of the mutant COTD in vivo.
Role of OmpT in host inflammatory response to UTI in mice caused by CFT073
Figure 6. Effect of OmpT on mRNA expression of fimH. Real-time RT PCR was used to detect mRNA expression in UPEC strains as described in the section ‘Materials and Methods’. Values represent the means of triplicate determinations. Error bars indicate standard deviations (∗ P < 0.05).
OmpT may be related to expression of type 1 fimbrial adhesin FimH in CFT073 CFT073 can express type 1 fimbriae as confirmed by MSHA of guinea pig erythrocytes (Mobley et al., 1993; Gunther et al., 2001). Analysis of gene expression using RT-PCR showed that the gene expression level of the type 1 fimbrial adhesin FimH, which plays an important role in the pathogenesis of UTI, was significantly lower than that of its parent stain (P < 0.05) (Fig. 6).
COTD is deficient in invasion of bladder epithelial cells in vivo To further examine if OmpT plays a role in bacterial invasion in vivo during uropathogenesis, the course of murine cystitis with the OmpT mutant was studied. Female C57B/L6 mice were inoculated with ∼108 CFU of CFT073 (wild-type), COTD or COTD(pST). A gentamicin protection assay was used to verify that pSTV29 could restore the invasion defect of COTD in vivo. The results showed that CFT073 (51.33 ± 20.1 × 104 ) and COTD(pST) (49.12 ± 7.55 × 104 ) exhibited a similar level of the invasion activity, but COTD (9.33 ± 2.0 × 104 ) was defficient in invasion (P < 0.01 compare with CFT073) (Fig. 7). These findings suggest that OmpT
TNF-α-, IL-6- and IL-8-mediated inflammatory reaction plays an important role in the pathophysiological process of UPECinduced UTI (Anukam et al., 2009). To evaluate the host inflammatory response, these cytokines in the serum, bladder and kidney tissues of mice infected with E. coli strains were detected by ELISA. The cytokine levels in the serum, bladder and kidney tissues of the mice infected with CFT073 and COTD(pST) were significantly higher than that in the animals infected with COTD (P < 0.05 for IL-6, IL-8 and TNF-α). Especially the proinflammatory cytokine TNF-α in serum was about three times higher in the CFT073 group than that in the COTD group (Fig. 8). Histologic of bladder and kidney tissues also showed that ompT is correlated with UTI. The bladder epithelium of the mice infected with CFT073 or COTD(pST) was markedly thickened; however, little histological alteration was seen in the COTD group (Fig. 9). More neutrophils could be observed in the kidney sections of the mice infected with CFT073 when compared with those infected with COTD. These data suggest that OmpT could increase the inflammatory response in UPEC-induced UTIs.
DISCUSSION OmpT of E. coli, SopA of S. flexneri, PgtE of S. enteric and Pla of Y. pestis belong to the omptin family (Hritonenko and Stathopoulos 2007). These proteins are embedded in the bacterial outer membrane and folded in a conserved 10-stranded β-barrel structure (Vandeputte-Rutten et al., 2001). Many omptin proteins play an important role in bacterial pathogenesis. Statistical analysis showed that UTI E. coli isolates had a higher prevalence of ompT gene compared to that of the faecal E. coli isolates (Hritonenko and Stathopoulos 2007). However, it is unknown how OmpT contributes to the pathogenesis of UPEC infections. In the present study, we provided novel data to highlight the role of OmpT in the pathogenic process of UTIs infected by UPEC. The
He et al.
7
Figure 8. Inflammatory cytokine determinations of the blood (A), bladder (B) and kidney (C) in mice infected with UPEC strains. (A) TNF-α, IL-6 and IL-8 levels in the blood of the mice. (B) TNF-α, IL-6 and IL-8 levels in the bladder tissues of the mice. (C) TNF-α, IL-6 and IL-8 levels in the kidney tissues of the mice. The cytokine assay was carried out as described in the section ‘Materials and Methods’. Data are mean ± standard deviation (∗ P < 0.05).
results showed that COTD was less adherent and invasive for HBEC 5637 cells and the urinary tract inflammation was reduced in the murine model injected with COTD than in the CFT073 group. Several omptins including Pla of Y. pestis, PgtE of S. enterica and OmpT of E. coli have been proven in adherence to eukaryotic cells (Kienle et al., 1992; Lahteenmaki et al., 1998; Lahteenmaki et al., 2003; Kukkonen et al., 2004). Our data showed that the OmpT deletion mutant was deficient in bacterial adherence. We also observed that the wild-type strain (CFT073)mediated E. coli adhesion to the extracellular matrix (ECM) was significantly higher than the OmpT mutation strain (Qu et al., 2014). These findings suggested that OmpT is required for UPEC adhesion to the human epithelial cells. Moreover, OmpT can confer adhesiveness to the cell components, such as basement membrane (Matrigel) and mammalian ECM. Our study also suggested that OmpT is required for E. coli invasion of HBEC 5637. OmpT-mediated adhesion and invasion may play a role in the pathogenesis of UTI. The ability of OmpT to adhere to the basement membrane and human epithelial cells may contribute to bacterial cell attachment to host epithelial tissues (e.g. urinary tract) and the establishment of a bacterial infection. The high prevalence of the ompT gene in UPEC further supports the notion that OmpT may be a versatile contributor in the pathogenesis of UTI.
The bladder is a sterile environment which is kept healthy by flushing the pathogens out of the urethra. Therefore, adhesion in the bladder epithelial cells to resist the flushing of urine is particularly important in the UPEC pathogenic process. UPEC adheres to the bladder epithelial cells primarily through the type 1 fimbriae (Struve and Krogfelt 1999; Langermann and Ballou 2001; Schembri and Klemm 2001). They enter the bladder epithelium by binding to uroplakin molecules (Wu, Sun and Medina 1996; Mulvey et al., 1998; Martinez et al., 2000). UPEC then multiplies inside to form IBCs, which provide a safe shield from the host immune attack. FimH, the mannose-binding adhesin which is present at the tip of the type 1 pilus produced by most of the UPEC, is critical during UTI for mediating colonization and invasion of the bladder epithelium and establishment of IBCs. Our results showed that the gene expression level of the type 1 fimbrial adhesin FimH and the number of IBCs in COTDinfected animals were significantly lower than its parent stain or the complemented mutant, suggesting that OmpT may play an role in modulation of FimH gene expression and the formation of IBCs. Early studies also found that OmpT has a proteolytic activity in denatured solution, causing serious degradation of the exogenously expressed protein. In the UPEC strains, OmpT is reported to cleave proteamine P1, an antimicrobial peptide. In addition, OmpT can catalyze the activation of plasminogen to
8
FEMS Pathogens and Disease, 2015, Vol. 73, No. 3
Figure 9. Histological analysis of bladder and kidney tissues of the infected mice with E. coli strains. (A) Normal murine bladder. (B) Murine bladder infected with COTD. (C) Murine bladder infected with CFT073. (D) Murine bladder infected with COTD(pST). (E) Normal murine kidney. (F) Murine kidney infected with COTD. (G) Murine kidney infected with CFT073. (H) Murine kidney infected with COTD(pST). [×400 magnification].
plasmin (Leytus et al., 1981; Haiko et al., 2009), although Pla of Y. pestis exhibits significantly higher plasminogen activation than does OmpT (Lundrigan and Webb 1992; Sodeinde et al., 1992; Johnson et al., 2005b). It has been suggested that microbial or host-derived enzymes, particularly proteinases, can be used by pathogens for their invasion processes (Jong et al., 2003). For example, plasminogen activation by Pla confers Y. pestis a mechanism for producing host-derived proteolytic activity that can degrade the ECM and thus potentiate invasion (Lahteenmaki et al., 1998). In summary, our data in this report suggest that OmpT may play a multifaceted role in the pathogenesis of E. coli UTI, including UPEC-induced adhesion/invasion, IBC formation and acute inflammation. The role of OmpT in the pathogenesis of UTI still remains elusive. The fundamental issue is how specific surface structures on host cells contribute to the tissue tropism of this disease. Studies are in progress to define the molecular mechanisms by which OmpT contributes to the pathogenesis of UTI caused by UPEC.
