Gene 534 (2014) 72–77
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Schizothorax davidi ghrelin: cDNA cloning, tissue distribution and indication for its stimulatory character in food intake Chaowei Zhou 1, Xingdong Zhang 1, Tao Liu, Rongbin Wei, Dengyue Yuan, Tao Wang, Fangjun Lin, Hongwei Wu, Fu Chen, Shiyong Yang, Defang Chen, Yan Wang, Zhiqiong Li ⁎ Department of aquaculture, College of Animal Science and Technology, Sichuan Agricultural University, Ya'an, China
a r t i c l e
i n f o
Article history: Accepted 7 October 2013 Available online 12 October 2013 Keywords: Schizothorax davidi Ghrelin Short-term fasting Long-term fasting
a b s t r a c t Ghrelin is a gut/brain hormone with a unique acyl modification and various biological functions in fish and mammals. The objectives of this project were to identify ghrelin gene organization, study tissue specific ghrelin mRNA expression and investigate the short- (0, 0.5, 1.5, 3, 6, 9, 12 h post-fasting) and long- (1, 3, 5, 7 days) term fasting as well as refeeding after a 7 day fasting induced changes in the expression of ghrelin mRNA in Schizothorax davidi. Our reverse transcription polymerase chain reaction analysis confirmed the predicted ghrelin sequence available in the GenBank and identified ghrelin mRNA expression in several tissues including the gut, liver, brain, heart, spleen, head kidney, gill and muscle. Quantitative PCR studies indicated that the expression level of ghrelin mRNA presented ascendant trend in short-term fasting group compared to the fed group, but it did not reach the significant level on statistics, while there is a significant increase in ghrelin mRNA expression in the gut of Schizothorax davidi fasted for 3, 5 and 7 days when compared to the expression in ad libitum fed fish. Refeeding after a 7 day fasting caused a significant and dramatic decrease in ghrelin mRNA expression in the gut of Schizothorax davidi. An increase in the expression of ghrelin mRNA during fasting, and its decrease following refeeding suggests an orexigenic role for ghrelin in Schizothorax davidi. Overall, our results provide evidence for a highly conserved structure and biological actions of ghrelin during evolution. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Feeding in vertebrates is regulated through a complex interaction of several guts and brain derived neuroendocrine factors. Ghrelin, the first known intestine peptide that has stimulates food intake, is a 28 amino acid peptide in most creatures including the humans (Kojima et al., 1999). The acylation on the third serine residue of ghrelin is essential for its receptor binding and biological activity. Initially, ghrelin was heralded as the long sought endogenous ligand for the orphan growth hormone secretagogue receptor. Soon, however, it became evident that ghrelin was implicated in a variety of physiological processes, including cell proliferation, metabolism, cell protection, reproduction, among others (Kojima and Kangawa, 2005). Overall, ghrelin is a multifunctional hormone complicated directive of various physiological processed in several animal models. To date, ghrelin has been cloning from a number of fish, including goldfish (Carassius auratus) (Unniappan and Peter, 2005; Unniappan et al., 2002), Nile tilapia (Oreochromis niloticus) (Parhar et al., 2003), Mozambique tilapia (Oreochromis mossambicus) (Kaiya et al., 2009b), Japanese eel (Anguilla japonica) (Kaiya et al., 2003b), rainbow trout Abbreviations: GRLN-LP, Ghrelin-like peptide; GH, Growth hormone; MS-222, Tricainemethane sulfonate; ORF, Open reading frame; bp, Base pair. ⁎ Corresponding author. Tel.: +86 835 2885654. E-mail address: [email protected] (Z. Li). 1 Chaowei Zhou and Xingdong Zhang contributed equally to this work. 0378-1119/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.gene.2013.10.012
(Oncorhynchus mykiss) (Kaiya et al., 2003a), channel catfish (Ictalurus punctatus) (Kaiya et al., 2005), sea bream (Acanthopagrus schlegeli) (Yeung et al., 2006), crucian carp (Carassius auratus) (Zhou et al., 2012), Schizothorax prenanti (Wei et al., 2013) and grass carp (Ctenopharyngodon idellus) (Feng et al., 2013). Furthermore, ghrelin-like peptide (GRLN-LP) has been cloned in cartilaginous fish (Kaiya et al., 2009a; Kawakoshi et al., 2007). The peptides of teleost ghrelin and shark GRLN-LP have different lengths of 12–25 amino acid residues, and have acylation of the third amino acid residue like in mammalian ghrelin. However, peculiar to teleost ghrelin is that the carboxyl-terminus possesses an amide structure, which has not been detected in the tetrapod ghrelin and shark GRLN-LP (Suda et al., 2012). The effects of ghrelin on food intake were foreshadowed by a number of studies showing that ghrelin could increase food intake and adiposity via the stimulation of orexigenic peptides in the hypothalamic arcuate nucleus (Kaiya et al., 2008, 2011; Kang et al., 2011a,b). The studies about ghrelin stimulating growth hormone (GH) secretion have been shown in tilapia, goldfish and rainbow trout (Kaiya et al., 2003c; Shepherd et al., 2007; Unniappan and Peter, 2004). For example, in goldfish, both central and peripheral treatments with goldfish ghrelin increased feeding behavior (Matsuda et al., 2006a; Unniappan et al., 2002, 2004). Similarly, long-term peripheral treatment with native ghrelin increased food intake and caused body weight gain and hepatic fat deposition in Mozambique tilapia (Riley et al., 2005a). In contrast, central treatments with native ghrelin reduced food intake in juvenile
C. Zhou et al. / Gene 534 (2014) 72–77
rainbow trout (Jönsson et al., 2010). In addition, overexpression of the ghrelin gene in the brain and gut have been identified in goldfish after food deprivation for 7 days (Unniappan et al., 2004), while the changes of the ghrelin mRNA of the stomach was not significant in mature Nile tilapia after food deprivation for 7 days (Parhar et al., 2003). Various investigations have shown the presence and biological roles of ghrelin in fish, however, concepts about the biological functions of ghrelin is disputed, suggesting that further studies are required to clarify the physiological of functions ghrelin in fish (Kaiya et al., 2008). The S. davidi (Schizothorax davidi) is a cold water fish distributed only in China, which is raising a high economic value. However, slow growth rate has been recognized as a major problem in cold water fish, increasing the final production cost. In nature, S. davidi growth is relatively slow compared to common carp (weight increase about 40 g per year in S. david, while about 500 g–1000 g per year in common carp). In our previous study, we have identified ghrelin gene in S. prenanti (Schizothorax prenanti) (Wei et al., 2013) and crucian carp (Zhou et al., 2012) and found that ghrelin might be involved in the regulation of food intake. To investigate whether it has the same physiological function on feeding in S. davidi, we first isolated the cDNA and gene sequences encoding ghrelin in S. davidi in this study, and investigated the expression of ghrelin in different tissues of S. davidi. Additionally, using quantitative real-time PCR method, we examined the short- and long- term fasting as well as refeeding induced changes in ghrelin expression in S. davidi intestine tract. Our results showed that ghrelin is widely expressed in various tissues of the S. davidi, and had an orexigenic character in S. davidi.
73
Table 1 Primers sequences and function used in this study. Primer
Sequences(5′–3′)
Size of Applications the product
Ghrelin-A1 Ghrelin-S1 Ghrelin-A2 Ghrelin-S2 β-actin-A3 β-actin-S3
CGGATCCATGCCTCTGCG-TTGTCGT GCTCGAGTCAGAATTCAAGTGGGGAATCA CGAATGACGGGCTGCGTTGTCGT GAGAATTCAAGTGGCA AGGAAGGATGGCTGGAAAAGAG TTTGAGCAGGAGATGGGAACC
312 312 120 120 134 134
Cloning of ORF Cloning of ORF Real time PCR Real time PCR Real time PCR Real time PCR
PCR fragments were ligated into a pMD®19-T plasmid vector (TaKaRa, Dalian, China). The ligated plasmid was transformed into E. coli DH5α. Colonies having inserts were cultured overnight in LB medium at 37 °C, extracted using OMEGA Mini Plasmid Kit and sequenced by automated sequence analysis (TaKaRa, Dalian, China). Once the sequence was confirmed, tissue distribution of ghrelin mRNA was performed in heart, spleen, head kidney, liver, brain, intestinal tract, gill and muscle. Real-time PCR of ghrelin was carried out on the CFX96 Real-Time PCR (Bio-Rad) using SYBR Green (TaKaRa, Dalian, China). The primers used in the real-time PCR are listed in Table 1. All real-time PCR reactions were performed in triplicate. Each one PCR mixture (25 μL) contained 12.5 μL of 2 × SYBRR Premix Ex Tap™ (TaKaRa, Dalian, China), 0.5 μL of each primer, 2.5 μL of cDNA and 9.5 μL of RNase Free H2O. The amplification condition was: 95 °C for 30 s × 1 followed by 95 °C 5 s, 60 °C 30 s × 45. The β-actin was used as housekeeping gene in this study. The 2−ΔΔCt method was used to determine the relative mRNA abundance for the surveyed samples.
