Developmental and Comparative Immunology 51 (2015) 10–21

Contents lists available at ScienceDirect

Developmental and Comparative Immunology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / d c i

Scavenger receptor B protects shrimp from bacteria by enhancing phagocytosis and regulating expression of antimicrobial peptides Wen-Jie Bi a,1, Dian-Xiang Li b,1, Yi-Hui Xu a, Sen Xu a, Jing Li a, Xiao-Fan Zhao a, Jin-Xing Wang a,* a b

Shandong Provincial Key Laboratory of Animal Cells and Developmental Biology, School of Life Sciences, Shandong University, Jinan 250100, China Biotechnology Department, School of Biological Sciences and Biotechnology, University of Jinan, Jinan 250022, China

A R T I C L E

I N F O

Article history: Received 29 December 2014 Revised 4 February 2015 Accepted 5 February 2015 Available online 16 February 2015 Keywords: Scavenger receptors Phagocytosis Innate immunity Marsupenaeus japonicus Bacteria

A B S T R A C T

Scavenger receptors (SRs) are involved in innate immunity through recognizing pathogen-associated molecular patterns (PAMPs) and in pathogenesis of diseases through interactions with damage-associated molecular patterns (DAMPs). The roles of SRs in invertebrate innate immunity still need to be elucidated. Here we identify a class B scavenger receptor from kuruma shrimp, Marsupenaeus japonicus, designated MjSR-B1. The recombinant MjSR-B1 agglutinated bacteria in a calcium dependent manner and bound lipopolysaccharide and lipoteichoic acid. After knockdown of MjSR-B1, both the bacterial clearance and phagocytotic ability of M. japonicus against V. anguillarum and S. aureus were impaired, and several phagocytosis related genes were downregulated. The expression levels of antimicrobial peptides were also downregulated. Overexpression of MjSR-B1 led to enhanced bacterial clearance, phagocytosis rate and upregulation of phagocytosis-related and antimicrobial peptide genes. However, overexpression of mutant MjSR-B1ΔC, which lacks the carboxyl tail of MjSR-B1, had none of these effects. Our results indicate that MjSR-B1 can protect shrimp from bacteria by promoting phagocytosis and by enhancing the expression of antimicrobial peptides. © 2015 Elsevier Ltd. All rights reserved.

1. Introduction A variety of pattern recognition receptors (PRRs) have been identified, including cytoplasmic proteins such as NOD-like receptors (NLRs) and the Retinoic acid-inducible gene (RIG)-I-like receptors (RLRs), and transmembrane proteins such as the Toll-like receptors (TLRs), C-type lectin receptors (CLRs) and scavenger receptors (SRs) (Pluddemann et al., 2011). More than 11 types of pattern recognition receptors have been identified in shrimp (Wang and Wang, 2013). These PRRs are involved in innate immunity by recognition of pathogen-associated molecular patterns (PAMPs), which are conserved structures among microbial species (Janeway and Medzhitov, 2002). Among PRRs, the scavenger receptor was first defined by Goldstein and Brown in 1979 by its ability to bind to and internalize oxidized low-density lipoprotein (oxLDL) (Brown et al., 1979). SRs comprise a large family of transmembrane cell surface glycoproteins that can bind modified low-density lipoproteins (LDLs), multiple polyanionic ligands and cell wall components (Canton et al., 2013; Wang and Wang, 2013). In recent years, many scavenger receptors

* Corresponding author. School of Life Sciences, Shandong University, Jinan, Shandong 250100, China. Tel.: +86 531 88364620; fax: +86 531 88364620. E-mail address: [email protected] (J.-X. Wang). 1 Equal contributions to this work. http://dx.doi.org/10.1016/j.dci.2015.02.001 0145-305X/© 2015 Elsevier Ltd. All rights reserved.

have been discovered and the definition has been broadened to eight different classes (A–H) (Canton et al., 2013). At the same time, the emphasis of SR research has broadened from their roles in lipid metabolism-relevant disorders (Pluddemann et al., 2007) and in host defense against pathogens in innate immunity (Canton et al., 2013). SRs have dual cellular roles: they are PRRs of the immune system, resulting in removal of bacteria by recognition of PAMPs, and also ‘scavengers’ of apoptotic cells and cellular debris by recognizing damage-associated molecular patterns (DAMPs). A working definition was recently proposed in a workshop: SRs are cell surface receptors that typically bind multiple ligands and promote the removal of non-self or altered self-targets. They often function by mechanisms that include endocytosis, phagocytosis, adhesion, and signaling, that ultimately lead to the elimination of degraded or harmful substances (Prabhudas et al., 2014). Class B scavenger receptors (SR-Bs), such as SR-BI, SR-BII, CD36 and LIMP2 in mammals, have two transmembrane domains flanking an extracellular loop, with both the amino- and carboxyltermini located in the cytoplasm (Neculai et al., 2013). SR-Bs mainly distribute in macrophages, microglia, the microvascular endothelium, and platelets in vertebrates. Through binding to different ligands (DAMPs or PAMPs), CD36, a member of the SR-B family, participates in diverse processes, including angiogenesis, atherosclerosis, metabolism, and sensory perception (Stuart et al., 2005). Furthermore, like other scavenger receptors, SR-Bs form signalosomes,