AUTHOR CONTRIBUTIONS HC, SH and CH conceived and designed the experiment, XH, QW, YQ, XL and CH performed the experiment, XH, QW, SB, SPK and CH analyzed the data, HC contributed reagents/materials/analysis tools, SPK, XH, SB, LP, QW, SH and HC participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.
FUNDING This study was supported by a research grant from the National Natural Science Foundation of China (No. 30972637 to H. Cao) and Grant from School of Public Health and Tropical Medicine of Southern Medical University, China (No. GW201248 to H. Cao). Conflict of interest statement. None declared.
REFERENCES Anukam KC, Hayes K, Summers K, et al. Probiotic Lactobacillus rhamnosus GR-1 and Lactobacillus reuteri RC-14 may help downregulate TNF-Alpha, IL-6, IL-8, IL-10 and IL-12 (p70) in the neurogenic bladder of spinal cord injured patient with urinary tract infections: a two-case study. Adv Urol 2009;2009:680363. DebRoy C, Sidhu MS, Sarker U, et al. Complete sequence of pEC14 114, a highly conserved IncFIB/FIIA plasmid associated with uropathogenic Escherichia coli cystitis strains. Plasmid 2010;63:53–60. Ejrnaes K. Bacterial characteristics of importance for recurrent urinary tract infections caused by Escherichia coli. Dan Med Bull 2011;58:B4187. Elsinghorst EA. Measurement of invasion by gentamicin resistance. Method Enzymol 1994;236:405–20. Foxman B, Brown P. Epidemiology of urinary tract infections: transmission and risk factors, incidence, and costs. Infect Dis Clin N Am 2003;17:227–41. Foxman B, Zhang L, Palin K, et al. Bacterial virulence characteristics of Escherichia coli isolates from first-time urinary tract infection. J Infect Dis 1995;171:1514–21. Gunther NT, Lockatell V, Johnson DE, et al. In vivo dynamics of type 1 fimbria regulation in uropathogenic Escherichia coli during experimental urinary tract infection. Infect Immun 2001;69:2838–46. Gunther NW, Snyder JA, Lockatell V, et al. Assessment of virulence of uropathogenic Escherichia coli type 1 fimbrial mutants in which the invertible element is phase-locked on or off. Infect Immun 2002;70:3344–54. Haiko J, Suomalainen M, Ojala T, et al. Invited review: breaking barriers—attack on innate immune defences by omptin surface proteases of enterobacterial pathogens. Innate Immun 2009;15:67–80. Hilbert DW, Paulish-Miller TE, Tan CK, et al. Clinical Escherichia coli isolates utilize alpha-hemolysin to inhibit in vitro epithelial cytokine production. Microbes Infect 2012;14:628–38.
He et al.
Hritonenko V, Stathopoulos C. Omptin proteins: an expanding family of outer membrane proteases in Gram-negative Enterobacteriaceae. Mol Membr Biol 2007;24:395–406. Hui CY, Guo Y, He QS, et al. Escherichia coli outer membrane p-protease OmpT confers resistance to urinary cationic peptides. Microbiol Immunol 2010;54:452–9. Hung CS, Dodson KW, Hultgren SJ. A murine model of urinary tract infection. Nat Protoc 2009;4:1230–43. Johnson JR, Jelacic S, Schoening LM, et al. The IrgA homologue adhesin Iha is an Escherichia coli virulence factor in murine urinary tract infection. Infect Immun 2005a;73:965–71. Johnson JR, Kaster N, Kuskowski MA, et al. Identification of urovirulence traits in Escherichia coli by comparison of urinary and rectal E. coli isolates from dogs with urinary tract infection. J Clin Microbiol 2003;41:337–45. Johnson JR, Scheutz F, Ulleryd P, et al. Phylogenetic and pathotypic comparison of concurrent urine and rectal Escherichia coli isolates from men with febrile urinary tract infection. J Clin Microbiol 2005b;43:3895–900. Jong AY, Chen SH, Stins MF, et al. Binding of Candida albicans enolase to plasmin(ogen) results in enhanced invasion of human brain microvascular endothelial cells. J Med Microbiol 2003;52:615–22. Justice SS, Lauer SR, Hultgren SJ, et al. Maturation of intracellular Escherichia coli communities requires SurA. Infect Immun 2006;74:4793–800. Kienle Z, Emody L, Svanborg C, et al. Adhesive properties conferred by the plasminogen activator of Yersinia pestis. J Gen Microbiol 1992;138(Pt 8):1679–87. Kramer RA, Zandwijken D, Egmond MR, et al. In vitro folding, purification and characterization of Escherichia coli outer membrane protease ompT. Eur J Biochem 2000;267:885–93. Kukkonen M, Suomalainen M, Kyllonen P, et al. Lack of O-antigen is essential for plasminogen activation by Yersinia pestis and Salmonella enterica. Mol Microbiol 2004;51:215–25. Lahteenmaki K, Virkola R, Saren A, et al. Expression of plasminogen activator pla of Yersinia pestis enhances bacterial attachment to the mammalian extracellular matrix. Infect Immun 1998;66:5755–62. Lahteenmaki K, Kukkonen M, Jaatinen S, et al. Yersinia pestis Pla has multiple virulence-associated functions. Adv Exp Med Biol 2003;529:141–5. Langermann S, Ballou WJ. Vaccination utilizing the FimCH complex as a strategy to prevent Escherichia coli urinary tract infections. J Infect Dis 2001;183 (Suppl. 1):S84-S86. Lee DJ, Bingle LE, Heurlier K, et al. Gene doctoring: a method for recombineering in laboratory and pathogenic Escherichia coli strains. BMC Microbiol 2009;9:252. Leytus SP, Bowles LK, Konisky J, et al. Activation of plasminogen to plasmin by a protease associated with the outer membrane of Escherichia coli. P Natl Acad Sci USA 1981;78:1485–9. Lundrigan MD, Webb RM. Prevalence of ompT among Escherichia coli isolates of human origin. FEMS Microbiol Lett 1992;76:51–6. Marrs CF, Zhang L, Tallman P, et al. Variations in 10 putative uropathogen virulence genes among urinary, faecal and periurethral Escherichia coli. J Med Microbiol 2002;51:138–42. Martinez JJ, Mulvey MA, Schilling JD, et al. Type 1 pilusmediated bacterial invasion of bladder epithelial cells. EMBO J 2000;19:2803–12. Mobley HL, Jarvis KG, Elwood JP, et al. Isogenic P-fimbrial deletion mutants of pyelonephritogenic Escherichia coli: the role of alpha Gal(1-4) beta Gal binding in virulence of a wild-type strain. Mol Microbiol 1993;10:143–55. Mulvey MA, Lopez-Boado YS, Wilson CL, et al. Induction and eva-
9
