American Journal of Infection Control 42 (2014) 1229-32
Contents lists available at ScienceDirect
American Journal of Infection Control
American Journal of Infection Control
journal homepage: www.ajicjournal.org
Brief report
Routine monitoring of adenovirus and norovirus within the health care environment Louise Pankhurst PhD a,1, 2, Elaine Cloutman-Green MRes b, *, 2, Melisa Canales PhD a, Nikki D’Arcy PhD a, John C. Hartley FRCPath b a
CEGE, Civil, Environmental and Geomatic Engineering, University College London, London, UK Great Ormond Street Hospital for Children National Health Service Foundation Trust, Cameliar Botnar Laboratories, Department of Microbiology, Virology and Infection Prevention and Control, London, UK
b
Key Words: Health careeassociated infection Adenovirus Norovirus Hematology and oncology Health care environment Pediatrics
This study investigated the presence of adenovirus and norovirus on ward surfaces using real-time polymerase chain reaction (PCR) to assist in the development of evidence-based infection control policy. Screening was carried out weekly for 6 months in the common areas of 2 pediatric wards. Additionally, a one-off screening was undertaken for adenovirus and norovirus on a day unit and for adenovirus only in patient cubicles while occupied. Over the 6-month screening of common areas, 2.4% of samples were positive for adenovirus or norovirus. In rooms occupied with adenovirus-infected children, all cubicle screening sites and almost all swabs were contaminated with adenovirus. In the day unit, 13% of samples were positive. Cleaning and environmental interaction strategies must therefore be designed to control nosocomial transmission of viruses outside of outbreak scenarios. Crown Copyright Ó 2014 Published by Elsevier Inc. on behalf of the Association for Professionals in Infection Control and Epidemiology, Inc. All rights reserved.
The development of evidence-based infection control policy is essential to reduce health careeassociated infections. It has been demonstrated that when 82% of ward sites were visually clean, only 30% of sites were considered bacteriologically clean.1 Consequently, it has been proposed that hospitals should monitor the level of microbial contamination within the environment either through aerobic colony counts or the presence of indicator organisms, such as methicillin-resistant Staphylococcus aureus.2 These recommendations do not currently extend to encompass viruses.1,2 Studies have demonstrated how viral contamination can be widespread in the hospital environment. Despite the suggestion that routine monitoring of hospital surfaces should be carried out to prevent infectious disease outbreaks, this has not yet been
* Address correspondence to Elaine Cloutman-Green, MRes, Microbiology, Level 4 Cameliar Botnar Laboratory, Great Ormond Street Hospital, Great Ormond St, London WC1N 3JH, UK. E-mail address: [email protected] (E. Cloutman-Green). This research was funded through the Engineering and Physical Sciences Research Council (grant no. EP/G029881/1). Cloutman-Green received funding from the National Institute of Health Research (grant no. HCSD10). Conflict of interest statement: The authors have no conflicts of interest to declare. 1 Current address: Nuffield Department of Clinical Medicine, University of Oxford, John Radcliffe Hospital, Oxford, UK. 2 Contributed equally to this study.
implemented widely.3-6 There remains no consensus on the methods and cutoffs that could be used in viral monitoring schemes. This study investigated the presence of adenovirus (AV) and norovirus (NV) within the pediatric health care environment under nonoutbreak settings and established whether these viruses are suitable targets for routine microbial surveillance of cleaning efficacy and to assist in the prevention of transmission. METHODS Environmental screening for AV and NV was undertaken weekly on 2 wards within the Great Ormond Street Hospital National Health Service Foundation Trust for 6 months (January-June 2011). Twelve sites were sampled within the shared ward area on each ward (Table 1). The first ward was an 11-bed inpatient hematopoietic stem cell transplantation unit (HSCTU), and the second ward was a 10-bed immunology/infectious disease unit (IIU). Further sampling for AV was undertaken within 3 occupied cubicles on the IIU where AV-positive patients had been admitted for at least 1 week. Routine cleaning on the HSCTU and IIU was undertaken with 1,000 ppm chlorine (Chlor-Clean, Guest Medical, Aylesford, UK). Finally a one-off environmental screen for AV and NV was undertaken on a hematology/oncology day unit (HODU). Sampling