W.-J. Bi et al./Developmental and Comparative Immunology 51 (2015) 10–21

components of heteromultimeric signaling complexes, with numerous transmembrane receptors, such as TLRs, integrins and tetraspanins, to participate in host defense against pathogens (Sharif et al., 2013). According to research on CD36 deficient mice and human HEK293 cell lines, CD36 may mediate bacterial recognition, phagocytosis and initiate signal transduction though interaction with TLR2/6 when challenged by various ligands or bacteria, including Gram-positive and Gram-negative bacteria (Baranova et al., 2008, 2012; Sharif et al., 2013; Triantafilou et al., 2006; Vishnyakova et al., 2006). CD36 also cooperates with a TLR4/6 heterodimer, but this occurs following sterile inflammation, such as that mediated by OxLDL not by PAMPs (Stewart et al., 2010). It has been reported that the C-terminal region of SR-Bs functions as a docking site for signal transduction (Rahaman et al., 2006), and a nonsense mutation of CD36 which removed 133 residues at the carboxylterminus of the polypeptide chain in mice blocked the signal transduction and led to immunodeficiency (Hoebe et al., 2005). SR-Bs have also been reported in invertebrates. Several SR-B genes were identified in Drosophila melanogaster and Anopheles gambiae (Christophides et al., 2004). Drosophila CD36 paralog Croquemort, a class B member of the SR family, is one of the best characterized SRs in D. melanogaster. Croquemort is a macrophage receptor that recognizes apoptotic cells (Franc et al., 1996). It can also act as a phagocytic receptor of Gram-positive bacteria (Areschoug and Gordon, 2009; Stuart et al., 2005). A Croquemort homolog, MjCroquemort, the only SR family member identified so far in shrimp, was reported in Marsupenaeus japonicus. The tissue distribution and expression patterns of MjCroquemort were analyzed (Mekata et al., 2011), but the function of Croquemort in shrimp needs to be clarified. In this work, we describe identification of a new member of the SR-B family in kuruma shrimp M. japonicus, designated MjSR-B1. Its expression was upregulated by Gram-positive and Gram–negative bacterial challenges. In vitro experiments indicated that MjSR-B1 could bind to and agglutinate both Gram-positive and Gramnegative bacteria. RNA interference of MjSR-B1 impaired the clearance of bacteria, reduced the phagocytotic rate of shrimp hemocytes and decreased the expression level of phagocytosis related and antimicrobial peptide (AMP) genes. Moreover, overexpression of MjSRB1 facilitated the clearance of bacteria, enhanced the phagocytotic rate and increased the expression level of phagocytosis related genes and AMP genes. Hence we report, for the first time to our knowledge, that MjSR-B1 is a phagocytic receptor both of Gram-positive and Gram-negative bacteria and the receptor can regulate expression of antimicrobial peptides in shrimp. 2. Materials and methods 2.1. Reagents and microorganisms Peptidoglycan (PG) and lipoteichoic acid (LTA) from Staphylococcus aureus and lipopolysaccharide (LPS) from Escherichia coli 055:B5 were purchased from Sigma (St. Louis, MO, USA). E. coli and Vibrio anguillarum were maintained in our laboratory. Bacillus subtilis, B. megaterum, B. thuringiensis, S. aureus, Klebsiella pneumoniae and Pseudomonas aeruginosa were gifts from Shandong Agricultural University. 2.2. Bacterial challenge and tissue collection Shrimp M. japonicus (individuals weighing 10–15 g) were obtained from an aquatic product market in Jinan, Shandong Province, China, nurtured in sea water at 21 °C in laboratory tanks and fed with commercial food. For bacterial challenge experiments, each shrimp was injected abdominally with 20 μl of S. aureus (2 × 107 CFU) or V. anguillarum (2 × 107 CFU) by using a microliter syringe (Wang

11

et al., 2009). For negative controls, another group of shrimp was injected with the same volume of phosphate-buffered saline (PBS; 140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.8 mM KH2PO4, pH 7.4). Hemolymph was extracted from the ventral sinus using a syringe with a 1/10th volume of 10% sodium citrate as anticoagulant buffer, and then immediately centrifuged at 800 × g for 15 min at 4 °C to isolate the hemocytes. Then, other tissues, including heart, hepatopancreas, gills, stomach and intestine were also extracted. Three shrimp were chosen for each experiment in case of individual differences.

2.3. Gene cloning of MjSR-B1 Total RNA (5 μg) was isolated from hemocytes and other tissues of shrimp with Unizol reagent (Biostar, China) and used for reverse transcription of cDNA. cDNA was synthesized according to the instructions of the SMART cDNA kit (BD Bioscience Clontech, USA), using the primers Oligo-anchor R and Smart F (Table 1). The cDNA was diluted 10-fold and then used as the template for PCR analysis. The full length of MjSR-B1 was amplified with specific primers (MjSR-B1exF and MjSR-B1exR), which were designed based on the unigene from the hemocyte transcriptome sequence of M. japonicus (Table 1).

2.4. Semi-quantitative RT-PCR and quantitative real-time RT-PCR (qRT-PCR) The tissue distribution of MjSR-B1 was determined by qRT-PCR with primers MjSR-B1 rtF and MjSR-B1rtR (Table 1). Actin F and actin R (Table 1) were used to amplify β-actin as the internal control. The qRT-PCR was performed as follows: 1 cycle at 95 °C for 10 min, 40 cycles at 95 °C for 15 s and 60 °C for 1 min, and then read at 78 °C for 2 s. The comparative CT method (2−ΔΔCT method) was used to analyze the expression pattern. The discrepancy between the CT of MjSR-B1 and β-actin was calculated to normalize the variation in the amount of cDNA in each reaction. The hemocytes collected from 0, 2, 6, 12, 24 and 48 h post V. anguillarum or S. aureus challenged shrimp were used for expression pattern analysis of MjSR-B1 by qRTPCR with primers MjSR-B1 rtF and MjSR-B1 rtR. Data were analyzed by the unpaired t-test and significant difference was accepted at p < 0.05.

2.5. Recombinant expression and purification of the extracellular region of MjSR-B1 A pair of primers (MjSR-B1exnomF and MjSR-B1exnomR) (Table 1) were designed on the basis of the full-length sequence of MjSR-B1 cDNA to amplify the fragment that encodes the extracellular region of MjSR-B1. The fragment was digested with restriction enzymes EcoRI and XhoI and then subcloned into the pET-32a(+) plasmid. The recombinant vector was transformed into competent E. coli Rosetta cells for protein expression. The recombinant protein was expressed in inclusion bodies and purified using following method: Briefly, the inclusion bodies were washed twice with 10 ml buffer A (50 mM Tris–HCl, 5 mM EDTA, pH 8.0), and then washed twice with 10 ml buffer B (50 mM Tris–HCl, 5 mM EDTA, 2 M urea, pH 8.0). Subsequently, the inclusion bodies were dissolved in 10 ml buffer C (50 mM Tris–HCl, 5 mM EDTA, 8 M urea, pH 8.0). The protein was refolded through dialyzed in 1 l dialysate solution (50 mM NaCl, 5 mM cysteine, 50 mM Tris–HCl, pH 8.0) for three times (4 °C, 16 h). The solution was then purified with His Bind resin chromatography (Novagen) according to the manufacturer’s instruction.

12

W.-J. Bi et al./Developmental and Comparative Immunology 51 (2015) 10–21

Table 1 Sequences of primers used in this study. Primer Primers for reverse transcription SMART F Oligo anchor R Primers for real-time quantitative PCR β-Actin rtF β-Actin rtR MjSR-B1rtF MjSR-B1rtR Myosin rtF Myosin rtR Rab5 rtF Rab5 rtR Lamp1 rtF Lamp1 rtR Arp rtF Arp rtR Cru-I1 rtF Cru-I1 rtR Cru-I2 rtF Cru-I2 rtR Cru-I3 rtF Cru-I3 rtR Cru-I4 rtF Cru-I4 rtR Alf-A1 rtF Alf-A1 rtR Alf-B1 rtF Alf-B1 rtR Alf-D1 rtF Alf-D1 rtR Alf-E1 rtF Alf-E1 rtR Primers for protein expression MjSR-B1 exF MjSR-B1 exR MjSR-B1nomexF MjSR-B1nomexR Primers for RNA interference dsMjSR-B1 F dsMjSR-B1 R dsGFP F dsGFP R Primers for overexpression MjSR-B1 overexF MjSR-B1 overexR MjSR-B1ΔC overexR

Sequence (5′–3′)

TACGGCTGCGAGAAGACGACAGAAGGG GACCACGCGTATCGATGTCGACT16(A/C/G)

