Chronobiology International, 2015; 32(1): 59–70 ! Informa Healthcare USA, Inc. ISSN: 0742-0528 print / 1525-6073 online DOI: 10.3109/07420528.2014.955185
ORIGINAL ARTICLE
Seasonal postembryonic maturation of the diurnal rhythm of serotonin in the chicken pineal gland Aneta Piesiewicz, Urszula Kedzierska, Elzbieta Turkowska, Iwona Adamska, and Pawel M. Majewski Department of Animal Physiology, Faculty of Biology, University of Warsaw, Poland
Previously, we have demonstrated the postembryonic development of chicken (Gallus gallus domesticus L.) pineal gland functions expressed as changes in melatonin (MEL) biosynthesis. Pineal concentrations of MEL and its precursor serotonin (5-HT) were shown to increase between the 2nd and 16th day of life. We also found that levels of the mRNAs encoding the enzymes participating in the final two steps of MEL biosynthesis from 5-HT: arylalkylamineN-acetyltransferase (AANAT) and hydroxyindole-O-methyltransferase (HIOMT), as well as their enzymatic activities, were raised during postembryonic development. Moreover, the manner of these changes was season-of-hatch dependent, even in animals kept under constant laboratory conditions (L:D 12:12). The most pronounced changes were seen in the concentrations of 5-HT and MEL, as well as in Aanat mRNA level and its enzymatic activity. The high daily variability in 5-HT content suggested that season- and age-dependent changes in the activity of the chicken pineal gland might rely on the availability of 5-HT, i.e. it may be limited by changes in pineal tryptophan (TRP) and/or 5-hydroxytryptophan (5-HTP) levels as well as by the activity of tryptophan hydroxylase (TPH) and aromatic L-amino acid decarboxylase (AADC): two enzymes participating in the conversion of TRP to 5-HT. The present study was undertaken with the following objectives: (1) to examine whether the pineal concentration of the 5-HT precursors TRP and 5-HTP exhibit age- and season-related changes; (2) to look for season-related differences in the transcription of the Tph1 and Ddc genes encoding enzymes TPH and AADC; (3) to identify the step(s) in postembryonic development in which these season-related variations in pineal gland function are most pronounced. Male Hy-line chickens hatched in the summer or winter, from eggs laid by hens held in L:D 16:8 conditions were kept from the day of hatch in L:D 12:12 conditions. At the age of 2 or 9 days, animals were sacrificed every 2 or 4 h over a 24-h period and their pineal glands were isolated under dim red light and processed for the measurement of (i) the pineal content of TRP, 5-HTP and 5-HT, and (ii) the level of Tph1 and Ddc mRNAs. Circadian rhythmicity of all the measured parameters was evaluated by the cosinor method. The pineal levels of TRP and 5-HT as well as the Tph1 and Ddc transcripts changed during postembryonic development in a season-related way. Whereas, the 5-HTP concentration did not vary between animals from both age groups, regardless of the season. Circadian rhythmicity of all the measured parameters was dependent on both the age and the season of hatch, and was greatest in older animals in the summer. These findings indicated that the efficiency of season-related MEL biosynthesis, reported previously, is limited by 5-HT availability and this limitation depends on the transcription of both the Tph1 and Ddc genes. Moreover, Ddc mRNA level in 9-d-old birds changed rhythmically, even though this gene is generally considered to be arrhythmic. Keywords: 5-Hydroxytryptophan, aromatic L-amino acid decarboxylase, birds, chronobiology, photoperiodic memory, rhythmicity, tryptophan hydroxylase, tryptophan
INTRODUCTION
decarboxylase gene (Ddc), converts 5-HTP to 5-hydroxytryptamine (serotonin, 5-HT) (Lovenberg et al., 1962). 5-HT is then transformed to N-acetylserotonin (NAS) by arylalkylamine-N-acetyltransferase (AANAT; E.C. 2.3.1.87), encoded by the arylalkylamine-N-acetyltransferase gene (Aanat) (Bernard et al., 1997). Finally, hydroxyindole-O-methyltransferase (HIOMT; E.C.2.1.1.4), encoded by the acetylserotonin O-methyltransferase gene (Asmt), converts NAS to MEL (Voisin et al., 1992). The genes encoding each of the enzymes participating in the MEL biosynthetic pathway have
The biosynthesis of melatonin (MEL) is a wellcharacterized sequence of enzymatic reactions starting with the hydroxylation of the essential amino acid tryptophan (TRP) to 5-hydroxytryptophan (5-HTP), catalyzed by tryptophan hydroxylase (TPH; E.C. 1.14.16.4), which in chickens is encoded by the tryptophan hydroxylase 1 gene (Tph1) (Chong et al., 2000). The next enzyme, aromatic L-amino acid decarboxylase (AADC; E.C.4.1.1.28), encoded by the dopa
Submitted May 30, 2014, Returned for revision July 23, 2014, Accepted August 11, 2014
Correspondence: Pawel M. Majewski, Department of Animal Physiology, Faculty of Biology, University of Warsaw, Miecznikowa 1, 02-096 Warsaw, Poland. E-mail: [email protected]
