Interventional Medicine & Applied Science, Vol. 8 (2), pp. 77–81 (2016)
ORIGINAL PAPER
Scaffold degradation during bone tissue reconstruction in Macaca nemestrina mandible ENDANG W. BACHTIAR1,*, LISA RINANDA AMIR1, PRADONO SUHARDI2, BASRIL ABAS3 1
Department of Oral Biology, Faculty of Dentistry and Oral Sciences Research Center, Universitas Indonesia, Jakarta, Indonesia 2 Department of Oral Surgery, Faculty of Dentistry, Universitas Indonesia, Jakarta, Indonesia 3
National Nuclear Energy Agency of Indonesia (BATAN), Jakarta, Indonesia
*Corresponding author: Endang W. Bachtiar; Department of Oral Biology, Faculty of Dentistry and Oral Sciences Research Center, Universitas Indonesia, Salemba Raya No. 4, Jakarta Pusat 10430, Indonesia; Phone: +62 21 31930355; Fax: +62 21 31930343; E-mails: [email protected], [email protected] (Received: January 6, 2016; Revised manuscript received: February 27, 2016; Accepted: April 8, 2016) Abstract: Objective: To examine the degradation of three scaffolds composed of hydroxyapatite/tricalcium phosphate (HA/TCP) with 70∶30 ratio, HA/TCP with 50∶50 ratio, and HA/TCP/chitosan scaffold as analyzed by the RNA expression of matrix metalloprotease 2 (MMP2), interleukin 13 (IL13), and tartrate-resistant acid phosphatase (TRAP) genes. Methods: The three tested scaffolds and dental pulp stromal cells (DPSCs) were transplanted into the mandibular bone defect of six young male Macaca nemestrina. Defect on the left mandible served as the experimental group and the right mandible served as control group (split mouth design). The biopsies were retrieved at 0, 2, and 4 weeks after cell-scaffold transplantation. The expression of MMP2, IL13, and TRAP was analyzed by real-time PCR (RT-PCR). Results: The inflammatory cells were still detected in areas where active bone and blood vessel formation occurred. The remnants of scaffold biomaterials were rarely seen. The expression of MMP2, IL13, and TRAP was observed in all samples. Their expressions were increased at week 4 and the decrease of TRAP gene expression in the experimental group was found higher than the control group. TRAP gene in the HA/TCP/chitosan group was found to be the highest at week 2 and lowest at week 4. Conclusions: Degradation of the scaffold did not induce higher inflammatory response compared to the control yet it induced more osteoclast activity. Keywords: chitosan, hydroxyapatite, tricalcium phosphate, scaffold, dental pulp stromal cells, degradation
drawbacks [2, 3]. These can be successfully applied for the treatment of a small-to-moderate-sized defect. Yet, the success of treatment of large bone defects with bone grafts remains a challenge and often results in a less than ideal outcome. The failings largely arise secondary to the inability of grafts to produce a regenerate that closely resembles lost tissue. As such, focus has shifted to the potential of mesenchymal stem cell-based skeletal tissue engineering. Scaffold materials facilitate the growth of mesenchymal stromal cells. Ideal scaffold should be biocompatible, biodegradable, and have a high surface area/volume ratio that could support the attachment, proliferation and differentiation of cells to develop the desired tissue [4, 5]. Chitosan is a natural polymer from renewable resources, obtained from shell of shellfish, and a waste product of the seafood industry. It has a good biocompatibility property and degradable by enzymes to become oligosaccharide that can be easily absorbed. It forms an insoluble
Introduction Bone defects are commonly found in maxillofacial and orthopedic surgery. Bone defects arise from a number of causes: by perturbed tissue development (e.g., alveolar cleft palate); inflammation caused by, e.g., microorganisms whereby the lipopolysaccharide component of bacteria cell membranes activates osteoclast activity to resorb bone; changes in mechanical loading such as after tooth loss and by surgery required for the removal of tumors [1]. The bone defects result in impaired bone function as lack of structural support. Treatment of bone reconstruction is, therefore, necessary to recreate the volume and density of the bone, thus maintaining normal bone function. Surgical techniques currently used for treating bone defects may count on different alternatives, including autologous bone grafts, homologous bone grafts, heterologous bone grafts (xenograft), or synthetic bone substitutes, each one of them has specific advantages or
This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium for non-commercial purposes, provided the original author and source are credited.
DOI: 10.1556/1646.8.2016.2.5
77
ISSN 2061-1617 © 2016 The Author(s)
Bachtiar et al.