GCATCATTCTCCATGTCGTCCCAGT TACGGCTGCGAGAAGACGACAGAA TGCCCACCTCACAAACTCAC GCACACAACGCATCACACTT GTTGAGGTCGGACTTGG TGACAACCAGGACACCC TTCCTCCCGTCACTCCAAG AGCCGTGTCCCAAATCTCA TTTTTGGGGGGGAGGGTA TGACACTCTGGAATCATTGCTTG TCAGGAAGAACGACTGGGGT TGTGGATTTGAGGCGAGGTA TGATTCAACCGCAGCCTACA CAGCACTTCTGGTGGGACG GCGTTTTCGTCTTCGTCCTG AATGATTGGTGGTTTCACGGTAG CAAGCCCTCCACCACTCTCG TTCCTGGGTTGCGGTCACA TGCGAAACAGACAGGGATTGC CCGAAGACCAGATGACCGAAA CTGGTCGGTTTCCTGGTGGC CCAACCTGGGCACCACATACTG CGGTGGTGGCCCTGGTGGCACTCTTCG GACTGGCTGCGTGTGCTGGCTTCCCCTC GCTTTTTATTTTGGGGGTCACGCTGT CTTTGGCGTGGAACAAGGTAGAGGAT TCCTAACCACGCAGTGCTTTGCTAATG GCTTTTCGGATTTGCCTTCGATGTTTG

TACTCAGAATTCCACCTGTGCCGATCTTCATGC TACTCAGTCGACTCACAGTTCCGCCGTGTAGAG TACTCAGAATTCAAGTTCCAAAGCGTCTTCGAC TACTCAGTCGACTCAGCGGTGGAGCGCCTGAGTGC

TAATACGACTCACTATAGGTACGCGGAGTTCCAGCGCGA TAATACGACTCACTATAGGCGTTCTCCTTGTCTCCCT GCGTAATACGACTCACTATAGGTGGTCCCAATTCTCGTGGAAC GCGTAATACGACTCACTATAGGCTTGAAGTTGACCTTGATGCC

TAATACGACTCACTATAGGGAGAATGAATGTGAAGATCCAAAT TTAATTCGCGGCCGCCTAATGATGATGATGATGGTGTTCAT AATTCGCCGT TCAATGATGATGATGATGGTGCACGGCCGCCACCACCAGCA

2.7. Bacterial binding assay and Western blotting All eight species of bacteria mentioned earlier were used for binding assays. Each bacterium (1 × 107 CFU) was incubated with 20 μg of recombinant MjSR-B1 in a total volume of 600 μl for 30 min at room temperature with gentle rotation. The bacteria were centrifuged and washed twice with 1 ml PBS, and then eluted with 100 μl 7% SDS solution. After centrifugation, The eluted solution and deposited bacteria were collected and used for Western blotting to detect the bacterial binding ability of MjSR-B1 with the following method: The deposited bacteria were resuspended in 100 μl PBS, then 50 μl of SDS–PAGE reduced loading buffer were added. The mixture was heated at 100 °C for 5 min and centrifuged again, and the supernatants were separated by 12.5% SDS–PAGE. The SDSeluted solution was treated in the same way. After electrophoresis, the proteins were transferred to nitrocellulose membrane using transfer buffer (48 mM Tris–HCl, 39 mM glycine, 1.28 mM SDS and 20% methanol) for Western blotting. Monoclonal anti-polyhistidine antibody (1:2000 dilution in TBS containing 1.5% nonfat milk) was used as primary antibody against His-tagged MjSR-B1; alkaline phosphatase-conjugated horse anti-mouse IgG (1:10,000 dilution in TBS containing 1.5% nonfat milk) was the secondary antibody. 2.8. Polysaccharide-binding analysis of recombinant MjSR-B1 To test the binding ability of MjSR-B1 to different bacterial components, an ELISA assay was performed as described previously (Shi et al., 2012). Lipoteichoic acid (LTA), peptidoglycan (PG) and lipopolysaccharide (LPS) were used in this assay. Each of these ligands was coated on the wells of flat-bottomed 96-well microliter plates at 37 °C for 20 h, and then evaporated at 60 °C for 30 min. Every well was coated with 4 μg ligand in a volume of 50 μl. Then, 100 nM of purified recombinant MjSR-B1, or the His-tag used as the control, diluted in binding buffer (50 mM Tris–HCl, 50 mM NaCl, pH 8.0) containing 0.1 mg/ml BSA, were added to each coated well of the plates (50 μl/well) and incubated at 37 °C for 3 h. Plates were washed four times with binding buffer (each for 5 min), and then 100 μl mouse monoclonal polyhistidine antibody (Sigma, 1:3000 dilution in binding buffer containing 0.1 mg/ml BSA) was added to each well and incubated at 37 °C for 2 h. After the plates were washed again four times with binding buffer, 100 μl alkaline phosphatase-conjugated goat anti-mouse IgG (Sigma, 1:2000 dilution in binding buffer containing 0.1 mg/ml BSA) was added to each well and incubated at 37 °C for 2 h. After another four washes, 50 μl p-nitro-phenyl phosphate (1 mg/ml in 10 mM diethanolamine, 0.5 mM MgCl2) was added to each well of the plates and incubated for 20 min at room temperature. The absorbance of each well was measured at 405 nm using a plate reader (Bio-Tek instruments). Specific binding was calculated by subtracting the total binding of the control His-tag protein from the total binding of MjSR-B1 protein. Each binding assay was performed three times.

2.6. Bacterial agglutination assay

2.9. RNA interference of MjSR-B1 and bacterial clearance assay

Four species of Gram-positive bacteria (S. aureus, B. subtilis, B. megaterum, and B. thuringiensis) and four of Gram-negative bacteria (V. anguillarum, E. coli, K. pneumoniae, and P. aeruginosa) were cultured in LB medium (1% tryptone, 1% NaCl, 0.5% yeast extract) to the logarithmic phase, harvested by centrifugation at 5000 × g for 5 min, and then resuspended in TBS to a final OD600 of 0.4. Then the diluted bacteria (25 μl) were incubated with the same volume of recombinant MjSR-B1 (concentration from 12.5 to 200 μg/ml), with or without 10 mM CaCl2, for 1 h at 28 °C. The His-tag expressed in E. coli with the bared pET-32a(+) vector was used as the control. Microscopy (Nikon ECLIPSE TE2000-U, Japan) was used to observe agglutination. All the assays were performed in triplicate.