0196-6553/$36.00 - Crown Copyright Ó 2014 Published by Elsevier Inc. on behalf of the Association for Professionals in Infection Control and Epidemiology, Inc. All rights reserved. http://dx.doi.org/10.1016/j.ajic.2014.07.028
1230
L. Pankhurst et al. / American Journal of Infection Control 42 (2014) 1229-32
Table 1 Locations and area sampled and the results for each sampling strategy Positives (n) Unit and sample number HSCTU 1 2 3 4 5 6 7 8 9 10 11 IIU 1 2 3 4 5 6 7 8 9 10 11 Cubicles 1 2 3 4 5 6 7 8 9 10 11 12
Location
Area
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19
NV
Floor outside known negative patient room Filing cabinet Floor outside known positive patient room Nurse’s station Sluice or medication room door handle Floor by main exit doors Notes trolley Computer keyboards Telephone on nurse’s station Ward exit door handle Chair arm/crash trolley
10 cm2 10 cm2 10 cm2 10 cm2 Entire handle 10 cm2 10 cm2 Every key and surface on the right 50% Entire key and handset Entire handle Where hand rests (w10 cm2) or 10 cm2
0 0 0 0 0 1 0 0 0 0 0
(25) (25) (25) (25) (25) (25) (25) (25) (25) (25) (25)
1 1 1 0 1 4 1 0 0 0 0
(25) (25) (25) (25) (25) (25) (25) (25) (25) (25) (25)
Floor outside known negative patient room Filing cabinet Floor outside known positive patient room Nurse’s station Sluice or medication room door handle Floor by main exit doors Notes trolley Computer keyboards Telephone on nurse’s station Ward exit door handle Chair arm/crash trolley
10 cm2 10 cm2 10 cm2 10 cm2 Entire handle 10 cm2 10 cm2 Every key and surface on the right 50% Entire key and handset Entire handle Where hand rests (w10 cm2) or 10 cm2
1 0 1 0 0 1 0 0 0 0 0
(24) (24) (24) (24) (24) (24) (24) (24) (24) (24) (24)
0 0 0 0 0 0 0 0 0 0 0
(24) (24) (24) (24) (24) (24) (24) (24) (24) (24) (24)
Floor under sink Clinical waste bin inner rim (under lid) Chair with arms (right) Door handle into patient bathroom Telephone keypads Taps in patient bathroom Mattress top Bed or cot frame under bed Trolley surface (in ante room if present) Side window sill (right side) Cubicle room exit door handle Corridor floor outside of cubicle or ante room entrance
10 cm2 Entire rim Where hands rests (10 cm2) Entire handle on cubicle side Entire keypad Entirety of both taps 10 cm2 10 cm2 10 cm2 10 cm2 Entire handle on cubicle side 10 cm2
2 3 3 3 3 2 3 3 3 3 3 2
(3) (3) (3) (3) (3) (3) (3) (3) (3) (3) (3) (3)
HODU No.
AV
Positives (n) Location Day procedure bay Recovery bay Procedure room Assisted toilet 1 Assisted toilet 2 Ensuite cubicle Bay 1 Corridor Bay 2 Bay 3 Height and weight room Reception Reception seating Cubicle 2 Cubicle 2 (preclean) Treatment room 1 Treatment room 2 Treatment room 3 Treatment room 4
No. sites in location (10 cm2 each) 5 6 5 2 3 5 5 3 5 5 6 5 5 5 5 5 5 5 5
AV 0 0 0 0 0 0 1 1 2 2 1 0 0 0 0 2 1 0 1
(5) (6) (5) (2) (3) (5) (5) (3) (5) (5) (6) (5) (5) (5) (5) (5) (5) (5) (5)
NV 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
(5) (6) (5) (2) (3) (5) (5) (3) (5) (5) (6) (5) (5) (5) (5) (5) (5) (5) (5)
AV, adenovirus; HODU, hematology/oncology day unit; HSCTU, hematopoietic stem cell transplantation unit; IIU, immunology/infectious disease unit; NV, norovirus.
included both bed spaces and shared ward areas (Table 1) and was undertaken before cleaning was performed. Routine cleaning on the HODU was undertaken with chlorine dioxide, Tristel Fuse (Tristel, Snailwell, UK). The clinical equipment was cleaned separately with Tuffie 5 Universal Wipes (Vernacare, Bolton, UK). Nucleic acids were extracted using the RNeasy Mini Kit (Qiagen, Crawley, UK) with the addition of a 56 C 10-minute heat step prior to extraction; subsequent procedures were carried out according to the manufacturer’s protocol. All samples were subject to a complementary DNA step. All samples were subject to a
complementary DNA step where 21.2 mL of nucleic acid extract added to 0.24 mg/mL random primers (Life Technologies, Paisley, UK); 0.02 mM dNTPs (Bioline, London, UK) was heated at 65 C for 5 minutes then 4 C for 2 minutes. Then, 1X first-strand buffer (Life Technologies, UK), 0.05 mM DTT (Life Technologies, Paisley, UK), 2 units/mL of RNaseOUT (Life Technologies, UK), and 15 units/mL of M-MLV (Life Technologies, Paisley, UK) were added per sample, and the mixture was heated at 37 C for 30 minutes and then 70 C for 15 minutes. Samples were stored at 20 C until quantitative polymerase chain reaction (PCR) was performed.