2. Materials and methods 2.1. Animals and samples Five males and five females of S. davidi, with average body weight of 100±6.3g, were purchased from a local fish nursery in Ya'an city, China, and were transported to the laboratory in College of Animal Science and Technology, Sichuan Agricultural University. The fish were maintained under a natural photoperiod at 20 °C in a circulating aquarium system for 2 weeks before the experiments began. The S. davidi were fed with commercial diet (40% crude protein, 6% fat) (Haida, Guangzhou, China) to satiety twice a day at 8:00 and 16:00 for 30 min. Fish were anesthetized in 0.02% tricainemethane sulfonate (MS-222) before being sacrificed. The tissues were frequently removed and stored frozen at liquid nitrogen until RNA isolation. All studies were approved by the Sichuan Agriculture University Animal Care Committee. 2.2. Total RNA extraction Total RNA was extracted from the heart, spleen, head kidney, liver, brain, intestinal tract, gill and muscle tissues using TRIzol A+ reagent (TaKaRa, Dalian, China) according to the manufacturer's instructions. Total RNA concentrations of all samples were determined by a photometer (Bio-Rad) fixed at 260 nm and 280 nm wavelengths. Total RNA was stored at − 80 °C immediately until the next step was conducted. 2.3. Cloning of ghrelin ORF and tissue distributions analysis In order to clone S. davidi ghrelin ORF, one pair of primers (Table 1) was designed based on other fish ghrelin sequences recorded in the NCBI Genbank. A total volume of 25 μL reaction system contained 12.5 μL 2 × dNTP Mix (Invitrogen), 1.25 μL each of sense primer and antisense primers (10 μM), 2.5 μL cDNA and 7.5 μL ddH2O (Invitrogen). PCR parameters were: 94 °C for 5 min × 1 followed by 94 °C 30 s, 58 °C 30 s, 72 °C 30 s × 30, and 72 °C 8 min. The PCR products were parted in 1.5% agarose gel electrophoresis, then the target bands were extracted by Universal DNA Purification Kit (TIANGEN, Beijing, China). Then the
2.4. Structural analysis Multiple sequence alignments were generated using the clustalx1.83. The cleavage site of the signal peptide was estimated using SignalP Ver. 4.0 program (http://www.cbs.dtu.dk/services/SignalP/). A phylogenetic tree based on the amino acid sequences was constructed by the neighbor-joining method of the Clustal W (http://www.ddbj.nig.ac.jp/ search/clustalw-e.html) (Thompson et al., 1994) and MEGA 5.1 program (http://www.megasoftware.net/index.html) (Kumar et al., 2004). 2.5. Real-time quantitative RT-PCR (qPCR) in early embryo The ghrelin expression during embryogenesis was determined using qPCR. The mating pond consisted of a 2 × 3 × 0.8 m3 pond with constant aeration. Cleaned floating aquatic plants were put into the pond for bubble nest building (placing fish eggs). For mating, four female and two male fish (1:2 male-to-female sex ratio) were injected with a mixture of LHRH analogue (Mocell, Shanghai, China) and domperidone (Huyu, Shanghai, China) (LHRH and domperidone were used to improve fish artificial propagation in aquaculture) for the first injection, each at 15 mg/kg and 20 mg/kg bodyweight, respectively. Twelve hours later, female fish received a second injection of a mixture of LHRH analogue (20 μg/kg bodyweight) and domperidone (10 mg/kg bodyweight). After 14 h, fertilized eggs were collected at unfertilized eggs, 1 h post spawning (hps), cleavage (8 hps), morula stage (12 hps), blastulation (14 hps), gastrulation (32 hps), organogenesis (63 hps), embryonic mobility (105 hps), vascularization (175 hps), hatch (185 hps) for cDNA synthesis, and verified microscopically. The S. davidi ghrelin expression during embryogenesis was analyzed by qPCR using SYBR Premix Ex Tap−2(Perfect real time) (TaKaRa, Dalian, China) according to the manufacturer's instructions. Primer set for the qPCR of ghrelin was designed in the obtained nucleotide sequence (Table 1). The PCR was conducted at 95 °C for 10 min, then 44 reaction cycles were run, each consisting of 15 s at 95 °C, 15 s at 60 °C, and 20 s at 72 °C. The β-actin was also amplified as an internal standard. A single melting peak was detected by melting temperature
74
C. Zhou et al. / Gene 534 (2014) 72–77
analyses. The confirmed PCR efficiency was close to the theoretical PCR efficiency. All samples for mRNA analysis were run once in a single assay. The gene expression levels were calculated using the PCR products standard and CFX96 (Bio-Rad Laboratories Inc.). 2.6. Fasting caused changes of ghrelin mRNA expression in S. davidi intestinal tract To evaluate the effects of evaluate the effects of the short-term and long-term fasting, fed and fasted groups of S. davidi (average body weight 50 ± 4.9 g, 1:1 male-to-female sex ratio) (n = 30 × 6, three fed tanks and three unfed tanks were replicated) were sampled in six glass aquariums (100 × 65 × 75 cm3) at Sichuan Agricultural University Farm. The animals were temporary cultured in water insured stable aeration and temperature at 20 °C in a natural photoperiod. All fish were hand-fed commercial feed two meals everyday at 8:00 and 16:00 for 7 days. After 2 weeks of feeding, three groups of fish endured fasting, while other three groups of fish were fed as before. Ten fish were randomly sampled by dipnet at selected times after termination of feeding (0, 0.5, 1.5, 3, 6, 9, 12 h post-fasting). The 0 time fish was taken at 8:00. The sampling of unfed fish prior to feeding (time 0) was done to assess gene expression prior to normal feeding time, reducing the disturbance and potential stress effects on normal feeding behavior and gene expression of the fed fish group. The rest of the fish (fed control) were randomly sampled from a feeding tank with continuous feeding. Subsequently, the feeding was stopped for 1, 3, 5, 7 days. On days 1, 3, 5, 7 of fasting, one fasted group fish and one not fasting group fish were sacrificed and intestinal tract were collected. Previous study has shown that ghrelin levels return to basal levels 3 h after feeding (Amole and Unniappan, 2009). Thus, to study effect of refeeding on ghrelin expression level, the remaining unfed fish was refeeded on day 7 and sampled at 3 h post-refeeding. Total RNA was extracted as described above (Section 2.2). Subsequently, the effects of fasting on ghrelin expression were examined by real-time PT-PCR as described above (Section 2.3) and the β-actin was used as reference gene. 2.7. Statistical analysis All data are expressed as the mean ± SEM. Statistical analysis was performed using one-way ANOVA or Student's t-test with the SPSS 18.0 statistical software package (SPSS Inc., Chicago, IL, USA). Significant differences were identified when their values were less than 0.05 (p b 0.05).