59
60
A. Piesiewicz et al.
been indentified in several species, cloned and sequenced. In the chicken (Gallus gallus domesticus L.), at least three of these enzymes, TPH, AANAT and HIOMT, are regulated indirectly by the molecular clock within pinealocytes and directly by light at the transcriptional, translational and post-translational levels, so the pineal MEL biosynthesis is a rhythmic dynamic process (Cassone, 2014). MEL is an universal and multifunctional molecule found in both vertebrates and invertebrates (Markowska et al., 2009; Reiter et al., 2010). In vertebrates, this hormone, synthesized in the pineal gland, is known to regulate many physiological processes such as seasonal reproduction (Pang et al., 1998), locomotor activity (Underwood et al., 2001) and immunity (Guerrero & Reiter, 2002; Majewski et al., 2005a, b; Piesiewicz et al., 2012a; Turkowska et al., 2013). The biosynthesis of MEL is controlled by central regulatory factors including the neurotransmitters released from the autonomic nervous system and the plasticity of the SCN-pineal circuit (Borjigin et al., 2012). Moreover, like other hormones, MEL biosynthesis may be regulated by peripheral oscillators (Bebas et al., 2009). A notable finding of studies on the circadian rhythm of MEL biosynthesis is the postembryonic maturation of this process. The MEL rhythm was demonstrated in vivo in the pineal glands and eyes of 18- and 20-d-old chicken embryos incubated in L:D 16:8 conditions (Zeman et al., 1992). Moreover, when eggs were incubated in L:D 12:12 conditions the expression of Aanat mRNA exhibited increasing amplitude from the 16th day of embryonic life (Herichova et al., 2001). Similarly, in vitro studies have revealed the circadian rhythm of MEL release from pinealocytes isolated from 18-d-old chicken embryos and kept in constant darkness (Akasaka et al., 1995). Unfortunately, in the above reports, the season of hatch was not mentioned. However, an early study in our laboratory, conducted on 3-wk-old chickens, kept from the day of hatch under controlled laboratory conditions (L:D 12:12), indicated that the peak of nocturnal activity of pineal AANAT, the enzyme thought to be responsible for MEL rhythmicity, is shifted depending on the season (Majewski et al., 2005a). Thereafter, we identified an age-related postembryonic increase in pineal AANAT activity in chickens hatched in both seasons, i.e. ‘‘winter’’ or ‘‘summer’’ birds (Skwarlo-Sonta et al., 2011). Recently, we found that the circadian rhythm of the Aanat mRNA level, its encoded enzyme activity, as well as the 5-HT and MEL contents of the pineal gland developed more slowly in ‘‘winter’’ animals than in ‘‘summer’’ ones (Piesiewicz et al., 2012b). These differences persisted until the 9th d post-hatch, but were no longer seen in 16-d-old chickens. The only exception was the rhythm of Asmt transcription, where the lowest amplitude was observed in 2-d-old birds hatched in the summer. Interestingly, the pineal 5-HT content
exhibited daily variability in chickens hatched in both seasons, regardless of their age. However, the observed changes were not rhythmical in ‘‘winter’’ animals. These results suggest that chickens kept from the day of hatch under artificial light conditions are able to recognize the natural season and/or artificial light-induced reproduction of birds affects pineal functions (Piesiewicz et al., 2012b). Taken together, these findings led us to hypothesize that postembryonic maturation of MEL biosynthesis in the chicken pineal gland is limited by the availability of 5-HT. Thus, the present study was undertaken to determine the influence of age and the season of hatch on the diurnal rhythm of particular steps in 5-HT biosynthesis in the chicken pineal gland. We have examined daily changes in the pineal content of the 5-HT precursors 5-HTP and TRP as well as changes in the mRNA levels of the Tph1 and Ddc genes encoding enzymes that participate in 5-HT biosynthesis. All experiments were performed on 2- and 9-d-old male chickens, kept from the day of hatch in L:D 12:12 conditions.