sion of host defenses by type 1-piliated uropathogenic Escherichia coli. Science 1998;282:1494–7. Mulvey MA, Schilling JD, Hultgren SJ. Establishment of a persistent Escherichia coli reservoir during the acute phase of a bladder infection. Infect Immun 2001;69:4572–9. Mysorekar IU, Hultgren SJ. Mechanisms of uropathogenic Escherichia coli persistence and eradication from the urinary tract. P Natl Acad Sci USA 2006;103:14170–5. Qu YR, He XL, Wang Q, et al. [Pathogenesis of uropathogenic Escherichia coli: role of outer membrane protein T and the mechanism]. J South Med Univ 2014;34:174–9. Reisner A, Haagensen JA, Schembri MA, et al. Development and maturation of Escherichia coli K-12 biofilms. Mol Microbiol 2003;48:933–46. Ronald A. The etiology of urinary tract infection: traditional and emerging pathogens. Dis Mon 2003;49:71–82. Ronald AR, Nicolle LE, Stamm E, et al. Urinary tract infection in adults: research priorities and strategies. Int J Antimicrob Ag 2001;17:343–8. Schembri MA, Klemm P. Biofilm formation in a hydrodynamic environment by novel fimh variants and ramifications for virulence. Infect Immun 2001;69:1322–8. Schilling JD, Lorenz RG, Hultgren SJ. Effect of trimethoprimsulfamethoxazole on recurrent bacteriuria and bacterial persistence in mice infected with uropathogenic Escherichia coli. Infect Immun 2002;70:7042–9. Schwartz DJ, Chen SL, Hultgren SJ, et al. Population dynamics and niche distribution of uropathogenic Escherichia coli during acute and chronic urinary tract infection. Infect Immun 2011;79:4250–9. Shigemura K, Arakawa S, Tanaka K, et al. Clinical investigation of isolated bacteria from urinary tracts of hospitalized patients and their susceptibilities to antibiotics. J Infect Chemother 2009;15:18–22. Sodeinde OA, Subrahmanyam YV, Stark K, et al. A surface protease and the invasive character of plague. Science 1992;258:1004–7. Song J, Abraham SN. TLR-mediated immune responses in the urinary tract. Curr Opin Microbiol 2008;11:66–73. Stapleton A, Stamm WE. Prevention of urinary tract infection. Infect Dis Clin N Am 1997;11:719–33. Struve C, Krogfelt KA. In vivo detection of Escherichia coli type 1 fimbrial expression and phase variation during experimental urinary tract infection. Microbiology 1999;145(Pt 10):2683–90. Stumpe S, Schmid R, Stephens DL, et al. Identification of OmpT as the protease that hydrolyzes the antimicrobial peptide protamine before it enters growing cells of Escherichia coli. J Bacteriol 1998;180:4002–6. Svanborg C, Godaly G. Bacterial virulence in urinary tract infection. Infect Dis Clin N Am 1997;11:513–29. Vandeputte-Rutten L, Kramer RA, Kroon J, et al. Crystal structure of the outer membrane protease OmpT from Escherichia coli suggests a novel catalytic site. EMBO J 2001;20:5033–9. Wright KJ, Seed PC, Hultgren SJ. Uropathogenic Escherichia coli flagella aid in efficient urinary tract colonization. Infect Immun 2005;73:7657–68. Wu XR, Sun TT, Medina JJ. In vitro binding of type 1-fimbriated Escherichia coli to uroplakins Ia and Ib: relation to urinary tract infections. P Natl Acad Sci USA 1996;93:9630–5. Zhang L, Foxman B. Molecular epidemiology of Escherichia coli mediated urinary tract infections. Front Biosci 2003;8:e235–44. Zhao T, Fang XX, Liu XL, et al. Construction and functional studies of uropathogenic E. coli strains with ompT gene knockout. J South Med Univ 2012;32:956–9.
RESEARCH ARTICLE
Role of uropathogenic Escherichia coli outer membrane protein T in pathogenesis of urinary tract infection Xiao Long He1,# , Qin Wang1,# , Liang Peng2 , Ya-Rong Qu1 , Santhosh Puthiyakunnon1 , Xiao-Lu Liu1 , Chang Ye Hui3 , Swapna Boddu1 , Hong Cao1,∗ and Sheng-He Huang1,4 1
Department of Microbiology, School of Public Health & Tropical Medicine, Southern Medical University, Guangzhou 510515, China, 2 Department of Clinical Laboratory, The Second Affiliated Hospital of Guangzhou Medical University, Guangzhou 510260 China, 3 Shenzhen Prevention and Treatment Center for Occupational Disease, Shenzhen, Guangdong 518001, China and 4 Children’s Hospital Los Angeles, University of Southern California, Los Angeles 90027, USA ∗ Corresponding author: Department of Microbiology, School of Public Health & Tropical Medicine, Southern Medical University, Guangzhou 510515, China. Tel: +86-020-6164-8723; Fax: +86-020-6164-8307; E-mail: [email protected] # Contributed equally to this work. One sentence summary: The article shown that OmpT plays a multifaceted role in pathogenesis of urinary tract infection, including increased bacterial adhesiveness/invasiveness, formation of IBCs and upregulated proinflammatory cytokines. Editor: Eric Oswald
ABSTRACT OmpT is one of the members of the outer membrane protein family that has been identified as a virulence factor in most of the uropathogenic Escherichia coli (UPEC). However, the exact role of OmpT in the urinary tract infections (UTIs) remains unclear. To determine the role of OmpT in the pathogenesis of UPEC, an isogenic deletion mutant of ompT (COTD) was constructed by the λ Red recombination. Human bladder epithelial cell line 5637(HBEC 5637) was used to evaluate the ability of bacterial adhesion/invasion. A murine model of UTI was established to study the formation of intracellular bacterial communities (IBCs) in the process of UTIs. The cytokines were also examined during the pathogenesis. The results showed that the COTD strain was deficient in bacterial adhesion and invasion as well as in IBC formation compare to the parent strain. ELISA quantification analysis of cytokines showed that the levels of TNF-α, IL-6 and IL-8 in the serum, bladder and kidney tissues of the mice infected with COTD were lower than that of the CFT073 group. In summary, these results suggest that OmpT plays a multifaceted role in pathogenesis of UTI, including increased bacterial adhesiveness/invasiveness, formation of IBCs and upregulated proinflammatory cytokines. Keywords: OmpT; UPEC; UTIs; human bladder epithelial cells; IBCs
INTRODUCTION Uropathogenic Escherichia coli (UPEC), the most common pathotype of extraintestinal pathogenic E. coli, is the major causative agent of urinary tract infection (UTI) (Stapleton and Stamm 1997;
Svanborg and Godaly 1997; Foxman and Brown 2003; Zhang and Foxman 2003) causing up to 90% of community-acquired infections and 50% of hospital-acquired infections (Ronald et al., 2001; Ronald 2003). The majority of urinary tract pathogens originates in the intestinal tract and ascends through the urethra up to
Received: 21 August 2014; Accepted: 9 January 2015 C FEMS 2015. All rights reserved. For permissions, please e-mail: [email protected].