region by assay of SignalP server software. Then the mature peptide begins (GTSFLSPAQKPQGRRPPRVGRR), at the third position is a serine residues, the same as other vertebrate in this site. There are two putative cleavage sites and amidation signals (GRR) at 12 and 19 amino acids (Figs. 1 and 2). The fragment after the mature peptide is C-terminal region which has 55 amino acids. As shown in Fig. 3, the phylogenetic analysis revealed the amino acid sequences of S. davidi ghrelin and other animal presented a high similarity with those of S. prenanti (99%), goldfish (94%), common carp (89.4%) and zebrafish (81.8%), as all four species were derived from the family Cyprinidae. However, lower identity was noted for other vertebrate species, e.g. 41–57% for other teleost species and 16–31% for tetrapod species. 3.2. Expression of ghrelin during embryonic development stages Real-time quantitative PCR was performed to evaluate the ghrelin expression of the early embryo of S. davidi. In addition, unfertilized eggs were examined. The result revealed that lower levels of expression were detected in unfertilized eggs, the newly fertilized eggs and cleavage stages. The S. davidi ghrelin mRNA was highly expressed from blastulation stage to hatch stage (Fig. 4). 3.3. The S. davidi ghrelin distribution in different tissues Real-time quantitative PCR was performed to detect the ghrelin expression levels in various tissues of S. davidi. The result showed high expression of ghrelin gene in the intestinal tract, moderate expression in the liver and low expression in the residual tissues (Fig. 5). 3.4. Fasting caused changes of ghrelin mRNA expression in S. davidi intestinal tract As shown in Fig. 6, the ghrelin mRNA expression level presented an ascendant trend in short-term fasting group (0, 0.5, 1.5, 3, 6, 9, 12 h post-fasting) compared to the fed group, but it did not reach the significant level on statistics (p N 0.05). To further explore the effect of fasting on ghrelin mRNA expression level, we assessed the ghrelin expression level during the long-term fasting stage (1, 3, 5, 7 days). As shown in Fig. 7, Ghrelin mRNA expression level during fasting increased in S. davidi intestinal tract, especially, fasting for 3, 5 and 7days produced a significant ascent (p b 0 .05), when compared to the expression levels in that of fed groups. Refeeding after a 7 day fasting caused a significant decrease compared to the expression levels in that of 7day fed groups in the gut of Schizothorax davidi. 4. Discussion
3. Results 3.1. Molecular cloning of S. davidi ghrelin The S. davidi ghrelin included 312bp nucleotides, which is a complete Open Reading Frame (Fig. 1; GenBank accession no. JN880422). The deduced amino acid sequence shows that the S. davidi ghrelin encoded 103 amino acid residues contain 26 amino acids of the signal peptide
In our study, we first obtained the 312 bp of ghrelin which encoded 103 amino acids of ORF from the gut of S. davidi which has high commercial value at fishery markets in China, and the ghrelin involved 26 amino acids of the signal peptide region. The mature peptide started immediately after the signal peptide and this indicated that protein will be secreted out of the cell after its synthesis (Von Heijne, 1992) which demonstrated it was the secreted protein.
Fig. 1. Nucleotide and predicted amino acid sequences of S. davidi ghrelin gene.
C. Zhou et al. / Gene 534 (2014) 72–77
75
Fig. 2. Multiple alignment of the deduced amino acid sequences of ghrelin in S. davidi and other animal.
Our results showed that predicted amino acid sequence of S. davidi ghrelin is highly conserved in the mature ghrelin peptide and less conservation in the signal peptide and the residual C-terminal peptide of the precursors (Fig. 2). This fact reflects the essentiality of ghrelin peptide in terms of its function. In particular, in the N-terminal portion of the mature ghrelin peptide, there is strong conservation of the first seven amino acid residues including a serine residue at the position, which is the site of acylation, an essential modification for receptor binding and biological activity (Muccioli et al., 2001). The N-terminal region is the biologically active segment of the ghrelin and the first four amino acids “GSSF” are considered to be the “active core” of the ghrelin peptide in mammals (Bednarek and Feighner, 2000), while the “active core” of ghrelin is “GTSF” as observed in S. davidi, similar to goldfish, zebrafish and Schizothorax prenanti (Amole and Unniappan, 2009; Wei et al., 2013). These conserved structures of the S. davidi ghrelin suggest that this peptide may be biologically active as a ligand
Fig. 3. Phylogenetic analysis of ghrelin amino acid sequences.
Fig. 4. Temporal expression pattern of S. davidi ghrelin mRNA at different stages of early embryonic development.
76
C. Zhou et al. / Gene 534 (2014) 72–77
Fig. 5. Expression of ghrelin gene in different organizations.
for GHS receptor. Furthermore, we found that the amino acid sequences of S. davidi ghrelin have high similarity to vertebrates, especially family Cyprinidae. It can be concluded that this ghrelin gene was rather conserved among different fish species. Previous studies reported that the expression of ghrelin and its receptors detected the embryonic stage (Li et al., 2009; Small et al., 2009). Our study reveals that ghrelin was expressed in early embryo and increased gradually until postnatal life, and that the level is influenced by proliferative conditions. Interestingly, its mRNA was also detectable in unfertilized eggs, suggesting that ghrelin could be classified as maternal mRNA. In fact, the expression of ghrelin increases during embryonic development with growth factors (Small et al., 2009). However, the effect of ghrelin on embryonic stage in the S. davidi remains for further investigation. A qualitative analysis using RT-PCR revealed expression of ghrelin mRNA in all tissues tested, including the liver and the gut. Wide distribution of ghrelin mRNA was found in human tissues (Gardner et al., 2011) and in the tissues of several fishes (Kaiya et al., 2008). The wide presence of ghrelin mRNA in tissues involved in the regulation of feeding, metabolism and reproduction suggests multiple functions for this peptide in S. davidi as well. The particular importance is the presence of ghrelin in the gut which is involved in the regulation of food intake, suggesting a potential role for ghrelin in feeding regulation, as discovered in other fish (Riley et al., 2005b; Unniappan et al., 2002; Yeung et al., 2006). Providing further support to a potential role of ghrelin in the regulation of energy balance, we assessed the effect of the short-term fasting, long-term fasting and refeeding in S. davidi. Our results showed that there was a tendency (P N 0.05) that the fasting fish group fed had higher ghrelin levels than fed fish group. Until the fasting at 3, 5 and 7 days, the ghrelin mRNA expression was significantly higher in gut compared to the control (p b 0.05). Fasting increased ghrelin mRNA expression in the gut of goldfish on day 7 of starvation (Unniappan and Peter, 2004). On the contrary, a decreased plasma ghrelin level
Fig. 7. Ghrelin mRNA expression in the gut of long-term fasting and re-feeding S. davidi.
was observed in rainbow trout during the fasting (Johnson et al., 2007). These results suggest that the ghrelin physiology varied from species to species in fish. Notably, in fish that were fed after a 7 day fast, ghrelin mRNA expression reduced dramatically within 3 h postfeeding, which are consistent with the previous study in other fish such as zebrafish and sea bass (Amole and Unniappan, 2009; Terova et al., 2008). Fasting causes an urge to eat and orexigenic signals play an important role in mediating this drive to eat (Kaiya et al., 2009b). The upregulation of ghrelin mRNA observed in our studies provides evidence for a role of ghrelin in fasting induced hunger drive. Although we are unable to conclude that a corresponding increase in blood levels of ghrelin occurs in S. davidi, it is possible that the increase in ghrelin mRNA expression is a reflection of a surge in circulating levels of ghrelin during long-term fasting. For example, a 7 day fasting caused an upregulation of ghrelin mRNA as well as an increase in serum ghrelin levels in goldfish. Intracerebroventricular and intraperitoneal injections of ghrelin cause an increase in food intake of goldfish (Matsuda et al., 2006b; Miura et al., 2007). Above all, in S. davidi, an increase in ghrelin mRNA expression in the gut suggests that ghrelin seems to be linked to growth and metabolism, seems to stimulate long-term appetite through a peripheral action, but does not stimulate short-term appetite. In conclusion, we report for the first time the ghrelin gene structure, mRNA expression level in different tissues and early embryo stage as well as the effect of fasting in S. davidi. The results reveal that the S. davidi ghrelin was widely expressed in the peripheral tissues, notably in the gut, and seems to stimulate long-term appetite through a peripheral action, but does not stimulate short-term appetite. These results suggested that the S. davidi ghrelin could also be a potent regulator of biological functions. Confirmation of the native ghrelin sequence in this report is expected to provide opportunities for further studies required to elucidate the physiological roles played by ghrelin in S. davidi. Conflict of interest statement The authors have nothing to disclose. Acknowledgments This study was supported by grants from the Major Project of Education Department in Sichuan (12ZA120) and the double branch plan of Sichuan Agricultural University (01570702). References
Fig. 6. Ghrelin mRNA expression in the gut of short-term fasting S. davidi.