Application of Isotope and Radiation Technology, Indonesia National Atomic Energy Agency.
complex with connective tissue such as collagen and glycosaminoglycans to become a porous interconnected 3D structure that makes this biomolecule suitable as a scaffolding material for tissue engineering purposes [6–8]. Hydroxyapatite (HA) and tricalcium phosphate (TCP) have been studied extensively due to their composition closely resembling the inorganic phase of bone tissue, their osteoconductive and biocompatible properties allowing their integration with the host bone [9]. Degradation of scaffolds is a crucial factor in designing an appropriate scaffold. Ideally, the scaffold construct provides mechanical and biochemical stability until the desired tissue regenerates, and subsequently followed by a complete degradation of the scaffold at a rate consistent with tissue generation [4, 5]. In bone tissue engineering, the temporary scaffold material must degrade in vivo in pace with new bone formation as not to compromise the mechanical stability of the construct prior to sufficient bony in-growth. We recently have shown the ability of scaffold composed of HA, TCP, and chitosan to facilitate the in vivo bone formation in the mandible of Macaca nemestrina after its transplantation with dental pulp stromal cells (DPSCs). However, it was not clear whether these materials could be degraded once the bone tissue already formed in the constructed areas. Therefore, the purpose of the present study was to evaluate the degradation of HA/TCP/chitosan scaffold in vivo. The expression of genes involved in the inflammatory response as well as in osteoclast activity was examined by real-time PCR (RT-PCR). Here, we evaluate the expression of matrix metalloprotease 2 (MMP2), interleukin 13 (IL13), and tartrate-resistant acid phosphatase (TRAP).
Dental pulp stromal cells (DPSCs) DPSCs were collected from six M. nemestrina upper and lower first incisive (12 teeth). Dental pulp tissues were removed from the root canal by extirpation needle, finely chopped with sterile scalpel followed by enzymatic degradation with collagenase I (Sigma, St. Louis, MO, USA) and dispase (Sigma, St. Louis, MO, USA) at 37 °C incubator with 5% CO2 for 1 hr. The tissue is dissociated by serial pipetting every 15–20 min. Cells were subsequently cultured at 37 °C incubator with 5% CO2 until they reached about 90% confluency. Ten million cells were prepared for cell sorting using fluorescence activating cell sorting with CD70, CD 90, and CD45 antibodies. The positive CD70, CD90, and negative CD45 cells indicated for DPSCs that were cultured in Dulbecco’s modified Eagle medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (Invitrogen, Carlsbad, CA, USA), 100 IU/ml penicillin, 100 μg/ml streptomycin (Invitrogen, Carlsbad, CA, USA), 250 μg fungizone (Invitrogen, Carlsbad, CA, USA), 10 nM dexamethasone (Invitrogen, Carlsbad, CA, USA), 100 μg ascorbic acid, and 100 mM β-glycerophosphate (Sigma, St. Louis, MO, USA). Three million DPSCs were used for cell-scaffold transplantation. Surgical procedure The in vivo experiment was performed in six M. nemestrina young adult males. Artificial bone defects were created in the right and left posterior mandible, inferior from the mesial part of first molar tooth area to distal of second premolar. The defect size was approximately 10 × 20 mm. DPSCs and the three tested scaffolds were transplanted into the bone defects in the right mandible whereby the bone defect in the left mandible was untreated and served as a control, representing the split mouth design. All animals were tolerated well with the treatment and were given antibiotic and analgesic for the course of 5 and 2 days, respectively. This procedure received ethical clearance from the Animal Care and Use Committee (ACUC No. 11-B005-IR) and was carried out in the Primate Research Center, Bogor Agricultural University, Indonesia.
Materials and Methods Scaffold preparation Three different scaffolds were used in this study: (a) biphasic calcium phosphate of HA/TCP 30∶70, (b) HA/TCP 50∶50, and (c) HA/TCP/chitosan. Chitosan is obtained by deacetylation of chitin, the structural element in the exoskeleton of shrimp with sodium hydroxide solution and precipitated by hydrochloric acid. HA and TCP are prepared by wet chemical method of calcium hydroxide, phosphoric acid and sodium phosphate, calcium nitrate, respectively. Scaffold premix solution was prepared by dissolving 6 g of chitosan in 10 ml of 3% acetic acid with 1% hydroxypropylmethylcellulose and 0.2 M phosphate solution for 2 hr. To remove the acid residue, scaffolds were soaked in 0.2 M NaOH (Sigma, St. Louis, MO, USA) for 4 hr, washed with distilled water and vacuum dried at 60 °C. All scaffolds were exposed to radiation sterilization of 25 kGy. This procedure was performed at the Center for
ISSN 2061-1617 © 2016 The Author(s)
Sample preparation Biopsies were retrieved with hollow trephone burr with an inner diameter of 0.2 mm at 0, 2, and 4 weeks after DPSC and scaffolds’ transplantation. Half of biopsies
78
Interventional Medicine & Applied Science
Scaffold degradation on bone tissue reconstruction
Table I
Primers used for real-time PCR
Primer IL13
Sequence (5′ to 3′)
Forward Reverse
ACAGCCCTCAGGGAGCTCAT GCTGTCAGGTTGATGCTCCAT
MMP2 Forward Reverse
CCAGACTTCCTCAGGCGGTGG TAGCGCCTCCATCGTAGCGC
TRAP Forward Reverse
CACAATCTGCAGTACCTGCAAGAT CCCATAGTGGAAGCGCAGATA Fig. 2.