1
2
FEMS Pathogens and Disease, 2015, Vol. 73, No. 3
the bladder. In 95% of UTI, in the initial site of infection is the urinary bladder (Schilling, Lorenz and Hultgren 2002; Shigemura et al., 2009). UPEC strains exhibit a number of virulence traits to survive and invade the urinary epithelium. One important way is through interaction with the host innate immune system. The urinary tract epithelial cells can secrete antimicrobial peptides and cytokines (IL-6 and IL-8) when UPEC invade and eventually can trigger the inflammatory cascade during the pathophysiological process of UTI (Song and Abraham 2008; Hilbert et al., 2012). UPEC could also implement long-term persistence in the bladder cells through development of intracellular bacterial communities (IBCs) to escape host defenses. The IBCs characterized as a protected niche of invaded UPEC (Reisner et al., 2003; Mysorekar and Hultgren 2006) can escape from innate host surveillance, antibiotic therapy and clearance by micturition (Mulvey, Schilling and Hultgren 2001; Wright, Seed and Hultgren 2005; Schwartz et al., 2011). Besides, epidemiological analysis and clinical studies have shown that almost all UPEC strains are type B2 (DebRoy et al., 2010). Different from the rectum source E. coli, UPEC could express O antigen and have many UTI-related virulence factors, such as fimH (type1 fimbriae), pap (P fimbriae), papG (adhesin), allele III, sfa/foc, sfaS (S fimbriae), hlyA (hemolysin), fyuA (yersiniabacillin), iha (iron-regulated adhesin), iron (siderophore) and ompA (outer membrane protein A)(Foxman et al., 1995; Marrs et al., 2002; Johnson et al., 2005a; Ejrnaes 2011). These virulence factors are involved in adhesion, invasion, bacterial resistance to host immune defense and metabolic pathways in the pathogenic process of UPEC. OmpT, an aspartyl protease found on the outer membrane of E. coli, is a member of the family of omptin proteases that are present in some Gram-negative bacteria, such as OmpT in E. coli, SopA in Shigella flexneri, PgtE in Salmonella enterica and Pla in Yersinia pestis (Kramer et al., 2000). The in vitro enzymatic experiments showed that OmpT can hydrolyze protamine in a short time to avoid being killed by protamine (Stumpe et al., 1998; Hui et al. 2010). About 90% of clinically isolated UPEC strains carry ompT gene that is shown to be one of the most commonly expressed UTIs virulence genes (Foxman et al., 1995; Johnson et al., 2003). The epidemiological analysis showed that ompT may be functionally associated with kpsMT, cnf1, sfa and prf, while ompT is not closely linked genetically to these virulence factors (Foxman et al., 1995), which contribute to the pathological damage and inflammatory response of the bladder and kidney. However, the role of OmpT in urinary tract pathogenesis has not been fully confirmed. In order to study the role of ompT in the pathogenesis of UTI induced by UPEC, we constructed an isogenic deletion mutant of ompT by the λ Red recombineering technology. Our data suggest that adhesion, invasion, IBCs formation and inflammation are attenuated in UTI caused by the UPEC strain-lacking ompT.
MATERIALS AND METHODS Bacterial strains, plasmids and reagents Escherichia coli strains CFT073 and DH5α were used in this study. All strains were grown in Luria Bertani (LB) medium at 37◦ C. A LacZ staining kit was purchased from Beyotime Institute of Biotechnology (Shanghai, China). Plasmids pKD46, pET28a and pSTV29 were used in this study. The human bladder epithelial cell line 5637 (HBEC 5637) was purchased from ATCC Bioresource Center (USA) and was used as the in vitro cell model of adhesion and invasion assays. All cell culture reagents were purchased from Thermo Scientific (Beijing, China). All other chemicals in this study were purchased from Sigma Chemical Company (St. Louis, MO, USA).
Construction of isogenic mutant of ompT in E. coli CFT073 To define the role of OmpT in the pathogenesis of UTI, an isogenic ompT deletion mutant of E. coli CFT073 (COTD) was constructed using the λ RED homologous recombination system as described by Lee et al. (2009) and Zhao et al. (2012). Briefly, the linear DNA fragment was amplified from pET28a by PCR with primers (ompT Kan F2 and ompT Kan R2) (Table 1), the expected size of the fragment (1602 bp) was confirmed by PCR. After transformation of the DNA fragment into E. coli CFT073/pKD46, positive colonies were selected on LB agar with kanamycin. The primers OmpT F2/OmpT R2 and OmpT F1/OmpT R1 were used (Table 1). The mutants with the expected size (2066 bp) were confirmed by PCR. The complementation strain of COTD (COTD/pST) with ompT gene was constructed by subcloning the complete coding region of ompT into a low copy number expression plasmid (pSTV29). At last, the mutant was confirmed by DNA sequencing. In order to appraise whether the mutant of ompT displays grown impairment, CFT073, COTD and COTD (pST) were inoculated in the identical conditions and their growth curve was made. Briefly, CFT073, COTD and COTD(pST) were inoculated in with LB broth; the growth curves were determined by measuring the optical density (OD) at 600 nm at different time points (data not shown).
The assay of proteolytic activities of CFT073, COTD and COTD(pST) Proteolytic activities of the E. coli strains were determined using protamine as a substrate. In order to perform the assay, 500 μl of the protamine solution (0.01 g ml−1 ) was poured into phial with the addition of a 20 clean disk (diameter 6 mm) in advance and stored at 4◦ C. CFT073, COTD and COTD(pST) in the exponential phase were plated into a petri dish respectively, and then fixed the disk into the petri dish and cultured at 37◦ C for 6 h. Each assay was repeated three times.
Table 1. Primers and sequences in ompT deletion. Primer OmpT OmpT OmpT OmpT OmpT OmpT
Sequence Kan F2 Kan R2 F2 R2 F1 R1
AGGTTAAATGCTTACAATATTAGGGGATATTGTTTGCTTTTACCGGTAACAGGTGGCACTTTTCGGGGAAATG CCTCATGCTATTATCGCTAATATGCATCTAAAGGCATGGCACTTGAATAGGTGCGCTCTCCTGTTCCGAC CGTTCAGGCTAGCTTCGTTC ATTGCGAGGCCTTATGTGTC ATACCTGCTCCATTTTTGCTGT AACCTGGACGGATGAAAGTAGA
He et al.
The susceptibility of E. coli strains to protamine was tested as described by Stumpe et al. (1998). Protamine was added at a concentration of 100 mg l−1 to a cell suspension at the exponential phase (A600 ∼ 0.5), then the cells were grown in LB medium at 37◦ C and the growth curves were determined by measuring the OD at 600 nm at different time points.
Adhesion and invasion assays Adherence and invasion assays were performed essentially as described by Elsinghorst (1994). Briefly, the HBEC 5637 confluent monolayers in 24-well plates (approximately 5 × 105 cells well−1 ) were incubated with bacteria (CFT073, COTD, COTD(pST)) at a multiplicity of infection of 100 for 2 h. The monolayers were washed five times with 0.1 mol l−1 sterile PBS and lysed by the addition of 150 μl 0.5% Triton X-100 in each well for 15 min at room temperature. Then 350 μl ddH2 O was added into each well at room temperature for 10 min. Adherent and intracellular bacteria were enumerated by plating 10-fold serial dilutions on LB agar plates. To determine invasion frequencies, after the initial 2 h incubation, the cells were washed three times with 0.1 mol l−1 sterile PBS and treated with gentamicin (final concentration was 200 μg ml−1 ) for 1 h to kill extracellular bacteria. Then the cells were washed three times with sterile PBS, lysed according to the above procedure and the intracellular bacteria were enumerated on LB agar plates. The effect of adherence and invasion of E. coli strains were expressed as relative adhesion and invasion (percentage of the total wild-type strain CFT073 adhered to or internalized by HBEC 5637 cells). Each assay was performed in triplicate wells and repeated five times.