Amole, N., Unniappan, S., 2009. Fasting induces preproghrelin mRNA expression in the brain and gut of zebrafish, Danio rerio. Gen. Comp. Endocrinol. 161, 133–137. Bednarek, M.A., Feighner, S.D., 2000. Structure–function studies on the new growth hormone-releasing peptide, ghrelin: minimal sequence of ghrelin necessary for
C. Zhou et al. / Gene 534 (2014) 72–77 activation of growth hormone secretagogue receptor 1a. J. Med. Chem. 43, 4370–4376. Feng, Ke, Zhang, Guirong, Xiong, Bangxi, 2013. Molecular cloning, tissue distribution, and ontogenetic expression of ghrelin and regulation of expression by fasting and refeeding in the grass carp (Ctenopharyngodon Idellus). J. Exp. Zool. A 319, 202–212. Gardner, M.K., Charlebois, B.D., Jánosi, I.M., Howard, J., Hunt, A.J., Odde, D.J., 2011. Rapid microtubule self-assembly kinetics. Cell 146, 582–592. Johnson, D.S., Bai, L., Smith, B.Y., Patel, S.S., Wang, M.D., 2007. Single-molecule studies reveal dynamics of DNA unwinding by the ring-shaped T7 helicase. Cell 129, 1299–1309. Jönsson, E., Kaiya, H., Björnsson, B.T., 2010. Ghrelin decreases food intake in juvenile rainbow trout (Oncorhynchus mykiss) through the central anorexigenic corticotropinreleasing factor system. Gen. Comp. Endocrinol. 166, 39–46. Kaiya, H., et al., 2003a. Peptide purification, complementary deoxyribonucleic acid (DNA) and genomic DNA cloning, and functional characterization of ghrelin in rainbow trout. Endocrinology 144, 5215–5226. Kaiya, H., et al., 2003b. Amidated fish ghrelin: purification, cDNA cloning in the Japanese eel and its biological activity. J. Endourol. 176, 415–423. Kaiya, H., et al., 2003c. Identification of tilapia ghrelin and its effects on growth hormone and prolactin release in the tilapia, Oreochromis mossambicus. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 135, 421–429. Kaiya, H., et al., 2005. Purification, cDNA cloning, and characterization of ghrelin in channel catfish, Ictalurus punctatus. Gen. Comp. Endocrinol. 143, 201–210. Kaiya, H., Miyazato, M., Kangawa, K., Peter, R.E., Unniappan, S., 2008. Ghrelin: a multifunctional hormone in non-mammalian vertebrates. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 149, 109–128. Kaiya, H., et al., 2009a. Ghrelin-like peptide with fatty acid modification and O-glycosylation in the red stingray, Dasyatis akajei. BMC Biotechnol. 10, 30. Kaiya, H., et al., 2009b. Identification and genomic sequence of a ghrelin receptor (GHS-R)-like receptor in the Mozambique tilapia, Oreochromis mossambicus. Zool. Sci. 26, 330–337. Kaiya, H., Miyazato, M., Kangawa, K., 2011. Recent advances in the phylogenetic study of ghrelin. Peptides 32, 2155–2174. Kang, K.S., Yahashi, S., Matsuda, K., 2011a. Central and peripheral effects of ghrelin on energy balance, food intake and lipid metabolism in teleost fish. Peptides 32, 2242–2247. Kang, K.S., Yahashi, S., Matsuda, K., 2011b. The effects of ghrelin on energy balance and psychomotor activity in a goldfish model: an overview. Int. J. Pept. 2011. Kawakoshi, A., et al., 2007. Identification of a ghrelin-like peptide in two species of shark, Sphyrna lewini and Carcharhinus melanopterus. Gen. Comp. Endocrinol. 151, 259–268. Kojima, M., Kangawa, K., 2005. Ghrelin: structure and function. Physiol. Rev. 85, 495–522. Kojima, M., Hosoda, H., Date, Y., Nakazato, M., Matsuo, H., Kangawa, K., 1999. Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature 402, 656–660. Kumar, S., Tamura, K., Nei, M., 2004. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinform. 5, 150–163. Li, X., He, J., Hu, W., Yin, Z., 2009. The essential role of endogenous ghrelin in growth hormone expression during zebrafish adenohypophysis development. Endocrinology 150, 2767–2774. Matsuda, K., et al., 2006a. Regulation of food intake by acyl and des-acyl ghrelins in the goldfish. Peptides 27, 2321–2325.
77
Matsuda, K., et al., 2006b. Stimulatory effect of n-octanoylated ghrelin on locomotor activity in the goldfish, Carassius auratus. Peptides 27, 1335–1340. Miura, T., et al., 2007. Regulation of food intake in the goldfish by interaction between ghrelin and orexin. Peptides 28, 1207–1213. Muccioli, G., Papotti, M., Locatelli, V., Ghigo, E., Deghenghi, R., 2001. Binding of 125I-labeled ghrelin to membranes from human hypothalamus and pituitary gland. J. Endocrinol. Invest. 24, 7–9. Parhar, I.S., Sato, H., Sakuma, Y., 2003. Ghrelin gene in cichlid fish is modulated by sex and development. Biochem. Biophys. Res. Commun. 305, 169–175. Riley, L.G., Fox, B.K., Kaiya, H., Hirano, T., Grau, E.G., 2005a. Long-term treatment of ghrelin stimulates feeding, fat deposition, and alters the GH/IGF-I axis in the tilapia, Oreochromis mossambicus. Gen. Comp. Endocrinol. 142, 234–240. Riley, L.G., Fox, B.K., Kaiya, H., Hirano, T., Grau, E.G., 2005b. Long-term treatment of ghrelin stimulates feeding, fat deposition, and alters the GH/IGF-I axis in the tilapia, Oreochromis mossambicus. Gen. Comp. Endocrinol. 142, 234. Shepherd, B.S., et al., 2007. Endocrine and orexigenic actions of growth hormone secretagogues in rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. A Mol. Integr. Physiol. 146, 390–399. Small, B.C., Quiniou, S., Kaiya, H., 2009. Sequence, genomic organization and expression of two channel catfish, Ictalurus punctatus, ghrelin receptors. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 154, 451–464. Suda, A., Kaiya, H., Nikaido, H., Shiozawa, S., Mishiro, K., Ando, H., 2012. Identification and gene expression analyses of ghrelin in the stomach of Pacific bluefin tuna (Thunnus orientalis). Gen. Comp. Endocrinol. 178, 89–97. Terova, G., Rimoldi, S., Bernardini, G., Gornati, R., Saroglia, M., 2008. Sea bass ghrelin: molecular cloning and mRNA quantification during fasting and refeeding. Gen. Comp. Endocrinol. 155, 341–351. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. Unniappan, S., Peter, R.E., 2004. In vitro and in vivo effects of ghrelin on luteinizing hormone and growth hormone release in goldfish. Am. J. Physiol. Regul. Integr. Comp. Physiol. 286, R1093–R1101. Unniappan, S., Peter, R.E., 2005. Structure, distribution and physiological functions of ghrelin in fish. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 140, 396–408. Unniappan, S., et al., 2002. Goldfish ghrelin: molecular characterization of the complementary deoxyribonucleic acid, partial gene structure and evidence for its stimulatory role in food intake. Endocrinology 143, 4143–4146. Unniappan, S., Canosa, L.F., Peter, R.E., 2004. Orexigenic actions of ghrelin in goldfish: feeding-induced changes in brain and gut mRNA expression and serum levels, and responses to central and peripheral injections. Neuroendocrinology 79, 100–108. Von Heijne, G., 1992. Membrane protein structure prediction: hydrophobicity analysis and the positive-inside rule. J. Mol. Biol. 225, 487–494. Wei, R., et al., 2013. Identification, tissue distribution and regulation of preproghrelin in the brain and gut of Schizothorax prenanti. Regul. Pept. 186, 18–25. Yeung, C.-M., Chan, C.-B., Woo, N.Y., Cheng, C.H., 2006. Seabream ghrelin: cDNA cloning, genomic organization and promoter studies. J. Endocrinol. 189, 365–379. Zhou, C., Zhang, X., Liu, T., Wei, R., Li, Z., 2012. Cloning and prokaryotic expression of ghrelin gene in crucian carp (Carassius auratus). Afr. J. Microbiol. Res. 6, 5222–5228.