were embedded in paraffin for histological analysis. The other half of biopsies were processed for gene expression analysis. Briefly, bone biopsies were homogenized with mortar, pestle, and liquid nitrogen, and centrifuged at 2000 rpm for 7 min. Trizol (Fermentas, ON, Canada) was used for RNA isolation. cDNA was synthesized using RevertAid First Strand cDNA Synthesis kit (Fermentas, ON, Canada). Sybr Green master mix (Bio-Rad, Hercules, CA, USA) was used for RT-PCR to detect the expression of IL13, MMP2, and TRAP (Table I).
present in a close vicinity to the inflammatory cells (Fig. 2). This finding was observed in all samples. The remnants of scaffold materials were rarely found in the samples. The expression of MMP2, IL13, and TRAP genes was examined in the baseline group prior to DPSC– scaffold transplantation and served to standardize the expression of the target genes at 2 and 4 weeks after the transplantation. The expression of MMP2 was increased at week 4 in all scaffold groups as well as in the control group (Fig. 3A, 3B). However, the MMP2 expression was lower in the HA/TCP 50∶50 and HA/TCP/chitosan group compared to the control untreated group (Fig. 3A), except in HA/TCP 70∶30 where the MMP2 expression was higher in the experimental group compared to the control group. The highest concentration of MMP2 was found in HA/TCP 70∶30 group at week 4. The expression of TRAP gene expressed by osteoclasts was varied between groups. In the HA/TCP group, TRAP expressed the highest at week 2 and decreased sharply at week 4 (Fig. 4A, 4B). On the contrary, in the control group, the expression of TRAP increased at week 4. The expression of IL13, one of the markers for inflammatory response, was increased at week 4 in all scaffold groups as well as in the control group. In all the three tested scaffolds, the expression of IL13 was lower compared to the control group. The highest concentration of IL13 was found in the HA/TCP 70∶30 group at
Results In vivo scaffold degradation was analyzed after 2 and 4 weeks of DPSCs and scaffold transplantation into the mandibular bone defect of M. nemestrina. During the experimental period, all animals remained in good condition, the healing of the surgical incisions healed well. Histological analysis showed the presence of inflammatory cells in the areas where active bone and blood vessel formation were detected, indicated by the osteoid formation (Fig. 1). Multi-nucleated cells were also
Fig. 1.
Multi-nucleated giant cells (arrows) were present in the close vicinity to the inflammatory cells
Interventional Medicine & Applied Science
Inflammatory cells surround the newly formed bone
Fig. 3.
79
The expression of MMP2 gene
ISSN 2061-1617 © 2016 The Author(s)
Bachtiar et al.
Fig. 4.
The expression of TRAP gene
Fig. 5.
The expression of IL13 gene
in the control group, highest TRAP expression was detected later at week 4. The degradation of calcium phosphate ceramic involved both in osteoclast activity and chemical dissolution process. In the highly soluble TCP ceramic in vivo, the physicochemical dissolution took place to a larger extent than osteoclastic resorption. Osteoclasts are thus clearly involved in calcium phosphate degradation by means of resorption and phagocytosis [10]. Our data revealed lower expression of MMP2 in the experimental group compared to the control group. While in the experimental group, its expression was increased at week 4. The effect of chitosan on matrix metalloproteinases has not been studied well. These enzymes are a family of secreted or transmembrane endopeptidases that share structural domains and degrade extracellular matrix components. Gelatinases such as MMP2 and 9 cleave collagen types IV and V. MMP transcripts are expressed at low concentrations that rise promptly, however, when tissues locally undergo remodeling events such as inflammation, wound healing, cancer, and arthritis [11].
week 4 (Fig. 5A, 5B). All RT-PCR data were normalized with GAPDH housekeeping genes.