Murine model of acute UTI In order to explore and characterize the role of OmpT in the invasion ability and IBCs formation of E. coli CFT073, COTD and COTD(pST) strains, a murine model of UTI was constructed (Hung, Dodson and Hultgren 2009). Briefly, 7-week-old female C57B/L6 mice susceptible to UPEC were used in our study and randomly divided into three groups. They were deeply anesthetized with an intraperitoneal injection of 0.6% pentobarbital sodium (m/w). An intravenous syringe was used as a urinary catheter inserted through the urethra into the bladder. About 50 μl bacteria suspension (about 1 × 108 CFU at ∼10 μl s−1 ) was injected into the bladder by pushing the syringe plunger in 40 s. After 12 h, bladders were immediately harvested aseptically and processed for IBC enumeration as described below. Animal studies were approved and performed in accordance with the Committee for Animal Studies at Southern Medical University.
Ex vivo IBC enumeration and gentamicin protection assay The IBCs were examined according to the procedure as previously described (Justice et al., 2006). The bladders were removed and stretched on pads by hobnails. The stretched bladders were subjected to lacZ staining according to the manufacturer’ instruction and photographed by light microscopy in whole mount for enumeration of spots representing IBCs. Experiments were repeated three times. For the gentamicin protection assay, mice were inoculated with ∼108 CFU of three strains respectively as described above. After 12 h infection, mice were sacrifficed and bladders were re-
3
moved in sterile PBS. Bladders were splayed and washed three times in 400 ml sterile PBS each time. Bladders were then incubated at 37◦ C for 60 min with 200 μg ml−1 gentamicin to kill the adherent extracellular bacteria. After this incubation, bladders were washed three times in 1 ml fresh sterile PBS. Bladders were homogenized in 1 ml PBS with 0.05% Triton X-100. Then serial diluted samples were plated to LB agar and incubated overnight at 37◦ C for colony enumeration. Experiments were repeated three times.
Cytokine determinations and histological analysis After 12 h of E. coli inoculation, animals were anesthetized and blood samples were collected by cardiac puncture. After perfusion with 20 ml PBS, the bladder and kidneys were cut, and the bladder tissues were cut into two halves. Each half of the tissue was put into a glass homogenizer for homogenizing. The blood samples, bladder and kidney tissue homogenates were centrifuged at 1000 g for 10 min. The supernatants were collected and used for ELISA determination of TNF-α, IL-6 and IL8 according to the manufacturer’s instruction (BD Biosciences, CA, USA). The other half of the bladder and kidney tissues were immersion-fixed overnight in 4% paraformaldehyde, and paraffin embedded, 5-μm thick sections were stained with hematoxylin and eosin for histological evaluation.
Mannose-sensitive hemagglutination assay MSHA were performed as described earlier (Gunther et al., 2002). Blood samples were collected in 1% (wt/vol) acid citrate dextrose from guinea pigs. The erythrocytes were washed four times in PBS and suspended in PBS to 3% (vol/vol) the same day as used. CFT073, COTD and COTD(pST) were passaged statically three times for 48 h each in Luria broth at 37◦ C and then harvested by centrifugation (5000 g, 3 min). Cell pellets were resuspended in PBS to a 109 CFU ml−1 and assayed for expression of type 1 fimbriae by hemagglutination. Bacterial suspensions were serially diluted 2-fold into V-bottom 96-well microtiter plates in duplicate. Equal volumes of 3% (vol/vol) guinea pig erythrocytes were mixed with bacterial suspensions. Mannose was added to a 50 mM final concentration to one row of the duplicated serial dilutions for each bacterial growth condition. Non-agglutinated guinea pig erythrocytes formed tight buttons of cells at the bottom of the plate well, whereas agglutinated erythrocytes formed a diffuse mat of cells across the bottom of the well. The titer was defined as the reciprocal of the highest dilution of bacteria that agglutinated erythrocytes.
Real-time reverse-transcription PCR FimH mRNA expression levels of the bacteria were determined by quantitative real-time RT-PCR. Overnight-cultured E. coli R strains were collected. The total RNA extraction with TRIzol (TaKaRa Biotechnology Co., Ltd) was carried out according to the vendor’s instruction. The purified total RNA was reverse transcripted with the ExScript RT Reagent Kit (TaKaRa Biotechnology Co., Ltd), according to the manufacturer’s instructions. The 16s rRNA was used as an internal control. Primers used for RT-PCR were listed in Table 2. Real-time PCR was performed by employR Premix Ex TaqTM Kit (TaKaRa Biotechnology Co., ing the SYBR Ltd) and was run on the ABI 7500 Real-Time PCR System (Applied Biosystems, CA, USA). The thermal cycling was initiated with a first denaturation step of 3 min at 95◦ C, followed by 40 cycles of 95◦ C for 15 s, 60◦ C for 15 s. Melting curve analysis was
4
FEMS Pathogens and Disease, 2015, Vol. 73, No. 3
Table 2. Primers used in RT-PCR. Primer
Strand
Sequence
16s-rRNA 16s-rRNA FimH FimH
+ − + −
5 -CTCCTACGGGAGGCAGCAG -3 5 -GWATTACCGCGGCKGCTG-3 5 -CGCAACGGTACGATTATTCC-3 5 -CTCCGGTACGTGCGTAATTT-3
performed and concentration values were measured. Negative controls were also included. The detected cycle threshold (Ct) values were interpolated into the standard curves of the plasmid constructs, and the mRNA expression in the samples was calculated by CT.
Statistical analysis All values are expressed as mean ± standard deviation. Statistical analysis was performed with Student’s t-test for compari-
son of two groups, and with ANOVA for multiple comparisons. Differences with P < 0.05 were considered to be statistically significant.
RESULTS The proteolytic activity of CFT073, COTD and COTD(pST) OmpT can rescue E. coli from cleavage by protamine P1. In order to check the proteolytic activity of E. coli strains, an antibiotic susceptibility test was performed by Kirby Bauer’s disk diffusion method as described above and the zone of inhibition for the strains was elucidated (Fig. 1A–C). COTD showed the highest inhibitory zone diameter, indicating its susceptibility to protamine whereas the other two stains, CFT073 and COTD(pST), showed a negligible inhibitory effect, indicating their resistance to protamine (P < 0.01) (Fig. 1D). To further confirm the effect of protamine on the growth rate of the strains, the growing cell suspensions were incubated with
Figure 1. The proteolytic activity of CFT073, COTD and COTD(pST). Inhibitory zones of CFT073 (A), COTD (B) and COTD(pST) (C) showed the susceptibility of the three E. coli strains to protamine. COTD exhibited the highest inhibitory activity whereas the other two stains, CFT073 and COTD(pST), showed the negligible inhibitory activities indicating their resistance to protamine. (∗ P < 0.01).
He et al.
5
Figure 2. The influence of protamine on the growth rates of CFT073, COTD and COTD(pST). The growth rates of strains were determined by measuring the OD after addition of protamine and 16 h of growth in LB agar. Microbial growth curves were plotted for each strain.
protamine at a concentration of 100 mg l−1 as described above and the OD values of the cultures were determined after growing in LB medium. As shown in Fig. 2, the growth rate of COTD was lower than that of CFT073 and COTD(pST), which had equal growth rates after 16 h of incubation.