MATERIALS AND METHODS Animals and experimental design Experiments were performed on male Hy-Line chickens hatched in winter (January) and summer (June). Eggs were obtained from a commercial farm where the laying hens were kept in a fully controlled lightproof house (L:D 16:8) with free access to food and water. The eggs were incubated in a hatchery in constant darkness at the appropriate temperature. On the day of hatch, the chickens were transported from the hatchery (H&P, Orzesze-Gardawice, Poland) to the animal facility of the Faculty of Biology, University of Warsaw, and kept under controlled light (L:D 12:12, lights on at 04:00) and temperature conditions (initially 32 ± 2 C and decreased gradually to reach 26 C), with free access to the standard food and water. During the light phase, the lamps provided 250 lux in each cage. Chickens of 2- or 9-d-old were sacrificed every 2 or 4 h over a 24-h period. The pineal glands were isolated under dim red light of 510 lux intensity, immediately frozen in liquid nitrogen and stored at 80 C prior to further analysis. All procedures were performed in accordance with the regulations of the Polish Ethical Council for the care and use of laboratory animals and the European Community Directive for the ethical use of experimental animals, and conformed to the ethical standards of this journal (Portaluppi et al., 2010). Measurement of 5-HT and 5-HTP To measure the 5-HT and 5-HTP content, each pineal gland was sonicated (Bandelin electronic, Berlin, Germany) in 25 ml of a solution composed of 0.1 M perchloric acid, 0.02% EDTA and 0.02% sodium bisulfate (Sigma, St. Louis, MO). After centrifugation (5 min, Chronobiology International
Age- and season-related changes in 5-HT synthesis 13 000g, 4 C), the supernatants were passed through ISO-Disc Nylon filters (54143-U, Sigma, St. Louis, MO) and analyzed by HPLC (Dionex System, Sunnyvale, CA) using an Agilent Zorbax SB-C18 (5 mm, 4.6 250 mm) reversed-phase column (Agilent Technologies, Santa Clara, CA). The mobile phase consisted of 0.1 M sodium acetate, 0.1 M citric acid, 0.15 mM EDTA and 10% methanol (Sigma, St. Louis, MO). The flow rate was 1 ml/min and the gold electrode potential of the electrochemical detector was set at + 0.9 V against a Ag/AgCl reference electrode. Dilutions (100, 10, 1, 0.1, 0.01 mM) of 5-HT and 5-HTP (Sigma, St. Louis, MO) were used to produce a standard curve for quantification. The results are expressed as the mean ± SEM in pmol/pineal gland.
Measurement of TRP Pineal glands were sonicated (Bandelin electronic, Berlin, Germany) in 25 ml of ice-cold sodium phosphate buffer (50 mM, pH 6.8) and duplicate 10 ml aliquots were taken to measure TRP concentration with a BridgeIt L-tryptophan Fluorescence Assay Kit (Mediomics, St. Louis, MO) using a microplate fluorometer (Ascent, Thermo-labsystems, Milford, MA; excitation 485 nm/emission 680 nm). The results are expressed as the mean ± SEM in nmol/pineal gland. Isolation and quantification of mRNA Total RNA was isolated from pineal glands using Ron’s Tissue RNA Mini Kit (Bioron GmbH, Ludwigshafen, Germany). The RNA concentration was measured spectrophotometrically (NanoDrop-1000, Thermo Scientific, Waltham, MA) and its quality was assessed by gel electrophoresis. DNase treatment of the prepared RNA was performed using RQ1-RNase-Free DNase (Promega, Fitchburg, WI). Reverse transcription (RT) reaction mixtures contained 650 ng total RNA, 200 U M-MuLV reverse transcriptase (Bioron GmbH, Ludwigshafen, Germany), 0.5 mM dNTPs (New England Biolabs, Ipswich, MA), 75 mM oligo dT (Bioron GmbH, Ludwigshafen, Germany), 20 U RNasin RNase inhibitor N211A (New England Biolabs, Ipswich, MA), 10 ml of 5x M-MuLV reverse transcriptase buffer (Bioron GmbH, Ludwigshafen, Germany), plus nuclease-free water (NFH2O, Qiagen, Venlo, Netherlands) to give a final volume of 20 ml. RT reactions were performed in a thermal cycler (Icycler, Bio-Rad, Hercules, CA) using the following incubation temperature profile: 68 C for 7 min, 4 C for 5 min, and then following M-MuLV reverse transcriptase addition, 42 C for 90 min and 3 min at 80 C. The RT products were used in quantitative realtime PCR assays (qPCR) performed in 96-well black plates (Techne, Stone, Staffordshire, UK). Each qPCR mixture was comprised of a cDNA template (4% of the RT product), 10 ml 2xSYBR green I PCR master mix (Kapa SybrFast Universal qPCR Kit, KapaBiosystem, Woburn, MA), 0.5 mM gene-specific forward and reverse primers (Table 1) and NFH2O to bring the final volume to 20 ml. The reactions were performed in a Quantica thermal !
Informa Healthcare USA, Inc.
61
TABLE 1. Primers used for RT-qPCR analysis. Gene (accession no.)