Primers dsMjSR-B1F and dsMjSR-B1R (Table 1) were used to amplify a nucleotide fragment from MjSR-B1 as the template to synthesize the double-strand RNA (dsRNA) of MjSR-B1 with T7 RNA polymerase (Fermentas, Thermo Fisher Scientific, USA). DsRNA of MjSR-B1 (60 μg) was injected into the abdominal segment of shrimp and another 60 μg was injected 24 h later. For the control group, the same dose of dsRNA of green fluorescent protein (GFP) was injected synchronously. After second injection, shrimp hemocytes were collected for qRT-PCR analysis using primers MjSR-B1rtF and MjSRB1rtR to measure the efficiency of the RNA interference of MjSRB1. The internal control used in qRT-PCR was β-actin. After knockdown of MjSR-B1 (24 h of the second injection), 20 μl S. aureus

W.-J. Bi et al./Developmental and Comparative Immunology 51 (2015) 10–21

13

or V. Anguillarum (2 × 107 CFU) was injected into shrimp for bacterial clearance assays. The bacterial clearance assays were performed as follows: after 1 h injection of S. aureus or V. anguillarum, the hemolymph of each group was collected and gradient diluted. The 1000-fold diluted hemolymph was smeared onto LB-agar plates or 2216E-agar plates. The plates were incubated at 37 °C for about 24 h, and the number of bacteria on the plates were counted and calculated as amount per milliliter of shrimp hemolymph (CFU).

and Arp (Arp rtF and Arp rtR). The antimicrobial peptides were Crustin I-1 (Cru-I1 rtF and Cru-I1 rtR); Crustin I-2 (Cru-I2 rtF and Cru-I2 rtR); Crustin I-3 (Cru-I3 rtF and Cru-I3 rtR); Crustin I-4 (Cru-I4 rtF and Cru-I4 rtR); antilipopolysaccharide factor A1 (Alf-A1) (Alf-A1rtF and Alf-A1rtR); Alf-B1 (Alf-B1rtF and Alf-B1rtR); Alf-D1 (Alf-D1rtF and Alf-D1rtR); and Alf-E1 (Alf-E1rtF and Alf-E1rtR).

2.10. Overexpression of MjSR-B1

3.1. The cDNA of MjSR-B1 was cloned and identified

Primers MjSR-B1overexF and MjSR-B1overexR (Table 1) were used to amplify the ORF of MjSR-B1. As a control, primers MjSR-B1overexF and MjSR-B1ΔCoverexR were used to amplify the sequence of MjSRB1ΔC, which lacks the C-terminus of MjSR-B1. Both MjSR-B1overexR and MjSR-B1ΔCoverexR contain the nucleotide sequence for six adjacent histidines, which were used for detection. The double stranded DNA containing the MjSR-B1 sequence and a His-tag encoding sequence was used as template to transcribe the capped MjSR-B1 mRNA with the T7 RNA polymerase in vitro transcription kit (Ambion, Inc.) according to the manufacturer’s instructions. Each shrimp was injected in the abdominal segment with 3 μM MjSR-B1 mRNA. For the control group, each shrimp was injected synchronously with the same dose of MjSR-B1ΔC mRNA. After 24 h of mRNA injection, the hemolymph of each group was collected for Western blot analysis to measure the efficiency of overexpression, using anti-His-tag monoclonal primary antibody. The S. aureus or V. anguillarum (2 × 107 CFU) were injected into shrimp 24 h post mRNA injection, and bacterial clearance assays were conducted as described earlier.

The full length cDNA of MjSR-B1 is 2618 bp with an open reading frame (ORF) of 1524 bp, a 5′ untranslated region (UTR) of 504 bp and a 3′ untranslated region of 590 bp (GenBank accession no. KP121407). The ORF of the deduced protein comprises 507 amino acids. The theoretical molecular mass of MjSR-B1 is 56.87 kDa, and its isoelectric point is 8.48. The MjSR-B1 has a CD36 domain that contains two transmembrane regions at the N- and C-terminals of the protein (SMART analysis: http://smart.embl-heidelberg.de/) (Fig. S1). BLASTX (http://blast.ncbi.nlm.nih.gov/Blast.cgi) analysis showed that the MjSR-B1 has 38% identity with LIMP2 of tilapia Oreochromis niloticus, and 37% identity with CD36 of barred knifejaw Oplegnathus fasciatus. The results of multiple alignments showed relatively low conservation of the SR-B family (Fig. S2). A threedimensional model of the MjSR-B1 was constructed by the on line software SWISS-MODEL (http://swissmodel.expasy.org/) (Fig. 1A). We selected some SR-As, SR-Bs and SR-Cs from GenBank for phylogenetic analysis using protein sequences; as might be expected, the selected SRs were divided into three groups, SR-A, SR-B and SRC. The SR-Bs were divided into two subgroups. MjCroquemort belongs to subgroup I, while MjSR-B1 belongs to subgroup II (Fig. 1B).

2.11. Fluorescent labeling of bacteria and phagocytosis assay V. anguillarum and S. aureus were labeled with fluorescent isothiocyanate (FITC) (Sigma, USA) as previously described (Xu et al., 2014). After being washed twice with PBS, the bacteria were heated at 70 °C for 30 min, then washed with 0.1 M NaHCO3 and incubated in 0.1 M NaHCO3 containing 0.1 mg/ml FITC for 1 h at room temperature. Subsequently, the FITC-labeled bacteria were rinsed with PBS until there was no visible dissociated FITC. Each shrimp was injected in the abdominal segment with 10 μl FITC-labeled bacteria (1 × 109 CFU/ml). The phagocytosis assay was performed as follows: 30 min after bacterial injection, the hemolymph was collected in a 5 ml syringe containing 1 ml of anticoagulant. Then the hemolymph was centrifuged at 700 × g for 5 min at 4 °C and resuspended 3:1 (v/v) in 1 ml anticoagulant containing 4% paraformaldehyde. After incubation on ice for 10 min and washing with PBS twice, the fixed hemocytes were dropped onto poly-llysine coated glass slides and incubated for 1 h. After five washes, hemocytic phagocytosis was examined under a fluorescence microscope (Olympus BX51, Japan). The remainders of the fixed hemocytes were used to examine the phagocytosis ratio by flow cytometry, using the CELL Quest program (Becton Dickinson, USA). Phagocytosis percentage was defined as [the hemocytes ingesting bacteria/all cells observed or tested] × 100%. The assay was performed three times and data were analyzed by one-way ANOVA.

3. Results

3.2. Tissue distribution and expression patterns of MjSR-B1 qRT-PCR was performed to analyze the tissue distribution of MjSR-B1. The results showed that MjSR-B1 transcripts were mainly detected in hemocytes, hepatopancreas and heart, with almost no expression in gill and intestine (Fig. 2A). The temporal expression patterns of MjSR-B1 in hemocytes after bacterial challenge were also analyzed by qRT-PCR. Fig. 2B showed that the mRNA expression level of MjSR-B1 was upregulated 2 h and 48 h post V. anguillarum challenge. When challenged by S. aureus, the expression of MjSR-B1 was dramatically upregulated from 2 h to 48 h after bacterial challenge (Fig. 2C). 3.3. MjSR-B1 agglutinates bacteria The extracellular region of MjSR-B1 was expressed in E. coli Rosetta and purified chromatographically (Fig. 3A). Since the recombinant protein constitutes the extracellular region of MjSR-B1 (46.90 kDa) plus a His-tag, the molecular mass was as expected. We investigated the agglutinating ability of this recombinant MjSRB1. MjSR-B1 could agglutinate the eight kinds of bacteria we tested and the agglutination was calcium dependent (Fig. 3B). The minimal agglutinating concentration (MAC) for each bacterium is shown in Table 2.