L. Pankhurst et al. / American Journal of Infection Control 42 (2014) 1229-32
1231
Table 2 Real-time PCR primer and probe sequences Primer name Adeno-X Forward Adeno Reverse Adeno Probe Mus-F Mus-R Mus-Probe COG1F COG1R RING1(a)-TP RING1(b)-TP QNIF2 COG2R QNIFS
Primer type Forward Reverse Probe Forward Reverse Probe Forward Reverse Probe Probe Forward Reverse Probe
Sequence
Reference
50 eGCCACGGTGGGGTTTCTAAACTTe30 50 eGCCCCAGTGGTCTTACATGCACATC-30 50 -FAMeTGCACCAGACCCGGGCTCAGGTACTCCGAeBHQ1-30 50 eGGACACTATGCCCCTCCTTAGAe30 50 eAGCTCCAAACTCCGTCTCTGTAAe30 50 - NEDeTTGGGAACAAAACACCCAeMGBNFQ-30 50 eCGYTGGATGCGNTTYCATGAe30 50 eCTTAGACGCCATCATCATTYACe30 50 -FAM-AGATYGCGATCYCCTGTCCA-BHQ1-30 50 -FAM-AGATCGCGGTCTCCTGTCCA-BHQ1-30 50 eATGTTCAGRTGGATGAGRTTCTCWGAe3’ 50 eTCGACGCCATCTTCATTCACAe30 50 -JOEeAGCACGTGGGAGGGCGATCGeBHQ1-30
7 7 7
8 8 8 8 9 8 9
PCR, polymerase chain reaction.
Real-time PCR detection of AV
Cubicles
Real-time PCR detection of mouse genomic DNA alongside the AV hexon gene was performed (Table 2).7 The reaction was performed as follows: 10 mL TaqMan Fast Universal PCR Master Mix (2X) (Applied Biosystems, Warrington, UK), 0.1 mM of Adeno Forward, 0.1 mM Adeno Reverse, 0.1 mM Adeno Probe, 0.1 mM Mus-F, 0.1 mM Mus-R, 0.1 mM Mus-Probe, 10 mL DNA extract, and molecular grade water to give a final volume of 25 mL. The reactions were cycled on the ABI PRISM 7,500 Fast Real-Time PCR System (Applied Biosystems, Warrington, UK) at 95 C for 20 seconds followed by 45 cycles of 95 C for 3 seconds and 60 C for 30 seconds. The assay limit of detection was 200 copies per milliliter. Samples identified as inhibited by internal control analysis were diluted 1:10 and retested via quantitative PCR.
A total of 36 samples were taken within IIU cubicles occupied by AV-positive patients before postdischarge cleaning. Positive samples were found in all locations; in total, 92% of swabs taken were positive for AV (Table 1).
Real-time PCR detection of NV Real-time PCR detection of the NV GI and GII open reading frame genes was performed.8,9 The reaction was as follows: 10 mL TaqMan Fast Universal PCR Master Mix (2X) (Applied Biosystems, Warrington, UK), 0.1 mM of COG1F, 0.1 mM COG1R, 0.05 mM RING1(a)-TP, 0.05 mM RING1(b)-TP, 0.1 mM QNIF2, 0.1 mM COG2R, 0.1 mM QNIFS, 10 mL complementary DNA, and molecular grade water to give a final volume of 25 mL. The reactions were cycled on the ABI PRISM 7,500 Fast Real-Time PCR System (Applied Biosystems, Warrington, UK) following the same cycling conditions as for AV. Samples identified as inhibited by internal control analysis were diluted 1:10 and retested via quantitative PCR. The assay limit of detection was 5,000 copies per milliliter.
RESULTS HSCT and immunology units Over the 6-month period, 539 samples were taken on the HSCTU and IIU; 13 (2.4%) were positive (Table 1). Ten positive samples were found on the HSCTU and 3 on the IIU; 4 were positive for AV and 9 for NV GII. All positive NV samples were found on the HSCTU. Ten of the positive samples were floor swabs, with 6 recovered from the floor by the main ward exit doors. Other sites with multiple positive samples were the floor outside a known negative and known positive patient’s room. The nonfloor positive samples were NV recovered from a filing cabinet, sluice door handle, and notes trolley.