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Schizothorax davidi ghrelin: cDNA cloning, tissue distribution and indication for its stimulatory character in food intake Chaowei Zhou 1, Xingdong Zhang 1, Tao Liu, Rongbin Wei, Dengyue Yuan, Tao Wang, Fangjun Lin, Hongwei Wu, Fu Chen, Shiyong Yang, Defang Chen, Yan Wang, Zhiqiong Li ⁎ Department of aquaculture, College of Animal Science and Technology, Sichuan Agricultural University, Ya'an, China
a r t i c l e
i n f o
Article history: Accepted 7 October 2013 Available online 12 October 2013 Keywords: Schizothorax davidi Ghrelin Short-term fasting Long-term fasting
a b s t r a c t Ghrelin is a gut/brain hormone with a unique acyl modification and various biological functions in fish and mammals. The objectives of this project were to identify ghrelin gene organization, study tissue specific ghrelin mRNA expression and investigate the short- (0, 0.5, 1.5, 3, 6, 9, 12 h post-fasting) and long- (1, 3, 5, 7 days) term fasting as well as refeeding after a 7 day fasting induced changes in the expression of ghrelin mRNA in Schizothorax davidi. Our reverse transcription polymerase chain reaction analysis confirmed the predicted ghrelin sequence available in the GenBank and identified ghrelin mRNA expression in several tissues including the gut, liver, brain, heart, spleen, head kidney, gill and muscle. Quantitative PCR studies indicated that the expression level of ghrelin mRNA presented ascendant trend in short-term fasting group compared to the fed group, but it did not reach the significant level on statistics, while there is a significant increase in ghrelin mRNA expression in the gut of Schizothorax davidi fasted for 3, 5 and 7 days when compared to the expression in ad libitum fed fish. Refeeding after a 7 day fasting caused a significant and dramatic decrease in ghrelin mRNA expression in the gut of Schizothorax davidi. An increase in the expression of ghrelin mRNA during fasting, and its decrease following refeeding suggests an orexigenic role for ghrelin in Schizothorax davidi. Overall, our results provide evidence for a highly conserved structure and biological actions of ghrelin during evolution. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Feeding in vertebrates is regulated through a complex interaction of several guts and brain derived neuroendocrine factors. Ghrelin, the first known intestine peptide that has stimulates food intake, is a 28 amino acid peptide in most creatures including the humans (Kojima et al., 1999). The acylation on the third serine residue of ghrelin is essential for its receptor binding and biological activity. Initially, ghrelin was heralded as the long sought endogenous ligand for the orphan growth hormone secretagogue receptor. Soon, however, it became evident that ghrelin was implicated in a variety of physiological processes, including cell proliferation, metabolism, cell protection, reproduction, among others (Kojima and Kangawa, 2005). Overall, ghrelin is a multifunctional hormone complicated directive of various physiological processed in several animal models. To date, ghrelin has been cloning from a number of fish, including goldfish (Carassius auratus) (Unniappan and Peter, 2005; Unniappan et al., 2002), Nile tilapia (Oreochromis niloticus) (Parhar et al., 2003), Mozambique tilapia (Oreochromis mossambicus) (Kaiya et al., 2009b), Japanese eel (Anguilla japonica) (Kaiya et al., 2003b), rainbow trout Abbreviations: GRLN-LP, Ghrelin-like peptide; GH, Growth hormone; MS-222, Tricainemethane sulfonate; ORF, Open reading frame; bp, Base pair. ⁎ Corresponding author. Tel.: +86 835 2885654. E-mail address: [email protected] (Z. Li). 1 Chaowei Zhou and Xingdong Zhang contributed equally to this work. 0378-1119/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.gene.2013.10.012
(Oncorhynchus mykiss) (Kaiya et al., 2003a), channel catfish (Ictalurus punctatus) (Kaiya et al., 2005), sea bream (Acanthopagrus schlegeli) (Yeung et al., 2006), crucian carp (Carassius auratus) (Zhou et al., 2012), Schizothorax prenanti (Wei et al., 2013) and grass carp (Ctenopharyngodon idellus) (Feng et al., 2013). Furthermore, ghrelin-like peptide (GRLN-LP) has been cloned in cartilaginous fish (Kaiya et al., 2009a; Kawakoshi et al., 2007). The peptides of teleost ghrelin and shark GRLN-LP have different lengths of 12–25 amino acid residues, and have acylation of the third amino acid residue like in mammalian ghrelin. However, peculiar to teleost ghrelin is that the carboxyl-terminus possesses an amide structure, which has not been detected in the tetrapod ghrelin and shark GRLN-LP (Suda et al., 2012). The effects of ghrelin on food intake were foreshadowed by a number of studies showing that ghrelin could increase food intake and adiposity via the stimulation of orexigenic peptides in the hypothalamic arcuate nucleus (Kaiya et al., 2008, 2011; Kang et al., 2011a,b). The studies about ghrelin stimulating growth hormone (GH) secretion have been shown in tilapia, goldfish and rainbow trout (Kaiya et al., 2003c; Shepherd et al., 2007; Unniappan and Peter, 2004). For example, in goldfish, both central and peripheral treatments with goldfish ghrelin increased feeding behavior (Matsuda et al., 2006a; Unniappan et al., 2002, 2004). Similarly, long-term peripheral treatment with native ghrelin increased food intake and caused body weight gain and hepatic fat deposition in Mozambique tilapia (Riley et al., 2005a). In contrast, central treatments with native ghrelin reduced food intake in juvenile
C. Zhou et al. / Gene 534 (2014) 72–77
rainbow trout (Jönsson et al., 2010). In addition, overexpression of the ghrelin gene in the brain and gut have been identified in goldfish after food deprivation for 7 days (Unniappan et al., 2004), while the changes of the ghrelin mRNA of the stomach was not significant in mature Nile tilapia after food deprivation for 7 days (Parhar et al., 2003). Various investigations have shown the presence and biological roles of ghrelin in fish, however, concepts about the biological functions of ghrelin is disputed, suggesting that further studies are required to clarify the physiological of functions ghrelin in fish (Kaiya et al., 2008). The S. davidi (Schizothorax davidi) is a cold water fish distributed only in China, which is raising a high economic value. However, slow growth rate has been recognized as a major problem in cold water fish, increasing the final production cost. In nature, S. davidi growth is relatively slow compared to common carp (weight increase about 40 g per year in S. david, while about 500 g–1000 g per year in common carp). In our previous study, we have identified ghrelin gene in S. prenanti (Schizothorax prenanti) (Wei et al., 2013) and crucian carp (Zhou et al., 2012) and found that ghrelin might be involved in the regulation of food intake. To investigate whether it has the same physiological function on feeding in S. davidi, we first isolated the cDNA and gene sequences encoding ghrelin in S. davidi in this study, and investigated the expression of ghrelin in different tissues of S. davidi. Additionally, using quantitative real-time PCR method, we examined the short- and long- term fasting as well as refeeding induced changes in ghrelin expression in S. davidi intestine tract. Our results showed that ghrelin is widely expressed in various tissues of the S. davidi, and had an orexigenic character in S. davidi.
73
Table 1 Primers sequences and function used in this study. Primer
Sequences(5′–3′)
Size of Applications the product
Ghrelin-A1 Ghrelin-S1 Ghrelin-A2 Ghrelin-S2 β-actin-A3 β-actin-S3
CGGATCCATGCCTCTGCG-TTGTCGT GCTCGAGTCAGAATTCAAGTGGGGAATCA CGAATGACGGGCTGCGTTGTCGT GAGAATTCAAGTGGCA AGGAAGGATGGCTGGAAAAGAG TTTGAGCAGGAGATGGGAACC
312 312 120 120 134 134
Cloning of ORF Cloning of ORF Real time PCR Real time PCR Real time PCR Real time PCR
PCR fragments were ligated into a pMD®19-T plasmid vector (TaKaRa, Dalian, China). The ligated plasmid was transformed into E. coli DH5α. Colonies having inserts were cultured overnight in LB medium at 37 °C, extracted using OMEGA Mini Plasmid Kit and sequenced by automated sequence analysis (TaKaRa, Dalian, China). Once the sequence was confirmed, tissue distribution of ghrelin mRNA was performed in heart, spleen, head kidney, liver, brain, intestinal tract, gill and muscle. Real-time PCR of ghrelin was carried out on the CFX96 Real-Time PCR (Bio-Rad) using SYBR Green (TaKaRa, Dalian, China). The primers used in the real-time PCR are listed in Table 1. All real-time PCR reactions were performed in triplicate. Each one PCR mixture (25 μL) contained 12.5 μL of 2 × SYBRR Premix Ex Tap™ (TaKaRa, Dalian, China), 0.5 μL of each primer, 2.5 μL of cDNA and 9.5 μL of RNase Free H2O. The amplification condition was: 95 °C for 30 s × 1 followed by 95 °C 5 s, 60 °C 30 s × 45. The β-actin was used as housekeeping gene in this study. The 2−ΔΔCt method was used to determine the relative mRNA abundance for the surveyed samples.