Conclusions Inflammatory reactions were still detected at week 4 after DPSC and scaffold transplantation. Osteoclast activity marked by the expression of TRAP gene was upregulated compared to baseline prior to the expression. The histological analysis revealed no remnants of scaffold indicated that the scaffold might be degraded earlier before harvesting the biopsies. Therefore, it can be concluded that the majority of HA, TCP, and chitosan scaffolds used in this study have biodegraded as early as 4 weeks. The degradation involved more in osteoclast activity.
Discussion We recently have shown the in vivo bone formation after DPSC and HA/TCP and chitosan scaffold (manuscript in preparation). The ideal scaffold in tissue engineering should posses the ability to facilitate new bone formation and a good biodegradability [4, 5]. This study analyzed the in vivo degradation behavior of scaffold in mandibular bone of M. nemestrina. From the histological analysis, the inflammatory cells were still detected in the areas where new bone and blood vessel formed. The expression of IL13 RNA, one of the inflammatory markers, was also detected. Its increased expression in the ceramic group of HA/TCP was noticeable in week 2 and became more prominent in week 4 compared with the control group. On the contrary, IL13 expression was lower in the HA/TCP/chitosan group compared with the control group. Osteoclasts are cells accountable for bone mineral degradation, i.e., bone resorption. Previous studies have shown the mechanism of calcium phosphate ceramic degradation by osteoclasts in similar fashion to bone mineral degradation. Osteoclasts attach firmly to the substrate sealing zone. In the center of this sealing zone, they secrete H+ leading to a local pH value of 4–5. The osteoclast activity is usually determined by a specific osteoclastic enzyme (TRAP) [10]. We observed that the expression of TRAP RNA was found to be the highest at week 2 and lowest at week 4 in all tested scaffolds. While
ISSN 2061-1617 © 2016 The Author(s)
*** Funding sources: This study was financially supported by the Indonesian Ministry of Research and Technology (Grant No. RD 2011-3599) and Universitas Indonesia (Grant No. DRPM/R/385/RUUI/2012). Authors’ contribution: EWB contributed to study design, supervised the research study, and wrote the manuscript. LA contributed to animal experiment, histological and molecular assay, manuscript drafting, and critical discussion. PS contributed to animal experiment. BA contributed to scaffold preparation. Conflict of interest: None declared.
References 1. Pihlstrom BL, Michalowicz BS, Johnson NW: Periodontal diseases. Lancet 366, 1809–1820 (2005) 2. Arrington ED, Smith WJ, Chambers HG, Bucknell AL, Davino NA: Complications of iliac crest bone graft harvesting. Clin Orthoped 329, 300–309 (1996)
80
Interventional Medicine & Applied Science
Scaffold degradation on bone tissue reconstruction
3. Younger EM, Chapman MW: Morbidity at bone graft donor sites. J Orthop Trauma 3, 192–195 (1989) 4. Yang S, Leong KF, Du Z, Chua CK: The design of scaffolds for use in tissue engineering. Part I. Traditional factors. Tissue Eng J 7, 679–689 (2001) 5. Howard D, Buttery LD, Shakesheff KM, Roberts SJ: Tissue engineering: Strategies, stem cells and scaffolds. J Anat 213, 66–72 (2008) 6. Matsunaga T, Yanagiguchi K, Yamada S, Ohara N, Ikeda T, Hayashi Y: Chitosan monomer promotes tissue regeneration on dental pulp wounds. J Biomed Mater Res A 76, 711–720 (2006) 7. Mi FL, Huang CT, Liang HF, Chen MC, Chiu YL, Chen CH, Sung HW: Physicochemical, antimicrobial, and cytotoxic characteristics of a chitosan film cross-linked by naturally occurring
Interventional Medicine & Applied Science
8.
9. 10.
11.