Adhesion and invasion were reduced in the isogenic deletion mutant of ompT The relative adhesion (%) of CFT073, COTD and COTD(pST) to HBEC 5637 cells was shown in (Fig. 3). Significant group differences were found (F = 84.701, P < 0.01). The adherence rate of the ompT mutant COTD was significantly lower (52.94 ± 8.39%) than that of E. coli CFT073. The relative adhesion in COTD(pST) group was 74.63 ± 6.72% of the wild-type group, indicating that the adhesion defects could be partially complemented by the entire ompT gene. The invasion rates of CFT073, COTD and COTD(pST) were determined as described in the section ‘Materials and methods’. Significant differences in invasiveness were detected between the ompT mutant and its parent or complemented strain (F = 139.416, P < 0.001). The relative invasion rate of COTD (26.30
Figure 4. Invasion of E. coli CFT073, COTD and COTD(pST) into HBEC. The results are expressed as relative invasion (%) of the parent strain CFT073, which is defined as 100% (∗ P < 0.01).
± 10.16%) was significantly lower than that of the parent E. coli (CFT073) and the complemented mutant strain (COTD/pST) (Fig. 4). These results suggested that the ompT locus was required for E. coli CFT073 adhesion to and invasion of HBEC 5637 cells.
OmpT promotes acute UTI and is necessary for IBC formation during acute UTI
Figure 3. Adhesion of E. coli CFT073, COTD and COTD(pST) to HBEC 5637. The results are expressed as relative adhesion (%) of the parent strain CFT073, which is defined as 100% (∗ P < 0.01)
UPEC is an intracellular pathogen that can induce the initial epithelial colonization after infection. To further determine the role of OmpT in uropathogenesis, bladder bacterial loads of the different E. coli strains were evaluated by a murine cystitis model. Female C57B/L6 mice were transurethrally inoculated with ∼1 × 108 CFU of CFT073 (wild-type) or COTD (mutant) or COTD/pST (the complemented mutant). As shown in Fig. 5, the numbers of IBCs detected at 12 h by using β-galactosidase in situ staining was significantly lower after infection with the ompT mutant (28.66 ± 5.19 per bladder) when compared to that of the wild-type CFT073 (47.11 ± 10.8 per bladder)(P < 0.05), suggesting that OmpT is required for IBC formation during UTI.
6
FEMS Pathogens and Disease, 2015, Vol. 73, No. 3
Figure 5. Early IBC formation in female C57B/L6 mice. The numbers of IBCs were detected at 12 h by using β-galactosidase in situ staining. Experiments were repeated at least three times with similar results. Data are mean ± standard deviation (∗ P < 0.05 compare with CFT073).
Figure 7. Invasion of E. coli CFT073, COTD and COTD(pST) into bladder in vivo. Female C57B/L6 mice were inoculated with CFT073, COTD or COTD(pST), and bladders were harvested after 12 h and processed as described in the section ‘Materials and Methods’. Invaded bacteria were determined by serial dilution and plating. COTD was deficient in invasion compared to CFT073. Complementation with pSTV29 almost restores the invasion activity to wild-type levels. Experiments were repeated at least three times with similar results. Data are mean ± standard deviation (∗ P < 0.01 compare with CFT073).
could completely restore the invasion-deficient phenotype of the mutant COTD in vivo.
Role of OmpT in host inflammatory response to UTI in mice caused by CFT073
Figure 6. Effect of OmpT on mRNA expression of fimH. Real-time RT PCR was used to detect mRNA expression in UPEC strains as described in the section ‘Materials and Methods’. Values represent the means of triplicate determinations. Error bars indicate standard deviations (∗ P < 0.05).
OmpT may be related to expression of type 1 fimbrial adhesin FimH in CFT073 CFT073 can express type 1 fimbriae as confirmed by MSHA of guinea pig erythrocytes (Mobley et al., 1993; Gunther et al., 2001). Analysis of gene expression using RT-PCR showed that the gene expression level of the type 1 fimbrial adhesin FimH, which plays an important role in the pathogenesis of UTI, was significantly lower than that of its parent stain (P < 0.05) (Fig. 6).
COTD is deficient in invasion of bladder epithelial cells in vivo To further examine if OmpT plays a role in bacterial invasion in vivo during uropathogenesis, the course of murine cystitis with the OmpT mutant was studied. Female C57B/L6 mice were inoculated with ∼108 CFU of CFT073 (wild-type), COTD or COTD(pST). A gentamicin protection assay was used to verify that pSTV29 could restore the invasion defect of COTD in vivo. The results showed that CFT073 (51.33 ± 20.1 × 104 ) and COTD(pST) (49.12 ± 7.55 × 104 ) exhibited a similar level of the invasion activity, but COTD (9.33 ± 2.0 × 104 ) was defficient in invasion (P < 0.01 compare with CFT073) (Fig. 7). These findings suggest that OmpT
TNF-α-, IL-6- and IL-8-mediated inflammatory reaction plays an important role in the pathophysiological process of UPECinduced UTI (Anukam et al., 2009). To evaluate the host inflammatory response, these cytokines in the serum, bladder and kidney tissues of mice infected with E. coli strains were detected by ELISA. The cytokine levels in the serum, bladder and kidney tissues of the mice infected with CFT073 and COTD(pST) were significantly higher than that in the animals infected with COTD (P < 0.05 for IL-6, IL-8 and TNF-α). Especially the proinflammatory cytokine TNF-α in serum was about three times higher in the CFT073 group than that in the COTD group (Fig. 8). Histologic of bladder and kidney tissues also showed that ompT is correlated with UTI. The bladder epithelium of the mice infected with CFT073 or COTD(pST) was markedly thickened; however, little histological alteration was seen in the COTD group (Fig. 9). More neutrophils could be observed in the kidney sections of the mice infected with CFT073 when compared with those infected with COTD. These data suggest that OmpT could increase the inflammatory response in UPEC-induced UTIs.
DISCUSSION OmpT of E. coli, SopA of S. flexneri, PgtE of S. enteric and Pla of Y. pestis belong to the omptin family (Hritonenko and Stathopoulos 2007). These proteins are embedded in the bacterial outer membrane and folded in a conserved 10-stranded β-barrel structure (Vandeputte-Rutten et al., 2001). Many omptin proteins play an important role in bacterial pathogenesis. Statistical analysis showed that UTI E. coli isolates had a higher prevalence of ompT gene compared to that of the faecal E. coli isolates (Hritonenko and Stathopoulos 2007). However, it is unknown how OmpT contributes to the pathogenesis of UPEC infections. In the present study, we provided novel data to highlight the role of OmpT in the pathogenic process of UTIs infected by UPEC. The
He et al.