HODU Ninety samples were taken on 1 day on the HODU. Eleven were AV positive, and 1 was positive for NV GI (Table 1). The NV positive site was the clinical waste bin lid within an isolation cubicle. AV positive sites included the surfaces of toys (dollhouse, teddy bear, toy bricks), 2 chair arms, 2 exit door handles, 1 fan, 2 clinical surfaces (trolley, intravenous bench), and 1 clinical waste bin. All but one of the positive samples were recovered from bays and rooms where patients are weighed or treated. Locations with multiple positive samples were 2 of the 3 bays with 4 beds and 1 of the 4 treatment rooms. DISCUSSION Sampling of environmental sites was undertaken to assess potential risk of transmission to staff and patients through interaction with the environment. Positive samples were recovered by all screening strategies. All sampling sites within cubicles occupied by AV-positive patients were positive for AV, including the exit door handle, concurring with previous findings that high patient interaction with the environment results in heavy viral contamination.10,11 Fewer positive samples were found where there was less patient interaction (eg, shared ward areas); 2.4% of samples from shared ward areas on the HSCTU and IIU were positive for NV or AV. Although the floor was most commonly positive, positive samples were also recovered from high hand-touch surfaces, including door handles and notes trolleys, in agreement with other investigations.5 NV GII was most frequently found on the HSCTU, whereas the IIU and HODU samples were more commonly positive for AV. All but 1 positive NV sample revealed RNA of GII, the strain most commonly associated with NV outbreaks.12 Environmental monitoring of viruses (and bacteria) that cause health careeassociated infection (HCAI) provides an indication of contamination, cleaning success, and identifies potential routes of infection transmission.3,6 Although finding organisms in the environment does not always equate to cases of HCAI, it does indicate that the environment can act as a potential reservoir. The data therefore emphasizes the importance of infection control policies,
1232
L. Pankhurst et al. / American Journal of Infection Control 42 (2014) 1229-32
including good hand hygiene practice, particularly before and after exiting both cubicles and shared ward areas, not eating within any ward areas, and not storing items on the floor. Routine environmental monitoring of AV and NV would allow identification of heavily contaminated areas where patient interaction with the environment is high. Monitoring schemes should also include day units, as indicated by the contamination found within this area and the associated risk of transmission between hospitals, communities, and vice versa. In conclusion, extensively distributed viral contamination has been shown to occur outside of the outbreak scenario. Infection control practices should take into account routine risk of viral infection transmission, and monitoring for viruses should be considered in the development of evidencebased infection control practice to prevent HCAI.
References 1. Al-Hamad A, Maxwell S. How clean is clean? Proposed methods for hospital cleaning assessment. J Hosp Infect 2008;70:328-34. 2. Dancer SJ. How do we assess hospital cleaning? A proposal for microbiological standards for surface hygiene in hospitals. J Hosp Infect 2004;56:10-5.
3. Carducci A, Verani M, Lombardi R, Casini B, Privitera G. Environmental survey to assess viral contamination of air and surfaces in hospital settings. J Hosp Infect 2011;77:242-7. 4. Foulongne V, Courgnaud V, Champeau W, Segondy M. Detection of Merkel cell polyomavirus on environmental surfaces. J Med Virol 2011;83:1435-9. 5. Gallimore CI, Taylor C, Gennery AR, Cant AJ, Galloway A, Iturriza-Gomara M, et al. Environmental monitoring for gastroenteric viruses in a pediatric primary immunodeficiency unit. J Clin Microbiol 2006;44:395-9. 6. Ganime AC, Carvalho-Costa FA, Mendonça MC, Vieira CB, Santos M, Costa Filho R, et al. Group A rotavirus detection on environmental surfaces in a hospital intensive care unit. Am J Infect Control 2012;40:544-7. 7. Heim A, Ebnet C, Harste G, Pring-Åkerblom P. Rapid and quantitative detection of human adenovirus DNA by real-time PCR. J Med Virol 2003;70: 228-39. 8. Kageyama T, Kojima S, Shinohara M, Uchida K, Fukushi S, Hoshino FB, et al. Broadly reactive and highly sensitive assay for Norwalk-like viruses based on real-time quantitative reverse transcription-PCR. J Clin Microbiol 2003;41: 1548-57. 9. Loisy F, Atmar RL, Guillon P, Le Cann P, Pommepuy M, Le Guyader FS. Real-time RT-PCR for norovirus screening in shellfish. J Virol Methods 2005;123:1-7. 10. Barker J, Vipond IB, Bloomfield SF. Effects of cleaning and disinfection in reducing the spread of norovirus contamination via environmental surfaces. J Hosp Infect 2004;58:42-9. 11. Vipond IB, Barker J, Bloomfield SF, Caul EO. Molecular epidemiology for detecting Norwalk-like viruses in clinical cases and associated environment contamination. J Hosp Infect 2002;50:237-8. 12. Glass RI, Parashar UD, Estes MK. Norovirus gastroenteritis. N Engl J Med 2009; 361:1776-85.