81
cross-linking agent, aglycone geniposidic acid. J Agric Food Chem 54, 3290–3296 (2006) Yamada S, Ganno T, Ohara N, Hayashi Y: Chitosan monomer accelerates alkaline phosphates activity on human osteoblastic cells under hypofunctional conditions. J Biomed Mater Res A 83, 290–295 (2007) LeGeros RZ: Properties of osteoconductive biomaterials: Calcium phosphates. Clin Orthop Relat Res 395, 81–98 (2002) Zerbo IR, Bronckers AL, de Lange G, Burge EH: Localisation of osteogenic and osteoclastic cells in porous beta-tricalcium phosphate particles used for human maxillary sinus floor elevation. Biomaterials 26, 1445–1451 (2005) Muzzarelli RAA: Chitins and chitosans for the repair of wounded skin, nerve, cartilage and bone. Carbohydr Polym 76, 167–182 (2009)
ISSN 2061-1617 © 2016 The Author(s)
ORIGINAL PAPER
Scaffold degradation during bone tissue reconstruction in Macaca nemestrina mandible ENDANG W. BACHTIAR1,*, LISA RINANDA AMIR1, PRADONO SUHARDI2, BASRIL ABAS3 1
Department of Oral Biology, Faculty of Dentistry and Oral Sciences Research Center, Universitas Indonesia, Jakarta, Indonesia 2 Department of Oral Surgery, Faculty of Dentistry, Universitas Indonesia, Jakarta, Indonesia 3
National Nuclear Energy Agency of Indonesia (BATAN), Jakarta, Indonesia
*Corresponding author: Endang W. Bachtiar; Department of Oral Biology, Faculty of Dentistry and Oral Sciences Research Center, Universitas Indonesia, Salemba Raya No. 4, Jakarta Pusat 10430, Indonesia; Phone: +62 21 31930355; Fax: +62 21 31930343; E-mails: [email protected], [email protected] (Received: January 6, 2016; Revised manuscript received: February 27, 2016; Accepted: April 8, 2016) Abstract: Objective: To examine the degradation of three scaffolds composed of hydroxyapatite/tricalcium phosphate (HA/TCP) with 70∶30 ratio, HA/TCP with 50∶50 ratio, and HA/TCP/chitosan scaffold as analyzed by the RNA expression of matrix metalloprotease 2 (MMP2), interleukin 13 (IL13), and tartrate-resistant acid phosphatase (TRAP) genes. Methods: The three tested scaffolds and dental pulp stromal cells (DPSCs) were transplanted into the mandibular bone defect of six young male Macaca nemestrina. Defect on the left mandible served as the experimental group and the right mandible served as control group (split mouth design). The biopsies were retrieved at 0, 2, and 4 weeks after cell-scaffold transplantation. The expression of MMP2, IL13, and TRAP was analyzed by real-time PCR (RT-PCR). Results: The inflammatory cells were still detected in areas where active bone and blood vessel formation occurred. The remnants of scaffold biomaterials were rarely seen. The expression of MMP2, IL13, and TRAP was observed in all samples. Their expressions were increased at week 4 and the decrease of TRAP gene expression in the experimental group was found higher than the control group. TRAP gene in the HA/TCP/chitosan group was found to be the highest at week 2 and lowest at week 4. Conclusions: Degradation of the scaffold did not induce higher inflammatory response compared to the control yet it induced more osteoclast activity. Keywords: chitosan, hydroxyapatite, tricalcium phosphate, scaffold, dental pulp stromal cells, degradation
drawbacks [2, 3]. These can be successfully applied for the treatment of a small-to-moderate-sized defect. Yet, the success of treatment of large bone defects with bone grafts remains a challenge and often results in a less than ideal outcome. The failings largely arise secondary to the inability of grafts to produce a regenerate that closely resembles lost tissue. As such, focus has shifted to the potential of mesenchymal stem cell-based skeletal tissue engineering. Scaffold materials facilitate the growth of mesenchymal stromal cells. Ideal scaffold should be biocompatible, biodegradable, and have a high surface area/volume ratio that could support the attachment, proliferation and differentiation of cells to develop the desired tissue [4, 5]. Chitosan is a natural polymer from renewable resources, obtained from shell of shellfish, and a waste product of the seafood industry. It has a good biocompatibility property and degradable by enzymes to become oligosaccharide that can be easily absorbed. It forms an insoluble
Introduction Bone defects are commonly found in maxillofacial and orthopedic surgery. Bone defects arise from a number of causes: by perturbed tissue development (e.g., alveolar cleft palate); inflammation caused by, e.g., microorganisms whereby the lipopolysaccharide component of bacteria cell membranes activates osteoclast activity to resorb bone; changes in mechanical loading such as after tooth loss and by surgery required for the removal of tumors [1]. The bone defects result in impaired bone function as lack of structural support. Treatment of bone reconstruction is, therefore, necessary to recreate the volume and density of the bone, thus maintaining normal bone function. Surgical techniques currently used for treating bone defects may count on different alternatives, including autologous bone grafts, homologous bone grafts, heterologous bone grafts (xenograft), or synthetic bone substitutes, each one of them has specific advantages or
This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium for non-commercial purposes, provided the original author and source are credited.
DOI: 10.1556/1646.8.2016.2.5
77
ISSN 2061-1617 © 2016 The Author(s)
Bachtiar et al.