2.12. Real time quantitative PCR analysis for phagocytosis related genes and antimicrobial peptides genes

3.4. MjSR-B1 bound to bacteria and polysaccharides

After knockdown or overexpression of MjSR-B1, the shrimp were challenged by V. anguillarum or S. aureus. The hemocytes were collected to extract RNA 1 h after bacterial injection. qRT-PCR was performed to test the expression level of phagocytosis related genes and antimicrobial peptide genes. The phagocytosis related genes included Myosin (Myosin rtF and Myosin rtR); actin-related protein, Rab5 (Rab5 rtF and Rab5 rtR); Lamp1 (Lamp1 rtF and Lamp1 rtR);

Eight kinds of bacteria were used in MjSR-B1 binding assays. Recombinant MjSR-B1 bound strongly to S. aureus, B. megaterum, V. anguillarum and P. aeruginosa, and bound weakly to the other four bacteria tested (Fig. 4A). To clarify whether the bacterial binding ability of MjSR-B1 was due to binding of cell surface polysaccharides, ELISA assays were performed to detect the binding ability of MjSR-B1 to peptidoglycan (PGN), lipopolysaccharide (LPS) and

14

W.-J. Bi et al./Developmental and Comparative Immunology 51 (2015) 10–21

Fig. 1. A three-dimensional model of the MjSR-B1 and phylogenetic tree of SRs from shrimp and other species based on protein sequences. (A) A three-dimensional model of the MjSR-B1 was constructed by the on line software SWISS-MODEL (http://swissmodel.expasy.org/). The template ID is 4q4b1. EX, extracellular region; TM, transmembrane region; CP, cytoplasmic tail. (B) Phylogenetic tree. MEGA 4.0 was used to make a neighbor-joining phylogenetic tree. The black triangle marks MjSR-B1. The bootstrap is 1000, and the bar shows the relative distance of genetic variation.

W.-J. Bi et al./Developmental and Comparative Immunology 51 (2015) 10–21

15

Fig. 2. Expression patterns of MjSR-B1. (A) Tissue distribution analysis of MjSR-B1 expression in unchallenged shrimp by qRT-PCR. β-Actin transcription was used as the control. (B and C) Temporal expression patterns of MjSR-B1 in hemocytes after challenge by V. anguillarum or S. aureus, determined by qRT-PCR. All the assays were performed three times and data were analyzed by the unpaired t-test. Significant difference was accepted at p < 0.05.

Fig. 3. MjSR-B1 agglutinated different bacteria. (A) Expression and purification of the extracellular region of MjSR-B1. SDS–PAGE was used to test the expression of MjSRB1 in E. coli. Lane M, protein marker; lane 1, proteins of normal E. coli containing pET-32a-MjSR-B1; lane 2, proteins of E. coli pET-32a-MjSR-B1 after induction by 0.5 mM IPTG; lane 3, purified recombinant MjSR-B1. (B) Bacterial agglutination by recombinant MjSR-B1. The Gram-negative bacterium V. anguillarum was used for the agglutination assay. The His-tag from pET-32a(+) was used as the control.

16

W.-J. Bi et al./Developmental and Comparative Immunology 51 (2015) 10–21

Table 2 The minimal agglutinating concentrations of MjSR-B1. Microorganisms Gram-positive bacteria Staphylococcus aureus Bacillus subtilis Bacillus megaterum Bacillus thuringiensis Gram-negative bacteria Vibrio anguillarum Klebsiella pneumoniae Escherichia coli Pseudomonas aeruginosa

Minimal agglutinating concentration (MAC, μg/ml) 25 50 50 25 50 12.5 50 25

lipoteichoic acid (LTA). The data indicate that rMjSR-B1 could bind LPS and LTA in a dose-dependent manner, but did not bind to PGN (Fig. 4B). 3.5. MjSR-B1 promotes bacterial clearance in M. japonicus To investigate the in vivo function of MjSR-B1, RNAi of MjSR-B1 and bacterial clearance assays were performed. qRT-PCR analysis indicated that 24 h after dsMjSR-B1 second injection, the mRNA level of MjSR-B1 in hemocytes declined significantly (Fig. 5A). After MjSRB1 knockdown, V. anguillarum or S. aureus were injected into shrimp. The bacterial clearance ability of hemocytes was impaired in the MjSR-B1-silenced shrimp; the number of both V. anguillarum and S. aureus in shrimp increased significantly compared with the control shrimp (Fig. 5B). Overexpression of MjSR-B1 and mutant MjSR-B1 (Fig. 5C) in shrimp were also performed. Western blotting was used to examine the efficiency of MjSR-B1 overexpression. Fig. 5D shows

that both MjSR-B1 and MjSR-B1ΔC were successfully expressed in shrimp hemocytes. In bacterial clearance assays, overexpression of MjSR-B1 resulted in a significant enhancement of the bacterial clearance ability, in contrast to overexpressed MjSR-B1ΔC (Fig. 5E). These data suggest that MjSR-B1 plays a vital role in the process of bacterial clearance. 3.6. MjSR-B1 mediates phagocytosis in M. japonicus To investigate the mechanism of how MjSR-B1 facilitates bacterial clearance, phagocytosis assays were performed after MjSRB1 was knocked down or overexpressed. The results showed that knockdown of MjSR-B1 significantly decreased the phagocytic rate for Gram-positive and Gram-negative bacteria (Fig. 6A) whereas overexpression of MjSR-B1 significantly enhanced hemocyte phagocytosis of Gram-positive and Gram-negative bacteria (Fig. 6B). In order to confirm these results, we also analyzed hemocyte phagocytosis using flow cytometry, which could analyze more than 104 hemocytes (Fig. 6C). The data show that after knockdown of MjSRB1, the phagocytotic rate declined significantly compared with the control (Fig. 6D). After overexpression of MjSR-B1, the phagocytotic rate of hemocytes increased significantly (Fig. 6E). These data suggest that MjSR-B1 was responsible for hemocyte phagocytosis of both Gram-positive and Gram-negative bacteria. 3.7. Expression of phagocytotic related genes is mediated by MjSR-B1 To analyze the mechanism of MjSR-B1 enhancement of phagocytosis, qRT-PCR was performed to test the expression levels of phagocytosis related genes. These include phagosome marker gene Lamp1 (Huynh et al., 2007), a master regulator of endocytosis Rab5 (Frittoli et al., 2014), a participant of FcγR or CR3 mediated phagocytosis Arp (May et al., 2000), and a switch for efficient phagocytosis myosin (Dieckmann et al., 2010). Expression of these genes was analyzed in MjSR-B1-silenced or MjSR-B1-overexpressed shrimp challenged by V. anguillarum or S. aureus. The results showed that following the silencing of MjSR-B1, the expression levels of all the genes tested decreased significantly compared with controls (Fig. 7A and B), while only Arp expression level was increased significantly post V. anguillarum challenge in the MjSR-B1-overexpression shrimp (Fig. 7C) and all the genes tested increased significantly post S. aureus challenge in the MjSR-B1overexpressed shrimp (Fig. 7D). All of these results indicate that MjSRB1 participates in an early stage of bacterial phagocytosis. 3.8. Expression of antimicrobial peptides is mediated by MjSR-B1

Fig. 4. Recombinant MjSR-B1 binds to different bacteria and polysaccharides. (A) Bacterial binding assay of MjSR-B1. Bacteria were incubated with rMjSR-B1 and then washed with PBS and eluted with 7% SDS. The precipitated bacteria and 7% SDS eluate were separated by SDS–PAGE and transferred to nitrocellulose membranes for Western blot analysis. Anti-His-tag monoclonal antibody was used in the Western blot. (B) Direct binding assay. The polysaccharides LPS and LTA were used for ELISA analysis. The primary antibody was anti-His-tag monoclonal. All the assays were performed three times and data were analyzed by the unpaired t-test. Significant difference was accepted at p < 0.05.