7
Figure 8. Inflammatory cytokine determinations of the blood (A), bladder (B) and kidney (C) in mice infected with UPEC strains. (A) TNF-α, IL-6 and IL-8 levels in the blood of the mice. (B) TNF-α, IL-6 and IL-8 levels in the bladder tissues of the mice. (C) TNF-α, IL-6 and IL-8 levels in the kidney tissues of the mice. The cytokine assay was carried out as described in the section ‘Materials and Methods’. Data are mean ± standard deviation (∗ P < 0.05).
results showed that COTD was less adherent and invasive for HBEC 5637 cells and the urinary tract inflammation was reduced in the murine model injected with COTD than in the CFT073 group. Several omptins including Pla of Y. pestis, PgtE of S. enterica and OmpT of E. coli have been proven in adherence to eukaryotic cells (Kienle et al., 1992; Lahteenmaki et al., 1998; Lahteenmaki et al., 2003; Kukkonen et al., 2004). Our data showed that the OmpT deletion mutant was deficient in bacterial adherence. We also observed that the wild-type strain (CFT073)mediated E. coli adhesion to the extracellular matrix (ECM) was significantly higher than the OmpT mutation strain (Qu et al., 2014). These findings suggested that OmpT is required for UPEC adhesion to the human epithelial cells. Moreover, OmpT can confer adhesiveness to the cell components, such as basement membrane (Matrigel) and mammalian ECM. Our study also suggested that OmpT is required for E. coli invasion of HBEC 5637. OmpT-mediated adhesion and invasion may play a role in the pathogenesis of UTI. The ability of OmpT to adhere to the basement membrane and human epithelial cells may contribute to bacterial cell attachment to host epithelial tissues (e.g. urinary tract) and the establishment of a bacterial infection. The high prevalence of the ompT gene in UPEC further supports the notion that OmpT may be a versatile contributor in the pathogenesis of UTI.
The bladder is a sterile environment which is kept healthy by flushing the pathogens out of the urethra. Therefore, adhesion in the bladder epithelial cells to resist the flushing of urine is particularly important in the UPEC pathogenic process. UPEC adheres to the bladder epithelial cells primarily through the type 1 fimbriae (Struve and Krogfelt 1999; Langermann and Ballou 2001; Schembri and Klemm 2001). They enter the bladder epithelium by binding to uroplakin molecules (Wu, Sun and Medina 1996; Mulvey et al., 1998; Martinez et al., 2000). UPEC then multiplies inside to form IBCs, which provide a safe shield from the host immune attack. FimH, the mannose-binding adhesin which is present at the tip of the type 1 pilus produced by most of the UPEC, is critical during UTI for mediating colonization and invasion of the bladder epithelium and establishment of IBCs. Our results showed that the gene expression level of the type 1 fimbrial adhesin FimH and the number of IBCs in COTDinfected animals were significantly lower than its parent stain or the complemented mutant, suggesting that OmpT may play an role in modulation of FimH gene expression and the formation of IBCs. Early studies also found that OmpT has a proteolytic activity in denatured solution, causing serious degradation of the exogenously expressed protein. In the UPEC strains, OmpT is reported to cleave proteamine P1, an antimicrobial peptide. In addition, OmpT can catalyze the activation of plasminogen to
8
FEMS Pathogens and Disease, 2015, Vol. 73, No. 3
Figure 9. Histological analysis of bladder and kidney tissues of the infected mice with E. coli strains. (A) Normal murine bladder. (B) Murine bladder infected with COTD. (C) Murine bladder infected with CFT073. (D) Murine bladder infected with COTD(pST). (E) Normal murine kidney. (F) Murine kidney infected with COTD. (G) Murine kidney infected with CFT073. (H) Murine kidney infected with COTD(pST). [×400 magnification].
plasmin (Leytus et al., 1981; Haiko et al., 2009), although Pla of Y. pestis exhibits significantly higher plasminogen activation than does OmpT (Lundrigan and Webb 1992; Sodeinde et al., 1992; Johnson et al., 2005b). It has been suggested that microbial or host-derived enzymes, particularly proteinases, can be used by pathogens for their invasion processes (Jong et al., 2003). For example, plasminogen activation by Pla confers Y. pestis a mechanism for producing host-derived proteolytic activity that can degrade the ECM and thus potentiate invasion (Lahteenmaki et al., 1998). In summary, our data in this report suggest that OmpT may play a multifaceted role in the pathogenesis of E. coli UTI, including UPEC-induced adhesion/invasion, IBC formation and acute inflammation. The role of OmpT in the pathogenesis of UTI still remains elusive. The fundamental issue is how specific surface structures on host cells contribute to the tissue tropism of this disease. Studies are in progress to define the molecular mechanisms by which OmpT contributes to the pathogenesis of UTI caused by UPEC.
AUTHOR CONTRIBUTIONS HC, SH and CH conceived and designed the experiment, XH, QW, YQ, XL and CH performed the experiment, XH, QW, SB, SPK and CH analyzed the data, HC contributed reagents/materials/analysis tools, SPK, XH, SB, LP, QW, SH and HC participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.
FUNDING This study was supported by a research grant from the National Natural Science Foundation of China (No. 30972637 to H. Cao) and Grant from School of Public Health and Tropical Medicine of Southern Medical University, China (No. GW201248 to H. Cao). Conflict of interest statement. None declared.
REFERENCES Anukam KC, Hayes K, Summers K, et al. Probiotic Lactobacillus rhamnosus GR-1 and Lactobacillus reuteri RC-14 may help downregulate TNF-Alpha, IL-6, IL-8, IL-10 and IL-12 (p70) in the neurogenic bladder of spinal cord injured patient with urinary tract infections: a two-case study. Adv Urol 2009;2009:680363. DebRoy C, Sidhu MS, Sarker U, et al. Complete sequence of pEC14 114, a highly conserved IncFIB/FIIA plasmid associated with uropathogenic Escherichia coli cystitis strains. Plasmid 2010;63:53–60. Ejrnaes K. Bacterial characteristics of importance for recurrent urinary tract infections caused by Escherichia coli. Dan Med Bull 2011;58:B4187. Elsinghorst EA. Measurement of invasion by gentamicin resistance. Method Enzymol 1994;236:405–20. Foxman B, Brown P. Epidemiology of urinary tract infections: transmission and risk factors, incidence, and costs. Infect Dis Clin N Am 2003;17:227–41. Foxman B, Zhang L, Palin K, et al. Bacterial virulence characteristics of Escherichia coli isolates from first-time urinary tract infection. J Infect Dis 1995;171:1514–21. Gunther NT, Lockatell V, Johnson DE, et al. In vivo dynamics of type 1 fimbria regulation in uropathogenic Escherichia coli during experimental urinary tract infection. Infect Immun 2001;69:2838–46. Gunther NW, Snyder JA, Lockatell V, et al. Assessment of virulence of uropathogenic Escherichia coli type 1 fimbrial mutants in which the invertible element is phase-locked on or off. Infect Immun 2002;70:3344–54. Haiko J, Suomalainen M, Ojala T, et al. Invited review: breaking barriers—attack on innate immune defences by omptin surface proteases of enterobacterial pathogens. Innate Immun 2009;15:67–80. Hilbert DW, Paulish-Miller TE, Tan CK, et al. Clinical Escherichia coli isolates utilize alpha-hemolysin to inhibit in vitro epithelial cytokine production. Microbes Infect 2012;14:628–38.
He et al.