Application of Isotope and Radiation Technology, Indonesia National Atomic Energy Agency.
complex with connective tissue such as collagen and glycosaminoglycans to become a porous interconnected 3D structure that makes this biomolecule suitable as a scaffolding material for tissue engineering purposes [6–8]. Hydroxyapatite (HA) and tricalcium phosphate (TCP) have been studied extensively due to their composition closely resembling the inorganic phase of bone tissue, their osteoconductive and biocompatible properties allowing their integration with the host bone [9]. Degradation of scaffolds is a crucial factor in designing an appropriate scaffold. Ideally, the scaffold construct provides mechanical and biochemical stability until the desired tissue regenerates, and subsequently followed by a complete degradation of the scaffold at a rate consistent with tissue generation [4, 5]. In bone tissue engineering, the temporary scaffold material must degrade in vivo in pace with new bone formation as not to compromise the mechanical stability of the construct prior to sufficient bony in-growth. We recently have shown the ability of scaffold composed of HA, TCP, and chitosan to facilitate the in vivo bone formation in the mandible of Macaca nemestrina after its transplantation with dental pulp stromal cells (DPSCs). However, it was not clear whether these materials could be degraded once the bone tissue already formed in the constructed areas. Therefore, the purpose of the present study was to evaluate the degradation of HA/TCP/chitosan scaffold in vivo. The expression of genes involved in the inflammatory response as well as in osteoclast activity was examined by real-time PCR (RT-PCR). Here, we evaluate the expression of matrix metalloprotease 2 (MMP2), interleukin 13 (IL13), and tartrate-resistant acid phosphatase (TRAP).
Dental pulp stromal cells (DPSCs) DPSCs were collected from six M. nemestrina upper and lower first incisive (12 teeth). Dental pulp tissues were removed from the root canal by extirpation needle, finely chopped with sterile scalpel followed by enzymatic degradation with collagenase I (Sigma, St. Louis, MO, USA) and dispase (Sigma, St. Louis, MO, USA) at 37 °C incubator with 5% CO2 for 1 hr. The tissue is dissociated by serial pipetting every 15–20 min. Cells were subsequently cultured at 37 °C incubator with 5% CO2 until they reached about 90% confluency. Ten million cells were prepared for cell sorting using fluorescence activating cell sorting with CD70, CD 90, and CD45 antibodies. The positive CD70, CD90, and negative CD45 cells indicated for DPSCs that were cultured in Dulbecco’s modified Eagle medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (Invitrogen, Carlsbad, CA, USA), 100 IU/ml penicillin, 100 μg/ml streptomycin (Invitrogen, Carlsbad, CA, USA), 250 μg fungizone (Invitrogen, Carlsbad, CA, USA), 10 nM dexamethasone (Invitrogen, Carlsbad, CA, USA), 100 μg ascorbic acid, and 100 mM β-glycerophosphate (Sigma, St. Louis, MO, USA). Three million DPSCs were used for cell-scaffold transplantation. Surgical procedure The in vivo experiment was performed in six M. nemestrina young adult males. Artificial bone defects were created in the right and left posterior mandible, inferior from the mesial part of first molar tooth area to distal of second premolar. The defect size was approximately 10 × 20 mm. DPSCs and the three tested scaffolds were transplanted into the bone defects in the right mandible whereby the bone defect in the left mandible was untreated and served as a control, representing the split mouth design. All animals were tolerated well with the treatment and were given antibiotic and analgesic for the course of 5 and 2 days, respectively. This procedure received ethical clearance from the Animal Care and Use Committee (ACUC No. 11-B005-IR) and was carried out in the Primate Research Center, Bogor Agricultural University, Indonesia.
Materials and Methods Scaffold preparation Three different scaffolds were used in this study: (a) biphasic calcium phosphate of HA/TCP 30∶70, (b) HA/TCP 50∶50, and (c) HA/TCP/chitosan. Chitosan is obtained by deacetylation of chitin, the structural element in the exoskeleton of shrimp with sodium hydroxide solution and precipitated by hydrochloric acid. HA and TCP are prepared by wet chemical method of calcium hydroxide, phosphoric acid and sodium phosphate, calcium nitrate, respectively. Scaffold premix solution was prepared by dissolving 6 g of chitosan in 10 ml of 3% acetic acid with 1% hydroxypropylmethylcellulose and 0.2 M phosphate solution for 2 hr. To remove the acid residue, scaffolds were soaked in 0.2 M NaOH (Sigma, St. Louis, MO, USA) for 4 hr, washed with distilled water and vacuum dried at 60 °C. All scaffolds were exposed to radiation sterilization of 25 kGy. This procedure was performed at the Center for
ISSN 2061-1617 © 2016 The Author(s)
Sample preparation Biopsies were retrieved with hollow trephone burr with an inner diameter of 0.2 mm at 0, 2, and 4 weeks after DPSC and scaffolds’ transplantation. Half of biopsies
78
Interventional Medicine & Applied Science
Scaffold degradation on bone tissue reconstruction
Table I
Primers used for real-time PCR
Primer IL13
Sequence (5′ to 3′)
Forward Reverse
ACAGCCCTCAGGGAGCTCAT GCTGTCAGGTTGATGCTCCAT
MMP2 Forward Reverse
CCAGACTTCCTCAGGCGGTGG TAGCGCCTCCATCGTAGCGC
TRAP Forward Reverse
CACAATCTGCAGTACCTGCAAGAT CCCATAGTGGAAGCGCAGATA Fig. 2.