To investigate whether MjSR-B1 participates in bacterial clearance by regulating the expression of antimicrobial peptides (AMPs), the expression of AMPs, including crustins (CrusI-1, CrusI2, CrusI-3 and CrusI-4) and antilipopolysaccharide factors (Alf-A1, AlfB1, Alf-D1 and Alf-E1), was analyzed by qRT-PCR in MjSR-B1silenced or -overexpressed shrimp challenged by V. anguillarum or S. aureus. The results showed that Crus I-1, Alf-A1 and Alf-E1 were involved against Gram-negative bacteria because their expressions declined after MjSR-B1 silencing and increased after MjSRB1 overexpression (Fig. 8A and C). CrusI-1, CrusI-3, CrusI-4 and AlfB1 were involved in anti-Gram-positive bacterial responses (Fig. 8B and D). These data suggest that MjSR-B1 might participate in the regulation of the expression of antimicrobial peptides. 4. Discussion SR-Bs are type III transmembrane receptors with two transmembrane regions, an extracellular region and two cytoplasmic tails. The extracellular domain being heavily glycosylated has specific

W.-J. Bi et al./Developmental and Comparative Immunology 51 (2015) 10–21

17

Fig. 5. MjSR-B1 enhances bacterial clearance ability in shrimp. (A) Effects of RNAi detected by qRT-PCR. Twenty-four hours after the second injection of dsMjSR-B1, hemocytes were collected for RNA extraction and MjSR-B1 expression was analyzed by qRT-PCR. dsGFP was used as the control. (B) Bacterial clearance in MjSR-B1-knockdown shrimp. Twenty-four hours after the second dsMjSR-B1 injection, PBS washed V. anguillarum or S. aureus were injected into shrimp. The hemolymph was collected 1 h later, gradient diluted with PBS and plated on LB-agar plates. The numbers of bacteria were counted after 24 h culture at 37 °C. (C) A schematic view of the structure of the MjSRB1 protein and its truncation mutant for overexpression. TM indicates a transmembrane region. (D) Western blot to analyze both MjSR-B1 and MjSR-B1ΔC expression in hemocytes from mRNA-injected shrimp. Twenty-four hours after mRNA injection into shrimp, hemocytes were collected for Western blotting. Anti-His-tag monoclonal antibody was used as the primary antibody. (E) Bacterial clearance assays were conducted after overexpression of MjSR-B1 or MjSR-B1ΔC. Twenty-four hours after injection of mRNAs, PBS washed V. anguillarum or S. aureus were injected into shrimp and the hemolymph was collected 1 h later, gradient diluted with PBS and plated on LB-agar plates for bacterial culture. The bacterial colonies were counted after 24 h culture at 37 °C. MjSR-B1ΔC mRNA was used as the control. All the assays were performed three times and data were analyzed by the unpaired t-test. Significant difference was accepted at p < 0.05.

ligand binding sites, thus it could mediate ligand recognition (Kar et al., 2008; Silverstein and Febbraio, 2009). In this study, MjSR-B1 was upregulated in hemocytes after challenge with Gram-positive and Gram-negative bacteria. The extracellular domain of MjSR-B1 could agglutinate different bacteria, and bind to LPS from Gramnegative and LTA from Gram-positive bacteria. Phagocytosis is a highly conserved multi-step process involved in engulfing and destroying apoptotic bodies, dying tumor cells and pathogens. The cascades of phagocytosis begin with particle recognition by PRRs and adhesion of the particle to the phagocyte surface. Receptor recognition triggers a consecutive progression of cellular changes, including rearrangement of the cytoskeleton, reorganization of the plasma membrane, maturation of phagosomes, and production of cytokines and molecules required for antigen presentation to the adaptive immune system (Stuart and Ezekowitz, 2008). Pathogen recognition and internalization is mediated by a variety of phagocytic receptors, including scavenger receptors, integrins (complement receptors), Fcγ receptor, and C-type lectins such as mannose binding receptor in mammals (Greenberg and

Grinstein, 2002; Stuart and Ezekowitz, 2005). Multiple receptor types are co-expressed in single phagocytes and collaborate in the detection and ingestion of particles (Freeman and Grinstein, 2014). Three types of receptors that are related to phagocytosis have been identified in humans: pattern-recognition receptors (PRRs), opsonic receptors, and apoptotic corpse receptors (Flannagan et al., 2012; Freeman and Grinstein, 2014). In shrimp, several PRRs involved in phagocytosis have been identified. A β-integrin was reported in Fenneropenaeus chinensis. β-integrin exists on the membrane of hemocytes; it can interact with an opsonic receptor, FcLec4, a C-type lectin. FcLec4 detects invading bacterial pathogens via the carbohydrate recognition domain (i.e., the C-type lectin domain). Upon recognition, binding between the N-terminus of the lectin and β-integrin leads to cytoskeletal reorganization, which induces phagosome formation to ingest the invading bacteria (Wang et al., 2014). Calnexin (Cnx) has also been identified as one of the phagocytic receptors in M. japonicus (Zhang et al., 2014). MjCnx exists on the surface of shrimp hemocytes. It strongly binds to Gram-negative bacteria and to some Gram-positive bacteria. Further study revealed

18

W.-J. Bi et al./Developmental and Comparative Immunology 51 (2015) 10–21

Fig. 6. MjSR-B1 mediates phagocytosis of bacteria in shrimp. (A) Twenty-four hours after dsMjSR-B1 injection, FITC labeled V. anguillarum or S. aureus (green) were injected into shrimp. The hemocytes were collected 1 h later and stained with DAPI (blue), and then observed under a fluorescence microscope. Shrimp injected with dsGFP were used as controls. Scale bar = 20 μm. (a) The phagocytosis rate was calculated according to the images captured by the fluorescence microscope, a total of 1000 cells were counted. (B) Twenty-four hours after MjSR-B1 mRNA injection, FITC labeled V. anguillarum or S. aureus (green) were injected into shrimp. The hemocytes were collected 1 h later and stained with DAPI (blue), and then observed under a fluorescence microscope. Shrimp injected with MjSR-B1ΔC mRNA were used as controls. Scale bar = 20 μm. (b) The phagocytosis rate was calculated according to the images captured by the fluorescence microscope, a total of 1000 cells were counted. (C) Flow cytometry was used for hemocyte phagocytotic analysis. It can distinguish hemocytes from bacteria, and only the hemocytes were analyzed. Twenty-four hours post dsRNA or mRNA injection, FITC labeled V. anguillarum or S. aureus were injected into shrimp. The hemocytes were collected 1 h later and fixed with 1% paraformaldehyde, and then measured by flow cytometry. (D and E) Quantitative analysis of phagocytotic rates based on the data by flow cytometry. The data were analyzed by the unpaired t-test and significant difference was accepted at p < 0.05. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