Contents lists available at ScienceDirect
American Journal of Infection Control
American Journal of Infection Control
journal homepage: www.ajicjournal.org
Brief report
Routine monitoring of adenovirus and norovirus within the health care environment Louise Pankhurst PhD a,1, 2, Elaine Cloutman-Green MRes b, *, 2, Melisa Canales PhD a, Nikki D’Arcy PhD a, John C. Hartley FRCPath b a
CEGE, Civil, Environmental and Geomatic Engineering, University College London, London, UK Great Ormond Street Hospital for Children National Health Service Foundation Trust, Cameliar Botnar Laboratories, Department of Microbiology, Virology and Infection Prevention and Control, London, UK
b
Key Words: Health careeassociated infection Adenovirus Norovirus Hematology and oncology Health care environment Pediatrics
This study investigated the presence of adenovirus and norovirus on ward surfaces using real-time polymerase chain reaction (PCR) to assist in the development of evidence-based infection control policy. Screening was carried out weekly for 6 months in the common areas of 2 pediatric wards. Additionally, a one-off screening was undertaken for adenovirus and norovirus on a day unit and for adenovirus only in patient cubicles while occupied. Over the 6-month screening of common areas, 2.4% of samples were positive for adenovirus or norovirus. In rooms occupied with adenovirus-infected children, all cubicle screening sites and almost all swabs were contaminated with adenovirus. In the day unit, 13% of samples were positive. Cleaning and environmental interaction strategies must therefore be designed to control nosocomial transmission of viruses outside of outbreak scenarios. Crown Copyright Ó 2014 Published by Elsevier Inc. on behalf of the Association for Professionals in Infection Control and Epidemiology, Inc. All rights reserved.
The development of evidence-based infection control policy is essential to reduce health careeassociated infections. It has been demonstrated that when 82% of ward sites were visually clean, only 30% of sites were considered bacteriologically clean.1 Consequently, it has been proposed that hospitals should monitor the level of microbial contamination within the environment either through aerobic colony counts or the presence of indicator organisms, such as methicillin-resistant Staphylococcus aureus.2 These recommendations do not currently extend to encompass viruses.1,2 Studies have demonstrated how viral contamination can be widespread in the hospital environment. Despite the suggestion that routine monitoring of hospital surfaces should be carried out to prevent infectious disease outbreaks, this has not yet been
* Address correspondence to Elaine Cloutman-Green, MRes, Microbiology, Level 4 Cameliar Botnar Laboratory, Great Ormond Street Hospital, Great Ormond St, London WC1N 3JH, UK. E-mail address: [email protected] (E. Cloutman-Green). This research was funded through the Engineering and Physical Sciences Research Council (grant no. EP/G029881/1). Cloutman-Green received funding from the National Institute of Health Research (grant no. HCSD10). Conflict of interest statement: The authors have no conflicts of interest to declare. 1 Current address: Nuffield Department of Clinical Medicine, University of Oxford, John Radcliffe Hospital, Oxford, UK. 2 Contributed equally to this study.
implemented widely.3-6 There remains no consensus on the methods and cutoffs that could be used in viral monitoring schemes. This study investigated the presence of adenovirus (AV) and norovirus (NV) within the pediatric health care environment under nonoutbreak settings and established whether these viruses are suitable targets for routine microbial surveillance of cleaning efficacy and to assist in the prevention of transmission. METHODS Environmental screening for AV and NV was undertaken weekly on 2 wards within the Great Ormond Street Hospital National Health Service Foundation Trust for 6 months (January-June 2011). Twelve sites were sampled within the shared ward area on each ward (Table 1). The first ward was an 11-bed inpatient hematopoietic stem cell transplantation unit (HSCTU), and the second ward was a 10-bed immunology/infectious disease unit (IIU). Further sampling for AV was undertaken within 3 occupied cubicles on the IIU where AV-positive patients had been admitted for at least 1 week. Routine cleaning on the HSCTU and IIU was undertaken with 1,000 ppm chlorine (Chlor-Clean, Guest Medical, Aylesford, UK). Finally a one-off environmental screen for AV and NV was undertaken on a hematology/oncology day unit (HODU). Sampling