were embedded in paraffin for histological analysis. The other half of biopsies were processed for gene expression analysis. Briefly, bone biopsies were homogenized with mortar, pestle, and liquid nitrogen, and centrifuged at 2000 rpm for 7 min. Trizol (Fermentas, ON, Canada) was used for RNA isolation. cDNA was synthesized using RevertAid First Strand cDNA Synthesis kit (Fermentas, ON, Canada). Sybr Green master mix (Bio-Rad, Hercules, CA, USA) was used for RT-PCR to detect the expression of IL13, MMP2, and TRAP (Table I).
present in a close vicinity to the inflammatory cells (Fig. 2). This finding was observed in all samples. The remnants of scaffold materials were rarely found in the samples. The expression of MMP2, IL13, and TRAP genes was examined in the baseline group prior to DPSC– scaffold transplantation and served to standardize the expression of the target genes at 2 and 4 weeks after the transplantation. The expression of MMP2 was increased at week 4 in all scaffold groups as well as in the control group (Fig. 3A, 3B). However, the MMP2 expression was lower in the HA/TCP 50∶50 and HA/TCP/chitosan group compared to the control untreated group (Fig. 3A), except in HA/TCP 70∶30 where the MMP2 expression was higher in the experimental group compared to the control group. The highest concentration of MMP2 was found in HA/TCP 70∶30 group at week 4. The expression of TRAP gene expressed by osteoclasts was varied between groups. In the HA/TCP group, TRAP expressed the highest at week 2 and decreased sharply at week 4 (Fig. 4A, 4B). On the contrary, in the control group, the expression of TRAP increased at week 4. The expression of IL13, one of the markers for inflammatory response, was increased at week 4 in all scaffold groups as well as in the control group. In all the three tested scaffolds, the expression of IL13 was lower compared to the control group. The highest concentration of IL13 was found in the HA/TCP 70∶30 group at
Results In vivo scaffold degradation was analyzed after 2 and 4 weeks of DPSCs and scaffold transplantation into the mandibular bone defect of M. nemestrina. During the experimental period, all animals remained in good condition, the healing of the surgical incisions healed well. Histological analysis showed the presence of inflammatory cells in the areas where active bone and blood vessel formation were detected, indicated by the osteoid formation (Fig. 1). Multi-nucleated cells were also
Fig. 1.
Multi-nucleated giant cells (arrows) were present in the close vicinity to the inflammatory cells
Interventional Medicine & Applied Science
Inflammatory cells surround the newly formed bone
Fig. 3.
79
The expression of MMP2 gene
ISSN 2061-1617 © 2016 The Author(s)
Bachtiar et al.
Fig. 4.
The expression of TRAP gene
Fig. 5.
The expression of IL13 gene
in the control group, highest TRAP expression was detected later at week 4. The degradation of calcium phosphate ceramic involved both in osteoclast activity and chemical dissolution process. In the highly soluble TCP ceramic in vivo, the physicochemical dissolution took place to a larger extent than osteoclastic resorption. Osteoclasts are thus clearly involved in calcium phosphate degradation by means of resorption and phagocytosis [10]. Our data revealed lower expression of MMP2 in the experimental group compared to the control group. While in the experimental group, its expression was increased at week 4. The effect of chitosan on matrix metalloproteinases has not been studied well. These enzymes are a family of secreted or transmembrane endopeptidases that share structural domains and degrade extracellular matrix components. Gelatinases such as MMP2 and 9 cleave collagen types IV and V. MMP transcripts are expressed at low concentrations that rise promptly, however, when tissues locally undergo remodeling events such as inflammation, wound healing, cancer, and arthritis [11].
week 4 (Fig. 5A, 5B). All RT-PCR data were normalized with GAPDH housekeeping genes.