W.-J. Bi et al./Developmental and Comparative Immunology 51 (2015) 10–21

19

Fig. 7. Expression levels of myosin, Rab5, LAMP and ARP are mediated by MjSR-B1. After MjSR-B1 knockdown, shrimp were challenged by (A) V. anguillarum or (B) S. aureus. qRT-PCR was performed to measure the mRNA levels of phagocytosis-related genes in the shrimp 1 h after bacterial challenge. When MjSR-B1 protein was overexpressed, the expression level of the phagocytosis-related genes was tested 1 h post (C) V. anguillarum and (D) S. aureus challenge. All the assays were performed in triplicate and data were analyzed by the unpaired t-test at p < 0.05.

that MjCnx had high affinity for PGN, LTA and LPS. MjCnx enhances the clearance of V. anguillarum by promoting phagocytosis, and this ability was impaired by knockdown of MjCnx (Zhang et al., 2014). There are also some other PRRs identified in shrimp that are involved in phagocytosis, such as L-type lectin (Xu et al., 2014), fibrinogen-related protein (Sun et al., 2014) and galectin (Shi et al., 2014). In this study, the hemocytically expressed MjSR-B1 recognizes LPS and LTA and enhances phagocytosis of invading bacteria. Therefore, like mammals, shrimp have a multiplicity of phagocytic receptors, and these receptors either directly recognize the particle (e.g., MjSR-B1), or recognize targets coated by opsonic molecules (e.g., FcLec4). This also indicates that the innate immune system in shrimp has evolved overlapping mechanisms to combat some important pathogens. In a previous report, the COOH-terminal cytoplasmic residues of CD36 were essential to trigger phagocytic engulfment, and the COOH-terminal cytoplasmic domain could activate TLR2/6 signaling after induction by S. aureus or LTA, its cell wall component (Stuart et al., 2005). We also made a truncation mutation of the C-terminal cytoplasmic domain of MjSR-B1 for overexpression analysis, and found that bacterial clearance and phagocytosis were impaired with this mutant, and the expression of downstream genes of the phagocytosis cascade and the expression of antimicrobial peptides significantly declined. The extracellular domain of MjSR-B1 can bind to LPS from Gram-negative bacteria and LTA from the wall of Grampositive bacteria. These results indicate that the extracellular domain

recognizes the invading pathogens and triggers phagocytosis; the COOH-terminal cytoplasmic domain is essential to signal to the actin cytoskeleton and trigger engulfment to clear bacteria. In host immune response, CD36 cooperates with a TLR2/6 heterodimer in the recognition of LTA and diacylglycerides and plays a role in Staphylococcus aureus infection (Hoebe et al., 2005). CD36 also cooperates with a TLR4/6 heterodimer mediated by OxLDL in sterile inflammation. The TLR4–TLR6 signaling is propagated by both the MyD88 and TRIF adaptors, leading to the induction of proinflammatory cytokins (Stewart et al., 2010). Our results showed that MjSR-B1 participates in the regulation of the expression of AMPs; the induction of AMPs against bacteria might be through Toll like receptor pathways. In conclusion, in this study we identify and characterize MjSRB1 in M. japonicus. The extracellular region of MjSR-B1 possesses the ability to bind and agglutinate bacteria through binding LPS or LTA. The carboxy-terminal cytoplasmic domain is essential for the bacterial internalization. MjSR-B1 acts as a phagocytic receptor for both Gram-positive and Gram-negative bacteria, and as a pattern recognition receptor to regulate the expression of AMPs. Acknowledgements This work was supported by grants from National Natural Science Foundation of China (Grants 31472303 and 31130056), National Basic Research Program of China (973 Program, No. 2012CB114405) and

20

W.-J. Bi et al./Developmental and Comparative Immunology 51 (2015) 10–21

Fig. 8. Expression of crustins and antilipopolysaccharide factors is mediated by MjSR-B1. After MjSR-B1 knockdown, shrimp were challenged with (A) V. anguillarum or (B) S. aureus. qRT-PCR was performed to measure the mRNA levels of the antimicrobial peptides 1 h after the bacterial challenge CrusI-1, CrusI-2, CrusI-3, CrusI-4, Alf-A1, Alf-B1, Alf-D1 and Alf-E1. The expression levels of AMPs in MjSR-B1-overexpressed shrimp challenged by (C) V. anguillarum or (D) S. aureus. All the assays were performed three times and data were analyzed by the unpaired t-test. Significant difference was accepted at p < 0.05.

the Ph.D. Program Foundation of the Ministry of Education of China (Grant 20110131130003). Appendix: Supplementary material Supplementary data to this article can be found online at doi:10.1016/j.dci.2015.02.001. References Areschoug, T., Gordon, S., 2009. Scavenger receptors: role in innate immunity and microbial pathogenesis. Cell. Microbiol. 11, 1160–1169. Baranova, I.N., Kurlander, R., Bocharov, A.V., Vishnyakova, T.G., Chen, Z., Remaley, A.T., et al., 2008. Role of human CD36 in bacterial recognition, phagocytosis, and pathogen-induced JNK-mediated signaling. J. Immunol. 181, 7147–7156. Baranova, I.N., Vishnyakova, T.G., Bocharov, A.V., Leelahavanichkul, A., Kurlander, R., Chen, Z., et al., 2012. Class B scavenger receptor types I and II and CD36 mediate bacterial recognition and proinflammatory signaling induced by Escherichia coli, lipopolysaccharide, and cytosolic chaperonin 60. J. Immunol. 188, 1371–1380. Brown, M.S., Goldstein, J.L., Krieger, M., Ho, Y.K., Anderson, R.G., 1979. Reversible accumulation of cholesterol esters in macrophages incubated with acetylated lipoproteins. J. Cell Biol. 82, 597–613. Canton, J., Neculai, D., Grinstein, S., 2013. Scavenger receptors in homeostasis and immunity. Nat. Rev. Immunol. 13, 621–634. Christophides, G.K., Vlachou, D., Kafatos, F.C., 2004. Comparative and functional genomics of the innate immune system in the malaria vector Anopheles gambiae. Immunol. Rev. 198, 127–148. Dieckmann, R., von Heyden, Y., Kistler, C., Gopaldass, N., Hausherr, S., Crawley, S.W., et al., 2010. A myosin IK-Abp1-PakB circuit acts as a switch to regulate phagocytosis efficiency. Mol. Biol. Cell 21, 1505–1518.