0196-6553/$36.00 - Crown Copyright Ó 2014 Published by Elsevier Inc. on behalf of the Association for Professionals in Infection Control and Epidemiology, Inc. All rights reserved. http://dx.doi.org/10.1016/j.ajic.2014.07.028
1230
L. Pankhurst et al. / American Journal of Infection Control 42 (2014) 1229-32
Table 1 Locations and area sampled and the results for each sampling strategy Positives (n) Unit and sample number HSCTU 1 2 3 4 5 6 7 8 9 10 11 IIU 1 2 3 4 5 6 7 8 9 10 11 Cubicles 1 2 3 4 5 6 7 8 9 10 11 12
Location
Area
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19
NV
Floor outside known negative patient room Filing cabinet Floor outside known positive patient room Nurse’s station Sluice or medication room door handle Floor by main exit doors Notes trolley Computer keyboards Telephone on nurse’s station Ward exit door handle Chair arm/crash trolley
10 cm2 10 cm2 10 cm2 10 cm2 Entire handle 10 cm2 10 cm2 Every key and surface on the right 50% Entire key and handset Entire handle Where hand rests (w10 cm2) or 10 cm2
0 0 0 0 0 1 0 0 0 0 0
(25) (25) (25) (25) (25) (25) (25) (25) (25) (25) (25)
1 1 1 0 1 4 1 0 0 0 0
(25) (25) (25) (25) (25) (25) (25) (25) (25) (25) (25)
Floor outside known negative patient room Filing cabinet Floor outside known positive patient room Nurse’s station Sluice or medication room door handle Floor by main exit doors Notes trolley Computer keyboards Telephone on nurse’s station Ward exit door handle Chair arm/crash trolley
10 cm2 10 cm2 10 cm2 10 cm2 Entire handle 10 cm2 10 cm2 Every key and surface on the right 50% Entire key and handset Entire handle Where hand rests (w10 cm2) or 10 cm2
1 0 1 0 0 1 0 0 0 0 0
(24) (24) (24) (24) (24) (24) (24) (24) (24) (24) (24)
0 0 0 0 0 0 0 0 0 0 0
(24) (24) (24) (24) (24) (24) (24) (24) (24) (24) (24)
Floor under sink Clinical waste bin inner rim (under lid) Chair with arms (right) Door handle into patient bathroom Telephone keypads Taps in patient bathroom Mattress top Bed or cot frame under bed Trolley surface (in ante room if present) Side window sill (right side) Cubicle room exit door handle Corridor floor outside of cubicle or ante room entrance
10 cm2 Entire rim Where hands rests (10 cm2) Entire handle on cubicle side Entire keypad Entirety of both taps 10 cm2 10 cm2 10 cm2 10 cm2 Entire handle on cubicle side 10 cm2
2 3 3 3 3 2 3 3 3 3 3 2
(3) (3) (3) (3) (3) (3) (3) (3) (3) (3) (3) (3)
HODU No.
AV
Positives (n) Location Day procedure bay Recovery bay Procedure room Assisted toilet 1 Assisted toilet 2 Ensuite cubicle Bay 1 Corridor Bay 2 Bay 3 Height and weight room Reception Reception seating Cubicle 2 Cubicle 2 (preclean) Treatment room 1 Treatment room 2 Treatment room 3 Treatment room 4
No. sites in location (10 cm2 each) 5 6 5 2 3 5 5 3 5 5 6 5 5 5 5 5 5 5 5
AV 0 0 0 0 0 0 1 1 2 2 1 0 0 0 0 2 1 0 1
(5) (6) (5) (2) (3) (5) (5) (3) (5) (5) (6) (5) (5) (5) (5) (5) (5) (5) (5)
NV 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
(5) (6) (5) (2) (3) (5) (5) (3) (5) (5) (6) (5) (5) (5) (5) (5) (5) (5) (5)
AV, adenovirus; HODU, hematology/oncology day unit; HSCTU, hematopoietic stem cell transplantation unit; IIU, immunology/infectious disease unit; NV, norovirus.
included both bed spaces and shared ward areas (Table 1) and was undertaken before cleaning was performed. Routine cleaning on the HODU was undertaken with chlorine dioxide, Tristel Fuse (Tristel, Snailwell, UK). The clinical equipment was cleaned separately with Tuffie 5 Universal Wipes (Vernacare, Bolton, UK). Nucleic acids were extracted using the RNeasy Mini Kit (Qiagen, Crawley, UK) with the addition of a 56 C 10-minute heat step prior to extraction; subsequent procedures were carried out according to the manufacturer’s protocol. All samples were subject to a complementary DNA step. All samples were subject to a
complementary DNA step where 21.2 mL of nucleic acid extract added to 0.24 mg/mL random primers (Life Technologies, Paisley, UK); 0.02 mM dNTPs (Bioline, London, UK) was heated at 65 C for 5 minutes then 4 C for 2 minutes. Then, 1X first-strand buffer (Life Technologies, UK), 0.05 mM DTT (Life Technologies, Paisley, UK), 2 units/mL of RNaseOUT (Life Technologies, UK), and 15 units/mL of M-MLV (Life Technologies, Paisley, UK) were added per sample, and the mixture was heated at 37 C for 30 minutes and then 70 C for 15 minutes. Samples were stored at 20 C until quantitative polymerase chain reaction (PCR) was performed.