Conclusions Inflammatory reactions were still detected at week 4 after DPSC and scaffold transplantation. Osteoclast activity marked by the expression of TRAP gene was upregulated compared to baseline prior to the expression. The histological analysis revealed no remnants of scaffold indicated that the scaffold might be degraded earlier before harvesting the biopsies. Therefore, it can be concluded that the majority of HA, TCP, and chitosan scaffolds used in this study have biodegraded as early as 4 weeks. The degradation involved more in osteoclast activity.
Discussion We recently have shown the in vivo bone formation after DPSC and HA/TCP and chitosan scaffold (manuscript in preparation). The ideal scaffold in tissue engineering should posses the ability to facilitate new bone formation and a good biodegradability [4, 5]. This study analyzed the in vivo degradation behavior of scaffold in mandibular bone of M. nemestrina. From the histological analysis, the inflammatory cells were still detected in the areas where new bone and blood vessel formed. The expression of IL13 RNA, one of the inflammatory markers, was also detected. Its increased expression in the ceramic group of HA/TCP was noticeable in week 2 and became more prominent in week 4 compared with the control group. On the contrary, IL13 expression was lower in the HA/TCP/chitosan group compared with the control group. Osteoclasts are cells accountable for bone mineral degradation, i.e., bone resorption. Previous studies have shown the mechanism of calcium phosphate ceramic degradation by osteoclasts in similar fashion to bone mineral degradation. Osteoclasts attach firmly to the substrate sealing zone. In the center of this sealing zone, they secrete H+ leading to a local pH value of 4–5. The osteoclast activity is usually determined by a specific osteoclastic enzyme (TRAP) [10]. We observed that the expression of TRAP RNA was found to be the highest at week 2 and lowest at week 4 in all tested scaffolds. While
ISSN 2061-1617 © 2016 The Author(s)
*** Funding sources: This study was financially supported by the Indonesian Ministry of Research and Technology (Grant No. RD 2011-3599) and Universitas Indonesia (Grant No. DRPM/R/385/RUUI/2012). Authors’ contribution: EWB contributed to study design, supervised the research study, and wrote the manuscript. LA contributed to animal experiment, histological and molecular assay, manuscript drafting, and critical discussion. PS contributed to animal experiment. BA contributed to scaffold preparation. Conflict of interest: None declared.
References 1. Pihlstrom BL, Michalowicz BS, Johnson NW: Periodontal diseases. Lancet 366, 1809–1820 (2005) 2. Arrington ED, Smith WJ, Chambers HG, Bucknell AL, Davino NA: Complications of iliac crest bone graft harvesting. Clin Orthoped 329, 300–309 (1996)
80
Interventional Medicine & Applied Science
Scaffold degradation on bone tissue reconstruction
3. Younger EM, Chapman MW: Morbidity at bone graft donor sites. J Orthop Trauma 3, 192–195 (1989) 4. Yang S, Leong KF, Du Z, Chua CK: The design of scaffolds for use in tissue engineering. Part I. Traditional factors. Tissue Eng J 7, 679–689 (2001) 5. Howard D, Buttery LD, Shakesheff KM, Roberts SJ: Tissue engineering: Strategies, stem cells and scaffolds. J Anat 213, 66–72 (2008) 6. Matsunaga T, Yanagiguchi K, Yamada S, Ohara N, Ikeda T, Hayashi Y: Chitosan monomer promotes tissue regeneration on dental pulp wounds. J Biomed Mater Res A 76, 711–720 (2006) 7. Mi FL, Huang CT, Liang HF, Chen MC, Chiu YL, Chen CH, Sung HW: Physicochemical, antimicrobial, and cytotoxic characteristics of a chitosan film cross-linked by naturally occurring
Interventional Medicine & Applied Science
8.
9. 10.
11.
81
cross-linking agent, aglycone geniposidic acid. J Agric Food Chem 54, 3290–3296 (2006) Yamada S, Ganno T, Ohara N, Hayashi Y: Chitosan monomer accelerates alkaline phosphates activity on human osteoblastic cells under hypofunctional conditions. J Biomed Mater Res A 83, 290–295 (2007) LeGeros RZ: Properties of osteoconductive biomaterials: Calcium phosphates. Clin Orthop Relat Res 395, 81–98 (2002) Zerbo IR, Bronckers AL, de Lange G, Burge EH: Localisation of osteogenic and osteoclastic cells in porous beta-tricalcium phosphate particles used for human maxillary sinus floor elevation. Biomaterials 26, 1445–1451 (2005) Muzzarelli RAA: Chitins and chitosans for the repair of wounded skin, nerve, cartilage and bone. Carbohydr Polym 76, 167–182 (2009)
ISSN 2061-1617 © 2016 The Author(s)