2. Materials and methods 2.1. Animals and samples Five males and five females of S. davidi, with average body weight of 100±6.3g, were purchased from a local fish nursery in Ya'an city, China, and were transported to the laboratory in College of Animal Science and Technology, Sichuan Agricultural University. The fish were maintained under a natural photoperiod at 20 °C in a circulating aquarium system for 2 weeks before the experiments began. The S. davidi were fed with commercial diet (40% crude protein, 6% fat) (Haida, Guangzhou, China) to satiety twice a day at 8:00 and 16:00 for 30 min. Fish were anesthetized in 0.02% tricainemethane sulfonate (MS-222) before being sacrificed. The tissues were frequently removed and stored frozen at liquid nitrogen until RNA isolation. All studies were approved by the Sichuan Agriculture University Animal Care Committee. 2.2. Total RNA extraction Total RNA was extracted from the heart, spleen, head kidney, liver, brain, intestinal tract, gill and muscle tissues using TRIzol A+ reagent (TaKaRa, Dalian, China) according to the manufacturer's instructions. Total RNA concentrations of all samples were determined by a photometer (Bio-Rad) fixed at 260 nm and 280 nm wavelengths. Total RNA was stored at − 80 °C immediately until the next step was conducted. 2.3. Cloning of ghrelin ORF and tissue distributions analysis In order to clone S. davidi ghrelin ORF, one pair of primers (Table 1) was designed based on other fish ghrelin sequences recorded in the NCBI Genbank. A total volume of 25 μL reaction system contained 12.5 μL 2 × dNTP Mix (Invitrogen), 1.25 μL each of sense primer and antisense primers (10 μM), 2.5 μL cDNA and 7.5 μL ddH2O (Invitrogen). PCR parameters were: 94 °C for 5 min × 1 followed by 94 °C 30 s, 58 °C 30 s, 72 °C 30 s × 30, and 72 °C 8 min. The PCR products were parted in 1.5% agarose gel electrophoresis, then the target bands were extracted by Universal DNA Purification Kit (TIANGEN, Beijing, China). Then the
2.4. Structural analysis Multiple sequence alignments were generated using the clustalx1.83. The cleavage site of the signal peptide was estimated using SignalP Ver. 4.0 program (http://www.cbs.dtu.dk/services/SignalP/). A phylogenetic tree based on the amino acid sequences was constructed by the neighbor-joining method of the Clustal W (http://www.ddbj.nig.ac.jp/ search/clustalw-e.html) (Thompson et al., 1994) and MEGA 5.1 program (http://www.megasoftware.net/index.html) (Kumar et al., 2004). 2.5. Real-time quantitative RT-PCR (qPCR) in early embryo The ghrelin expression during embryogenesis was determined using qPCR. The mating pond consisted of a 2 × 3 × 0.8 m3 pond with constant aeration. Cleaned floating aquatic plants were put into the pond for bubble nest building (placing fish eggs). For mating, four female and two male fish (1:2 male-to-female sex ratio) were injected with a mixture of LHRH analogue (Mocell, Shanghai, China) and domperidone (Huyu, Shanghai, China) (LHRH and domperidone were used to improve fish artificial propagation in aquaculture) for the first injection, each at 15 mg/kg and 20 mg/kg bodyweight, respectively. Twelve hours later, female fish received a second injection of a mixture of LHRH analogue (20 μg/kg bodyweight) and domperidone (10 mg/kg bodyweight). After 14 h, fertilized eggs were collected at unfertilized eggs, 1 h post spawning (hps), cleavage (8 hps), morula stage (12 hps), blastulation (14 hps), gastrulation (32 hps), organogenesis (63 hps), embryonic mobility (105 hps), vascularization (175 hps), hatch (185 hps) for cDNA synthesis, and verified microscopically. The S. davidi ghrelin expression during embryogenesis was analyzed by qPCR using SYBR Premix Ex Tap−2(Perfect real time) (TaKaRa, Dalian, China) according to the manufacturer's instructions. Primer set for the qPCR of ghrelin was designed in the obtained nucleotide sequence (Table 1). The PCR was conducted at 95 °C for 10 min, then 44 reaction cycles were run, each consisting of 15 s at 95 °C, 15 s at 60 °C, and 20 s at 72 °C. The β-actin was also amplified as an internal standard. A single melting peak was detected by melting temperature
74
C. Zhou et al. / Gene 534 (2014) 72–77
analyses. The confirmed PCR efficiency was close to the theoretical PCR efficiency. All samples for mRNA analysis were run once in a single assay. The gene expression levels were calculated using the PCR products standard and CFX96 (Bio-Rad Laboratories Inc.). 2.6. Fasting caused changes of ghrelin mRNA expression in S. davidi intestinal tract To evaluate the effects of evaluate the effects of the short-term and long-term fasting, fed and fasted groups of S. davidi (average body weight 50 ± 4.9 g, 1:1 male-to-female sex ratio) (n = 30 × 6, three fed tanks and three unfed tanks were replicated) were sampled in six glass aquariums (100 × 65 × 75 cm3) at Sichuan Agricultural University Farm. The animals were temporary cultured in water insured stable aeration and temperature at 20 °C in a natural photoperiod. All fish were hand-fed commercial feed two meals everyday at 8:00 and 16:00 for 7 days. After 2 weeks of feeding, three groups of fish endured fasting, while other three groups of fish were fed as before. Ten fish were randomly sampled by dipnet at selected times after termination of feeding (0, 0.5, 1.5, 3, 6, 9, 12 h post-fasting). The 0 time fish was taken at 8:00. The sampling of unfed fish prior to feeding (time 0) was done to assess gene expression prior to normal feeding time, reducing the disturbance and potential stress effects on normal feeding behavior and gene expression of the fed fish group. The rest of the fish (fed control) were randomly sampled from a feeding tank with continuous feeding. Subsequently, the feeding was stopped for 1, 3, 5, 7 days. On days 1, 3, 5, 7 of fasting, one fasted group fish and one not fasting group fish were sacrificed and intestinal tract were collected. Previous study has shown that ghrelin levels return to basal levels 3 h after feeding (Amole and Unniappan, 2009). Thus, to study effect of refeeding on ghrelin expression level, the remaining unfed fish was refeeded on day 7 and sampled at 3 h post-refeeding. Total RNA was extracted as described above (Section 2.2). Subsequently, the effects of fasting on ghrelin expression were examined by real-time PT-PCR as described above (Section 2.3) and the β-actin was used as reference gene. 2.7. Statistical analysis All data are expressed as the mean ± SEM. Statistical analysis was performed using one-way ANOVA or Student's t-test with the SPSS 18.0 statistical software package (SPSS Inc., Chicago, IL, USA). Significant differences were identified when their values were less than 0.05 (p b 0.05).