Hritonenko V, Stathopoulos C. Omptin proteins: an expanding family of outer membrane proteases in Gram-negative Enterobacteriaceae. Mol Membr Biol 2007;24:395–406. Hui CY, Guo Y, He QS, et al. Escherichia coli outer membrane p-protease OmpT confers resistance to urinary cationic peptides. Microbiol Immunol 2010;54:452–9. Hung CS, Dodson KW, Hultgren SJ. A murine model of urinary tract infection. Nat Protoc 2009;4:1230–43. Johnson JR, Jelacic S, Schoening LM, et al. The IrgA homologue adhesin Iha is an Escherichia coli virulence factor in murine urinary tract infection. Infect Immun 2005a;73:965–71. Johnson JR, Kaster N, Kuskowski MA, et al. Identification of urovirulence traits in Escherichia coli by comparison of urinary and rectal E. coli isolates from dogs with urinary tract infection. J Clin Microbiol 2003;41:337–45. Johnson JR, Scheutz F, Ulleryd P, et al. Phylogenetic and pathotypic comparison of concurrent urine and rectal Escherichia coli isolates from men with febrile urinary tract infection. J Clin Microbiol 2005b;43:3895–900. Jong AY, Chen SH, Stins MF, et al. Binding of Candida albicans enolase to plasmin(ogen) results in enhanced invasion of human brain microvascular endothelial cells. J Med Microbiol 2003;52:615–22. Justice SS, Lauer SR, Hultgren SJ, et al. Maturation of intracellular Escherichia coli communities requires SurA. Infect Immun 2006;74:4793–800. Kienle Z, Emody L, Svanborg C, et al. Adhesive properties conferred by the plasminogen activator of Yersinia pestis. J Gen Microbiol 1992;138(Pt 8):1679–87. Kramer RA, Zandwijken D, Egmond MR, et al. In vitro folding, purification and characterization of Escherichia coli outer membrane protease ompT. Eur J Biochem 2000;267:885–93. Kukkonen M, Suomalainen M, Kyllonen P, et al. Lack of O-antigen is essential for plasminogen activation by Yersinia pestis and Salmonella enterica. Mol Microbiol 2004;51:215–25. Lahteenmaki K, Virkola R, Saren A, et al. Expression of plasminogen activator pla of Yersinia pestis enhances bacterial attachment to the mammalian extracellular matrix. Infect Immun 1998;66:5755–62. Lahteenmaki K, Kukkonen M, Jaatinen S, et al. Yersinia pestis Pla has multiple virulence-associated functions. Adv Exp Med Biol 2003;529:141–5. Langermann S, Ballou WJ. Vaccination utilizing the FimCH complex as a strategy to prevent Escherichia coli urinary tract infections. J Infect Dis 2001;183 (Suppl. 1):S84-S86. Lee DJ, Bingle LE, Heurlier K, et al. Gene doctoring: a method for recombineering in laboratory and pathogenic Escherichia coli strains. BMC Microbiol 2009;9:252. Leytus SP, Bowles LK, Konisky J, et al. Activation of plasminogen to plasmin by a protease associated with the outer membrane of Escherichia coli. P Natl Acad Sci USA 1981;78:1485–9. Lundrigan MD, Webb RM. Prevalence of ompT among Escherichia coli isolates of human origin. FEMS Microbiol Lett 1992;76:51–6. Marrs CF, Zhang L, Tallman P, et al. Variations in 10 putative uropathogen virulence genes among urinary, faecal and periurethral Escherichia coli. J Med Microbiol 2002;51:138–42. Martinez JJ, Mulvey MA, Schilling JD, et al. Type 1 pilusmediated bacterial invasion of bladder epithelial cells. EMBO J 2000;19:2803–12. Mobley HL, Jarvis KG, Elwood JP, et al. Isogenic P-fimbrial deletion mutants of pyelonephritogenic Escherichia coli: the role of alpha Gal(1-4) beta Gal binding in virulence of a wild-type strain. Mol Microbiol 1993;10:143–55. Mulvey MA, Lopez-Boado YS, Wilson CL, et al. Induction and eva-
9
sion of host defenses by type 1-piliated uropathogenic Escherichia coli. Science 1998;282:1494–7. Mulvey MA, Schilling JD, Hultgren SJ. Establishment of a persistent Escherichia coli reservoir during the acute phase of a bladder infection. Infect Immun 2001;69:4572–9. Mysorekar IU, Hultgren SJ. Mechanisms of uropathogenic Escherichia coli persistence and eradication from the urinary tract. P Natl Acad Sci USA 2006;103:14170–5. Qu YR, He XL, Wang Q, et al. [Pathogenesis of uropathogenic Escherichia coli: role of outer membrane protein T and the mechanism]. J South Med Univ 2014;34:174–9. Reisner A, Haagensen JA, Schembri MA, et al. Development and maturation of Escherichia coli K-12 biofilms. Mol Microbiol 2003;48:933–46. Ronald A. The etiology of urinary tract infection: traditional and emerging pathogens. Dis Mon 2003;49:71–82. Ronald AR, Nicolle LE, Stamm E, et al. Urinary tract infection in adults: research priorities and strategies. Int J Antimicrob Ag 2001;17:343–8. Schembri MA, Klemm P. Biofilm formation in a hydrodynamic environment by novel fimh variants and ramifications for virulence. Infect Immun 2001;69:1322–8. Schilling JD, Lorenz RG, Hultgren SJ. Effect of trimethoprimsulfamethoxazole on recurrent bacteriuria and bacterial persistence in mice infected with uropathogenic Escherichia coli. Infect Immun 2002;70:7042–9. Schwartz DJ, Chen SL, Hultgren SJ, et al. Population dynamics and niche distribution of uropathogenic Escherichia coli during acute and chronic urinary tract infection. Infect Immun 2011;79:4250–9. Shigemura K, Arakawa S, Tanaka K, et al. Clinical investigation of isolated bacteria from urinary tracts of hospitalized patients and their susceptibilities to antibiotics. J Infect Chemother 2009;15:18–22. Sodeinde OA, Subrahmanyam YV, Stark K, et al. A surface protease and the invasive character of plague. Science 1992;258:1004–7. Song J, Abraham SN. TLR-mediated immune responses in the urinary tract. Curr Opin Microbiol 2008;11:66–73. Stapleton A, Stamm WE. Prevention of urinary tract infection. Infect Dis Clin N Am 1997;11:719–33. Struve C, Krogfelt KA. In vivo detection of Escherichia coli type 1 fimbrial expression and phase variation during experimental urinary tract infection. Microbiology 1999;145(Pt 10):2683–90. Stumpe S, Schmid R, Stephens DL, et al. Identification of OmpT as the protease that hydrolyzes the antimicrobial peptide protamine before it enters growing cells of Escherichia coli. J Bacteriol 1998;180:4002–6. Svanborg C, Godaly G. Bacterial virulence in urinary tract infection. Infect Dis Clin N Am 1997;11:513–29. Vandeputte-Rutten L, Kramer RA, Kroon J, et al. Crystal structure of the outer membrane protease OmpT from Escherichia coli suggests a novel catalytic site. EMBO J 2001;20:5033–9. Wright KJ, Seed PC, Hultgren SJ. Uropathogenic Escherichia coli flagella aid in efficient urinary tract colonization. Infect Immun 2005;73:7657–68. Wu XR, Sun TT, Medina JJ. In vitro binding of type 1-fimbriated Escherichia coli to uroplakins Ia and Ib: relation to urinary tract infections. P Natl Acad Sci USA 1996;93:9630–5. Zhang L, Foxman B. Molecular epidemiology of Escherichia coli mediated urinary tract infections. Front Biosci 2003;8:e235–44. Zhao T, Fang XX, Liu XL, et al. Construction and functional studies of uropathogenic E. coli strains with ompT gene knockout. J South Med Univ 2012;32:956–9.