L. Pankhurst et al. / American Journal of Infection Control 42 (2014) 1229-32
1231
Table 2 Real-time PCR primer and probe sequences Primer name Adeno-X Forward Adeno Reverse Adeno Probe Mus-F Mus-R Mus-Probe COG1F COG1R RING1(a)-TP RING1(b)-TP QNIF2 COG2R QNIFS
Primer type Forward Reverse Probe Forward Reverse Probe Forward Reverse Probe Probe Forward Reverse Probe
Sequence
Reference
50 eGCCACGGTGGGGTTTCTAAACTTe30 50 eGCCCCAGTGGTCTTACATGCACATC-30 50 -FAMeTGCACCAGACCCGGGCTCAGGTACTCCGAeBHQ1-30 50 eGGACACTATGCCCCTCCTTAGAe30 50 eAGCTCCAAACTCCGTCTCTGTAAe30 50 - NEDeTTGGGAACAAAACACCCAeMGBNFQ-30 50 eCGYTGGATGCGNTTYCATGAe30 50 eCTTAGACGCCATCATCATTYACe30 50 -FAM-AGATYGCGATCYCCTGTCCA-BHQ1-30 50 -FAM-AGATCGCGGTCTCCTGTCCA-BHQ1-30 50 eATGTTCAGRTGGATGAGRTTCTCWGAe3’ 50 eTCGACGCCATCTTCATTCACAe30 50 -JOEeAGCACGTGGGAGGGCGATCGeBHQ1-30
7 7 7
8 8 8 8 9 8 9
PCR, polymerase chain reaction.
Real-time PCR detection of AV
Cubicles
Real-time PCR detection of mouse genomic DNA alongside the AV hexon gene was performed (Table 2).7 The reaction was performed as follows: 10 mL TaqMan Fast Universal PCR Master Mix (2X) (Applied Biosystems, Warrington, UK), 0.1 mM of Adeno Forward, 0.1 mM Adeno Reverse, 0.1 mM Adeno Probe, 0.1 mM Mus-F, 0.1 mM Mus-R, 0.1 mM Mus-Probe, 10 mL DNA extract, and molecular grade water to give a final volume of 25 mL. The reactions were cycled on the ABI PRISM 7,500 Fast Real-Time PCR System (Applied Biosystems, Warrington, UK) at 95 C for 20 seconds followed by 45 cycles of 95 C for 3 seconds and 60 C for 30 seconds. The assay limit of detection was 200 copies per milliliter. Samples identified as inhibited by internal control analysis were diluted 1:10 and retested via quantitative PCR.
A total of 36 samples were taken within IIU cubicles occupied by AV-positive patients before postdischarge cleaning. Positive samples were found in all locations; in total, 92% of swabs taken were positive for AV (Table 1).
Real-time PCR detection of NV Real-time PCR detection of the NV GI and GII open reading frame genes was performed.8,9 The reaction was as follows: 10 mL TaqMan Fast Universal PCR Master Mix (2X) (Applied Biosystems, Warrington, UK), 0.1 mM of COG1F, 0.1 mM COG1R, 0.05 mM RING1(a)-TP, 0.05 mM RING1(b)-TP, 0.1 mM QNIF2, 0.1 mM COG2R, 0.1 mM QNIFS, 10 mL complementary DNA, and molecular grade water to give a final volume of 25 mL. The reactions were cycled on the ABI PRISM 7,500 Fast Real-Time PCR System (Applied Biosystems, Warrington, UK) following the same cycling conditions as for AV. Samples identified as inhibited by internal control analysis were diluted 1:10 and retested via quantitative PCR. The assay limit of detection was 5,000 copies per milliliter.
RESULTS HSCT and immunology units Over the 6-month period, 539 samples were taken on the HSCTU and IIU; 13 (2.4%) were positive (Table 1). Ten positive samples were found on the HSCTU and 3 on the IIU; 4 were positive for AV and 9 for NV GII. All positive NV samples were found on the HSCTU. Ten of the positive samples were floor swabs, with 6 recovered from the floor by the main ward exit doors. Other sites with multiple positive samples were the floor outside a known negative and known positive patient’s room. The nonfloor positive samples were NV recovered from a filing cabinet, sluice door handle, and notes trolley.