region by assay of SignalP server software. Then the mature peptide begins (GTSFLSPAQKPQGRRPPRVGRR), at the third position is a serine residues, the same as other vertebrate in this site. There are two putative cleavage sites and amidation signals (GRR) at 12 and 19 amino acids (Figs. 1 and 2). The fragment after the mature peptide is C-terminal region which has 55 amino acids. As shown in Fig. 3, the phylogenetic analysis revealed the amino acid sequences of S. davidi ghrelin and other animal presented a high similarity with those of S. prenanti (99%), goldfish (94%), common carp (89.4%) and zebrafish (81.8%), as all four species were derived from the family Cyprinidae. However, lower identity was noted for other vertebrate species, e.g. 41–57% for other teleost species and 16–31% for tetrapod species. 3.2. Expression of ghrelin during embryonic development stages Real-time quantitative PCR was performed to evaluate the ghrelin expression of the early embryo of S. davidi. In addition, unfertilized eggs were examined. The result revealed that lower levels of expression were detected in unfertilized eggs, the newly fertilized eggs and cleavage stages. The S. davidi ghrelin mRNA was highly expressed from blastulation stage to hatch stage (Fig. 4). 3.3. The S. davidi ghrelin distribution in different tissues Real-time quantitative PCR was performed to detect the ghrelin expression levels in various tissues of S. davidi. The result showed high expression of ghrelin gene in the intestinal tract, moderate expression in the liver and low expression in the residual tissues (Fig. 5). 3.4. Fasting caused changes of ghrelin mRNA expression in S. davidi intestinal tract As shown in Fig. 6, the ghrelin mRNA expression level presented an ascendant trend in short-term fasting group (0, 0.5, 1.5, 3, 6, 9, 12 h post-fasting) compared to the fed group, but it did not reach the significant level on statistics (p N 0.05). To further explore the effect of fasting on ghrelin mRNA expression level, we assessed the ghrelin expression level during the long-term fasting stage (1, 3, 5, 7 days). As shown in Fig. 7, Ghrelin mRNA expression level during fasting increased in S. davidi intestinal tract, especially, fasting for 3, 5 and 7days produced a significant ascent (p b 0 .05), when compared to the expression levels in that of fed groups. Refeeding after a 7 day fasting caused a significant decrease compared to the expression levels in that of 7day fed groups in the gut of Schizothorax davidi. 4. Discussion
3. Results 3.1. Molecular cloning of S. davidi ghrelin The S. davidi ghrelin included 312bp nucleotides, which is a complete Open Reading Frame (Fig. 1; GenBank accession no. JN880422). The deduced amino acid sequence shows that the S. davidi ghrelin encoded 103 amino acid residues contain 26 amino acids of the signal peptide
In our study, we first obtained the 312 bp of ghrelin which encoded 103 amino acids of ORF from the gut of S. davidi which has high commercial value at fishery markets in China, and the ghrelin involved 26 amino acids of the signal peptide region. The mature peptide started immediately after the signal peptide and this indicated that protein will be secreted out of the cell after its synthesis (Von Heijne, 1992) which demonstrated it was the secreted protein.
Fig. 1. Nucleotide and predicted amino acid sequences of S. davidi ghrelin gene.
C. Zhou et al. / Gene 534 (2014) 72–77
75
Fig. 2. Multiple alignment of the deduced amino acid sequences of ghrelin in S. davidi and other animal.
Our results showed that predicted amino acid sequence of S. davidi ghrelin is highly conserved in the mature ghrelin peptide and less conservation in the signal peptide and the residual C-terminal peptide of the precursors (Fig. 2). This fact reflects the essentiality of ghrelin peptide in terms of its function. In particular, in the N-terminal portion of the mature ghrelin peptide, there is strong conservation of the first seven amino acid residues including a serine residue at the position, which is the site of acylation, an essential modification for receptor binding and biological activity (Muccioli et al., 2001). The N-terminal region is the biologically active segment of the ghrelin and the first four amino acids “GSSF” are considered to be the “active core” of the ghrelin peptide in mammals (Bednarek and Feighner, 2000), while the “active core” of ghrelin is “GTSF” as observed in S. davidi, similar to goldfish, zebrafish and Schizothorax prenanti (Amole and Unniappan, 2009; Wei et al., 2013). These conserved structures of the S. davidi ghrelin suggest that this peptide may be biologically active as a ligand
Fig. 3. Phylogenetic analysis of ghrelin amino acid sequences.
Fig. 4. Temporal expression pattern of S. davidi ghrelin mRNA at different stages of early embryonic development.
76
C. Zhou et al. / Gene 534 (2014) 72–77
Fig. 5. Expression of ghrelin gene in different organizations.
for GHS receptor. Furthermore, we found that the amino acid sequences of S. davidi ghrelin have high similarity to vertebrates, especially family Cyprinidae. It can be concluded that this ghrelin gene was rather conserved among different fish species. Previous studies reported that the expression of ghrelin and its receptors detected the embryonic stage (Li et al., 2009; Small et al., 2009). Our study reveals that ghrelin was expressed in early embryo and increased gradually until postnatal life, and that the level is influenced by proliferative conditions. Interestingly, its mRNA was also detectable in unfertilized eggs, suggesting that ghrelin could be classified as maternal mRNA. In fact, the expression of ghrelin increases during embryonic development with growth factors (Small et al., 2009). However, the effect of ghrelin on embryonic stage in the S. davidi remains for further investigation. A qualitative analysis using RT-PCR revealed expression of ghrelin mRNA in all tissues tested, including the liver and the gut. Wide distribution of ghrelin mRNA was found in human tissues (Gardner et al., 2011) and in the tissues of several fishes (Kaiya et al., 2008). The wide presence of ghrelin mRNA in tissues involved in the regulation of feeding, metabolism and reproduction suggests multiple functions for this peptide in S. davidi as well. The particular importance is the presence of ghrelin in the gut which is involved in the regulation of food intake, suggesting a potential role for ghrelin in feeding regulation, as discovered in other fish (Riley et al., 2005b; Unniappan et al., 2002; Yeung et al., 2006). Providing further support to a potential role of ghrelin in the regulation of energy balance, we assessed the effect of the short-term fasting, long-term fasting and refeeding in S. davidi. Our results showed that there was a tendency (P N 0.05) that the fasting fish group fed had higher ghrelin levels than fed fish group. Until the fasting at 3, 5 and 7 days, the ghrelin mRNA expression was significantly higher in gut compared to the control (p b 0.05). Fasting increased ghrelin mRNA expression in the gut of goldfish on day 7 of starvation (Unniappan and Peter, 2004). On the contrary, a decreased plasma ghrelin level
Fig. 7. Ghrelin mRNA expression in the gut of long-term fasting and re-feeding S. davidi.
was observed in rainbow trout during the fasting (Johnson et al., 2007). These results suggest that the ghrelin physiology varied from species to species in fish. Notably, in fish that were fed after a 7 day fast, ghrelin mRNA expression reduced dramatically within 3 h postfeeding, which are consistent with the previous study in other fish such as zebrafish and sea bass (Amole and Unniappan, 2009; Terova et al., 2008). Fasting causes an urge to eat and orexigenic signals play an important role in mediating this drive to eat (Kaiya et al., 2009b). The upregulation of ghrelin mRNA observed in our studies provides evidence for a role of ghrelin in fasting induced hunger drive. Although we are unable to conclude that a corresponding increase in blood levels of ghrelin occurs in S. davidi, it is possible that the increase in ghrelin mRNA expression is a reflection of a surge in circulating levels of ghrelin during long-term fasting. For example, a 7 day fasting caused an upregulation of ghrelin mRNA as well as an increase in serum ghrelin levels in goldfish. Intracerebroventricular and intraperitoneal injections of ghrelin cause an increase in food intake of goldfish (Matsuda et al., 2006b; Miura et al., 2007). Above all, in S. davidi, an increase in ghrelin mRNA expression in the gut suggests that ghrelin seems to be linked to growth and metabolism, seems to stimulate long-term appetite through a peripheral action, but does not stimulate short-term appetite. In conclusion, we report for the first time the ghrelin gene structure, mRNA expression level in different tissues and early embryo stage as well as the effect of fasting in S. davidi. The results reveal that the S. davidi ghrelin was widely expressed in the peripheral tissues, notably in the gut, and seems to stimulate long-term appetite through a peripheral action, but does not stimulate short-term appetite. These results suggested that the S. davidi ghrelin could also be a potent regulator of biological functions. Confirmation of the native ghrelin sequence in this report is expected to provide opportunities for further studies required to elucidate the physiological roles played by ghrelin in S. davidi. Conflict of interest statement The authors have nothing to disclose. Acknowledgments This study was supported by grants from the Major Project of Education Department in Sichuan (12ZA120) and the double branch plan of Sichuan Agricultural University (01570702). References
Fig. 6. Ghrelin mRNA expression in the gut of short-term fasting S. davidi.