Flannagan, R.S., Jaumouille, V., Grinstein, S., 2012. The cell biology of phagocytosis. Annu. Rev. Pathol. 7, 61–98. Franc, N.C., Dimarcq, J.L., Lagueux, M., Hoffmann, J., Ezekowitz, R.A., 1996. Croquemort, a novel Drosophila hemocyte/macrophage receptor that recognizes apoptotic cells. Immunity 4, 431–443. Freeman, S.A., Grinstein, S., 2014. Phagocytosis: receptors, signal integration, and the cytoskeleton. Immunol. Rev. 262, 193–215. Frittoli, E., Palamidessi, A., Marighetti, P., Confalonieri, S., Bianchi, F., Malinverno, C., et al., 2014. A RAB5/RAB4 recycling circuitry induces a proteolytic invasive program and promotes tumor dissemination. J. Cell Biol. 206, 307–328. Greenberg, S., Grinstein, S., 2002. Phagocytosis and innate immunity. Curr. Opin. Immunol. 14, 136–145. Hoebe, K., Georgel, P., Rutschmann, S., Du, X., Mudd, S., Crozat, K., et al., 2005. CD36 is a sensor of diacylglycerides. Nature 433, 523–527. Huynh, K.K., Eskelinen, E.L., Scott, C.C., Malevanets, A., Saftig, P., Grinstein, S., 2007. LAMP proteins are required for fusion of lysosomes with phagosomes. EMBO J. 26, 313–324. Janeway, C.A., Jr., Medzhitov, R., 2002. Innate immune recognition. Annu. Rev. Immunol. 20, 197–216. Kar, N.S., Ashraf, M.Z., Valiyaveettil, M., Podrez, E.A., 2008. Mapping and characterization of the binding site for specific oxidized phospholipids and oxidized low density lipoprotein of scavenger receptor CD36. J. Biol. Chem. 283, 8765–8771. May, R.C., Caron, E., Hall, A., Machesky, L.M., 2000. Involvement of the Arp2/3 complex in phagocytosis mediated by FcgammaR or CR3. Nat. Cell Biol. 2, 246–248. Mekata, T., Okugawa, S., Inada, M., Yoshimine, M., Nishi, J., Kono, T., et al., 2011. Class B scavenger receptor, Croquemort from kuruma shrimp Marsupenaeus japonicus: molecular cloning and characterization. Mol. Cell. Probes 25, 94–100. Neculai, D., Schwake, M., Ravichandran, M., Zunke, F., Collins, R.F., Peters, J., et al., 2013. Structure of LIMP-2 provides functional insights with implications for SR-BI and CD36. Nature 504, 172–176. Pluddemann, A., Neyen, C., Gordon, S., 2007. Macrophage scavenger receptors and host-derived ligands. Methods 43, 207–217.

W.-J. Bi et al./Developmental and Comparative Immunology 51 (2015) 10–21

Pluddemann, A., Mukhopadhyay, S., Gordon, S., 2011. Innate immunity to intracellular pathogens: macrophage receptors and responses to microbial entry. Immunol. Rev. 240, 11–24. Prabhudas, M., Bowdish, D., Drickamer, K., Febbraio, M., Herz, J., Kobzik, L., et al., 2014. Standardizing scavenger receptor nomenclature. J. Immunol. 192, 1997–2006. Rahaman, S.O., Lennon, D.J., Febbraio, M., Podrez, E.A., Hazen, S.L., Silverstein, R.L., 2006. A CD36-dependent signaling cascade is necessary for macrophage foam cell formation. Cell Metab. 4, 211–221. Sharif, O., Matt, U., Saluzzo, S., Lakovits, K., Haslinger, I., Furtner, T., et al., 2013. The scavenger receptor CD36 downmodulates the early inflammatory response while enhancing bacterial phagocytosis during pneumococcal pneumonia. J. Immunol. 190, 5640–5648. Shi, X.Z., Zhong, X., Yu, X.Q., 2012. Drosophila melanogaster NPC2 proteins bind bacterial cell wall components and may function in immune signal pathways. Insect Biochem. Mol. Biol. 42, 545–556. Shi, X.Z., Wang, L., Xu, S., Zhang, X.W., Zhao, X.F., Vasta, G.R., et al., 2014. A galectin from the kuruma shrimp (Marsupenaeus japonicus) functions as an opsonin and promotes bacterial clearance from hemolymph. PLoS ONE 9, e91794. Silverstein, R.L., Febbraio, M., 2009. CD36, a scavenger receptor involved in immunity, metabolism, angiogenesis, and behavior. Sci. Signal. 2, re3. Stewart, C.R., Stuart, L.M., Wilkinson, K., van Gils, J.M., Deng, J., Halle, A., et al., 2010. CD36 ligands promote sterile inflammation through assembly of a Toll-like receptor 4 and 6 heterodimer. Nat. Immunol. 11, 155–161. Stuart, L.M., Ezekowitz, R.A., 2005. Phagocytosis: elegant complexity. Immunity 22, 539–550. Stuart, L.M., Ezekowitz, R.A., 2008. Phagocytosis and comparative innate immunity: learning on the fly. Nat. Rev. Immunol. 8, 131–141. Stuart, L.M., Deng, J., Silver, J.M., Takahashi, K., Tseng, A.A., Hennessy, E.J., et al., 2005. Response to Staphylococcus aureus requires CD36-mediated phagocytosis

21

triggered by the COOH-terminal cytoplasmic domain. J. Cell Biol. 170, 477– 485. Sun, J.J., Lan, J.F., Shi, X.Z., Yang, M.C., Yang, H.T., Zhao, X.F., et al., 2014. A fibrinogenrelated protein (FREP) is involved in the antibacterial immunity of Marsupenaeus japonicus. Fish Shellfish Immunol. 39, 296–304. Triantafilou, M., Gamper, F.G., Haston, R.M., Mouratis, M.A., Morath, S., Hartung, T., et al., 2006. Membrane sorting of toll-like receptor (TLR)-2/6 and TLR2/1 heterodimers at the cell surface determines heterotypic associations with CD36 and intracellular targeting. J. Biol. Chem. 281, 31002–31011. Vishnyakova, T.G., Kurlander, R., Bocharov, A.V., Baranova, I.N., Chen, Z., Abu-Asab, M.S., et al., 2006. CLA-1 and its splicing variant CLA-2 mediate bacterial adhesion and cytosolic bacterial invasion in mammalian cells. Proc. Natl. Acad. Sci. U.S.A. 103, 16888–16893. Wang, X.W., Wang, J.X., 2013. Pattern recognition receptors acting in innate immune system of shrimp against pathogen infections. Fish Shellfish Immunol. 34, 981–989. Wang, X.W., Zhang, X.W., Xu, W.T., Zhao, X.F., Wang, J.X., 2009. A novel C-type lectin (FcLec4) facilitates the clearance of Vibrio anguillarum in vivo in Chinese white shrimp. Dev. Comp. Immunol. 33, 1039–1047. Wang, X.W., Zhao, X.F., Wang, J.X., 2014. C-type lectin binds to beta-integrin to promote hemocytic phagocytosis in an invertebrate. J. Biol. Chem. 289, 2405– 2414. Xu, S., Wang, L., Wang, X.W., Zhao, Y.R., Bi, W.J., Zhao, X.F., et al., 2014. L-Type lectin from the kuruma shrimp Marsupenaeus japonicus promotes hemocyte phagocytosis. Dev. Comp. Immunol. 44, 397–405. Zhang, Q., Wang, X.Q., Jiang, H.S., Jia, W.M., Zhao, X.F., Wang, J.X., 2014. Calnexin functions in antibacterial immunity of Marsupenaeus japonicus. Dev. Comp. Immunol. 46, 356–363.