HODU Ninety samples were taken on 1 day on the HODU. Eleven were AV positive, and 1 was positive for NV GI (Table 1). The NV positive site was the clinical waste bin lid within an isolation cubicle. AV positive sites included the surfaces of toys (dollhouse, teddy bear, toy bricks), 2 chair arms, 2 exit door handles, 1 fan, 2 clinical surfaces (trolley, intravenous bench), and 1 clinical waste bin. All but one of the positive samples were recovered from bays and rooms where patients are weighed or treated. Locations with multiple positive samples were 2 of the 3 bays with 4 beds and 1 of the 4 treatment rooms. DISCUSSION Sampling of environmental sites was undertaken to assess potential risk of transmission to staff and patients through interaction with the environment. Positive samples were recovered by all screening strategies. All sampling sites within cubicles occupied by AV-positive patients were positive for AV, including the exit door handle, concurring with previous findings that high patient interaction with the environment results in heavy viral contamination.10,11 Fewer positive samples were found where there was less patient interaction (eg, shared ward areas); 2.4% of samples from shared ward areas on the HSCTU and IIU were positive for NV or AV. Although the floor was most commonly positive, positive samples were also recovered from high hand-touch surfaces, including door handles and notes trolleys, in agreement with other investigations.5 NV GII was most frequently found on the HSCTU, whereas the IIU and HODU samples were more commonly positive for AV. All but 1 positive NV sample revealed RNA of GII, the strain most commonly associated with NV outbreaks.12 Environmental monitoring of viruses (and bacteria) that cause health careeassociated infection (HCAI) provides an indication of contamination, cleaning success, and identifies potential routes of infection transmission.3,6 Although finding organisms in the environment does not always equate to cases of HCAI, it does indicate that the environment can act as a potential reservoir. The data therefore emphasizes the importance of infection control policies,
1232
L. Pankhurst et al. / American Journal of Infection Control 42 (2014) 1229-32
including good hand hygiene practice, particularly before and after exiting both cubicles and shared ward areas, not eating within any ward areas, and not storing items on the floor. Routine environmental monitoring of AV and NV would allow identification of heavily contaminated areas where patient interaction with the environment is high. Monitoring schemes should also include day units, as indicated by the contamination found within this area and the associated risk of transmission between hospitals, communities, and vice versa. In conclusion, extensively distributed viral contamination has been shown to occur outside of the outbreak scenario. Infection control practices should take into account routine risk of viral infection transmission, and monitoring for viruses should be considered in the development of evidencebased infection control practice to prevent HCAI.
References 1. Al-Hamad A, Maxwell S. How clean is clean? Proposed methods for hospital cleaning assessment. J Hosp Infect 2008;70:328-34. 2. Dancer SJ. How do we assess hospital cleaning? A proposal for microbiological standards for surface hygiene in hospitals. J Hosp Infect 2004;56:10-5.
3. Carducci A, Verani M, Lombardi R, Casini B, Privitera G. Environmental survey to assess viral contamination of air and surfaces in hospital settings. J Hosp Infect 2011;77:242-7. 4. Foulongne V, Courgnaud V, Champeau W, Segondy M. Detection of Merkel cell polyomavirus on environmental surfaces. J Med Virol 2011;83:1435-9. 5. Gallimore CI, Taylor C, Gennery AR, Cant AJ, Galloway A, Iturriza-Gomara M, et al. Environmental monitoring for gastroenteric viruses in a pediatric primary immunodeficiency unit. J Clin Microbiol 2006;44:395-9. 6. Ganime AC, Carvalho-Costa FA, Mendonça MC, Vieira CB, Santos M, Costa Filho R, et al. Group A rotavirus detection on environmental surfaces in a hospital intensive care unit. Am J Infect Control 2012;40:544-7. 7. Heim A, Ebnet C, Harste G, Pring-Åkerblom P. Rapid and quantitative detection of human adenovirus DNA by real-time PCR. J Med Virol 2003;70: 228-39. 8. Kageyama T, Kojima S, Shinohara M, Uchida K, Fukushi S, Hoshino FB, et al. Broadly reactive and highly sensitive assay for Norwalk-like viruses based on real-time quantitative reverse transcription-PCR. J Clin Microbiol 2003;41: 1548-57. 9. Loisy F, Atmar RL, Guillon P, Le Cann P, Pommepuy M, Le Guyader FS. Real-time RT-PCR for norovirus screening in shellfish. J Virol Methods 2005;123:1-7. 10. Barker J, Vipond IB, Bloomfield SF. Effects of cleaning and disinfection in reducing the spread of norovirus contamination via environmental surfaces. J Hosp Infect 2004;58:42-9. 11. Vipond IB, Barker J, Bloomfield SF, Caul EO. Molecular epidemiology for detecting Norwalk-like viruses in clinical cases and associated environment contamination. J Hosp Infect 2002;50:237-8. 12. Glass RI, Parashar UD, Estes MK. Norovirus gastroenteritis. N Engl J Med 2009; 361:1776-85.