Amole, N., Unniappan, S., 2009. Fasting induces preproghrelin mRNA expression in the brain and gut of zebrafish, Danio rerio. Gen. Comp. Endocrinol. 161, 133–137. Bednarek, M.A., Feighner, S.D., 2000. Structure–function studies on the new growth hormone-releasing peptide, ghrelin: minimal sequence of ghrelin necessary for
C. Zhou et al. / Gene 534 (2014) 72–77 activation of growth hormone secretagogue receptor 1a. J. Med. Chem. 43, 4370–4376. Feng, Ke, Zhang, Guirong, Xiong, Bangxi, 2013. Molecular cloning, tissue distribution, and ontogenetic expression of ghrelin and regulation of expression by fasting and refeeding in the grass carp (Ctenopharyngodon Idellus). J. Exp. Zool. A 319, 202–212. Gardner, M.K., Charlebois, B.D., Jánosi, I.M., Howard, J., Hunt, A.J., Odde, D.J., 2011. Rapid microtubule self-assembly kinetics. Cell 146, 582–592. Johnson, D.S., Bai, L., Smith, B.Y., Patel, S.S., Wang, M.D., 2007. Single-molecule studies reveal dynamics of DNA unwinding by the ring-shaped T7 helicase. Cell 129, 1299–1309. Jönsson, E., Kaiya, H., Björnsson, B.T., 2010. Ghrelin decreases food intake in juvenile rainbow trout (Oncorhynchus mykiss) through the central anorexigenic corticotropinreleasing factor system. Gen. Comp. Endocrinol. 166, 39–46. Kaiya, H., et al., 2003a. Peptide purification, complementary deoxyribonucleic acid (DNA) and genomic DNA cloning, and functional characterization of ghrelin in rainbow trout. Endocrinology 144, 5215–5226. Kaiya, H., et al., 2003b. Amidated fish ghrelin: purification, cDNA cloning in the Japanese eel and its biological activity. J. Endourol. 176, 415–423. Kaiya, H., et al., 2003c. Identification of tilapia ghrelin and its effects on growth hormone and prolactin release in the tilapia, Oreochromis mossambicus. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 135, 421–429. Kaiya, H., et al., 2005. Purification, cDNA cloning, and characterization of ghrelin in channel catfish, Ictalurus punctatus. Gen. Comp. Endocrinol. 143, 201–210. Kaiya, H., Miyazato, M., Kangawa, K., Peter, R.E., Unniappan, S., 2008. Ghrelin: a multifunctional hormone in non-mammalian vertebrates. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 149, 109–128. Kaiya, H., et al., 2009a. Ghrelin-like peptide with fatty acid modification and O-glycosylation in the red stingray, Dasyatis akajei. BMC Biotechnol. 10, 30. Kaiya, H., et al., 2009b. Identification and genomic sequence of a ghrelin receptor (GHS-R)-like receptor in the Mozambique tilapia, Oreochromis mossambicus. Zool. Sci. 26, 330–337. Kaiya, H., Miyazato, M., Kangawa, K., 2011. Recent advances in the phylogenetic study of ghrelin. Peptides 32, 2155–2174. Kang, K.S., Yahashi, S., Matsuda, K., 2011a. Central and peripheral effects of ghrelin on energy balance, food intake and lipid metabolism in teleost fish. Peptides 32, 2242–2247. Kang, K.S., Yahashi, S., Matsuda, K., 2011b. The effects of ghrelin on energy balance and psychomotor activity in a goldfish model: an overview. Int. J. Pept. 2011. Kawakoshi, A., et al., 2007. Identification of a ghrelin-like peptide in two species of shark, Sphyrna lewini and Carcharhinus melanopterus. Gen. Comp. Endocrinol. 151, 259–268. Kojima, M., Kangawa, K., 2005. Ghrelin: structure and function. Physiol. Rev. 85, 495–522. Kojima, M., Hosoda, H., Date, Y., Nakazato, M., Matsuo, H., Kangawa, K., 1999. Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature 402, 656–660. Kumar, S., Tamura, K., Nei, M., 2004. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinform. 5, 150–163. Li, X., He, J., Hu, W., Yin, Z., 2009. The essential role of endogenous ghrelin in growth hormone expression during zebrafish adenohypophysis development. Endocrinology 150, 2767–2774. Matsuda, K., et al., 2006a. Regulation of food intake by acyl and des-acyl ghrelins in the goldfish. Peptides 27, 2321–2325.
77
Matsuda, K., et al., 2006b. Stimulatory effect of n-octanoylated ghrelin on locomotor activity in the goldfish, Carassius auratus. Peptides 27, 1335–1340. Miura, T., et al., 2007. Regulation of food intake in the goldfish by interaction between ghrelin and orexin. Peptides 28, 1207–1213. Muccioli, G., Papotti, M., Locatelli, V., Ghigo, E., Deghenghi, R., 2001. Binding of 125I-labeled ghrelin to membranes from human hypothalamus and pituitary gland. J. Endocrinol. Invest. 24, 7–9. Parhar, I.S., Sato, H., Sakuma, Y., 2003. Ghrelin gene in cichlid fish is modulated by sex and development. Biochem. Biophys. Res. Commun. 305, 169–175. Riley, L.G., Fox, B.K., Kaiya, H., Hirano, T., Grau, E.G., 2005a. Long-term treatment of ghrelin stimulates feeding, fat deposition, and alters the GH/IGF-I axis in the tilapia, Oreochromis mossambicus. Gen. Comp. Endocrinol. 142, 234–240. Riley, L.G., Fox, B.K., Kaiya, H., Hirano, T., Grau, E.G., 2005b. Long-term treatment of ghrelin stimulates feeding, fat deposition, and alters the GH/IGF-I axis in the tilapia, Oreochromis mossambicus. Gen. Comp. Endocrinol. 142, 234. Shepherd, B.S., et al., 2007. Endocrine and orexigenic actions of growth hormone secretagogues in rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. A Mol. Integr. Physiol. 146, 390–399. Small, B.C., Quiniou, S., Kaiya, H., 2009. Sequence, genomic organization and expression of two channel catfish, Ictalurus punctatus, ghrelin receptors. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 154, 451–464. Suda, A., Kaiya, H., Nikaido, H., Shiozawa, S., Mishiro, K., Ando, H., 2012. Identification and gene expression analyses of ghrelin in the stomach of Pacific bluefin tuna (Thunnus orientalis). Gen. Comp. Endocrinol. 178, 89–97. Terova, G., Rimoldi, S., Bernardini, G., Gornati, R., Saroglia, M., 2008. Sea bass ghrelin: molecular cloning and mRNA quantification during fasting and refeeding. Gen. Comp. Endocrinol. 155, 341–351. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. Unniappan, S., Peter, R.E., 2004. In vitro and in vivo effects of ghrelin on luteinizing hormone and growth hormone release in goldfish. Am. J. Physiol. Regul. Integr. Comp. Physiol. 286, R1093–R1101. Unniappan, S., Peter, R.E., 2005. Structure, distribution and physiological functions of ghrelin in fish. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 140, 396–408. Unniappan, S., et al., 2002. Goldfish ghrelin: molecular characterization of the complementary deoxyribonucleic acid, partial gene structure and evidence for its stimulatory role in food intake. Endocrinology 143, 4143–4146. Unniappan, S., Canosa, L.F., Peter, R.E., 2004. Orexigenic actions of ghrelin in goldfish: feeding-induced changes in brain and gut mRNA expression and serum levels, and responses to central and peripheral injections. Neuroendocrinology 79, 100–108. Von Heijne, G., 1992. Membrane protein structure prediction: hydrophobicity analysis and the positive-inside rule. J. Mol. Biol. 225, 487–494. Wei, R., et al., 2013. Identification, tissue distribution and regulation of preproghrelin in the brain and gut of Schizothorax prenanti. Regul. Pept. 186, 18–25. Yeung, C.-M., Chan, C.-B., Woo, N.Y., Cheng, C.H., 2006. Seabream ghrelin: cDNA cloning, genomic organization and promoter studies. J. Endocrinol. 189, 365–379. Zhou, C., Zhang, X., Liu, T., Wei, R., Li, Z., 2012. Cloning and prokaryotic expression of ghrelin gene in crucian carp (Carassius auratus). Afr. J. Microbiol. Res. 6, 5222–5228.