Primer set (50 – 30 )
Tph1 (U26428.1)
Forward: ACTGTATACCGAGAGCTTAACAA Reverse: GTGAAAAACTCTGAATGCTAATC Forward: TATAACACTGTTTGGGTCCTATC Reverse: AGGAAACTTTTAAGGAGAGAGAA Forward: CAGACTCTTACCACAGCCCCTTT Reverse: CAAGTTTGCAACCAAGATTCACC
Ddc (XM419032.2) Tbp (D83135)
cycler (Techne, Stone, Staffordshire, UK) using the following conditions: 95 C for 20 s, followed by 40 cycles of denaturation (95 C for 3 s), annealing with extension (58/63 C for 30 s). Each sample was assayed in duplicate. Fragments of the Tph1, Ddc and Tbp (TATAbinding protein, reference gene) cDNAs were separately amplified by PCR, cloned and used as quantification standards for qPCR. Transcript quantification was performed using Quantica software (Techne, Stone, Staffordshire, UK). The results were normalized to the level of Tbp transcript and expressed as the number of mRNA copies per 100 copies of Tbp mRNA. The isolation of RNA and RT-qPCR were performed no later than 1 month after pineal gland collection.
Statistical analysis The data presented as mean values ± SEM were analyzed using nonparametric statistical tests. For comparison of the results for the two different age groups in one season as well as for the same age groups in different seasons at each time point, the Mann–Whitney U test was applied. The significance of day/night changes in each parameter was assessed by one-way analysis of variance (ANOVA), followed by the Tukey post hoc test. Differences were considered significant at p50.05. Statistical analyses were performed using STATISTICA 10PL software (StatSoft, Tulsa, OK). In addition, data were analyzed by the cosinor method as previously described (Piesiewicz et al., 2012b). Circadian variability is presented as a cosine curve, being an approximation of the cosine function. The midline estimating statistics of the rhythm and the rhythm percentage were computed and are presented in the tables, separately for each parameter. Rejection with p50.05 of the zero-amplitude assumption for the approximating function was considered to demonstrate significance of rhythmicity. RESULTS The pineal 5-HT content The pattern and quantity of pineal 5-HT content in ‘‘winter’’ chickens did not change during postembryonic development (Figure 1), but there were significant differences between the daily fluctuations of 5-HT recorded in 2- and 9-d-old animals. The level of 5-HT was higher in the older chickens at the following time points: ZT 2, 14, 18, 20 and 24 (p50.045). On the
62
A. Piesiewicz et al.
FIGURE 1. Daily changes in 5-HT content in the pineal glands of chickens. The 5-HT level in pineal glands isolated from chickens reared in L:D 12:12 conditions, regardless of the season, was measured in birds of different ages (A and B). Each point represents the values obtained from three pineal glands, measured in duplicate, and the results are expressed as the mean ± SEM. Circadian rhythms are determined in separate cosinor analyses (C and D). The statistical significances are marked in the text and given in Table 2.
contrary, the pattern of daily changes of this pineal amine in ‘‘summer’’ birds was already established in 2d-old chickens (Figure 1), whereas its level increased during postembryonic development (p50.02). Higher pineal 5-HT levels were found in 2-d-old ‘‘summer’’ chickens compared to ‘‘winter’’ animals at ZT 8, 14, 18 and 20 (p50.03). In 9-d-old ‘‘summer’’ chickens this difference was evident at the end of the light period (ZT 10) and remained significant at night (ZT 12, 14, 16, 18 and 22; p50.04). The pineal 5-HT content in chickens hatched in the winter changed rhythmically only in 9-d-old birds (Table 2), with a significant difference (p50.0002) between levels in the middle of the day (ZT 6) and the middle of the night (ZT 18). On the contrary, in the summer, levels of 5-HT already displayed a diurnal rhythm in 2-d-old animals (Table 2), with maximal values observed at night in both age groups (p50.0002).
The pineal 5-HTP content In both ‘‘winter’’ and ‘‘summer’’ animals, the pineal 5-HTP level did not change during postembryonic development. However, the patterns of fluctuations in its content seemed to be well-pronounced in the summer (Figure 2). The pineal 5-HTP content changed rhythmically in 2-d-old chickens hatched in the winter and in 9-d-old animals hatched in the summer (Table 3), but significant day/night differences were not found. The pineal TRP content The pattern and quantity of pineal TRP content in chickens hatched in the winter changed during postembryonic development (Figure 3). The level of this essential amino acid was lower in 9-d-old animals than in younger birds, and this difference was most pronounced at ZT 8, 10, 12, 16, 18 and 22 (p50.03). Contrastingly, in chickens hatched in the summer the Chronobiology International
Age- and season-related changes in 5-HT synthesis
63
TABLE 2. Percentage of rhythm in the pineal 5-HT content of 2- and 9-d-old chickens hatched in the winter and summer. Winter Age group 2-d-old 9-d-old
Summer
Percentage of rhythm
F value
p Value
Percentage of rhythm
F value
p Value
41.26 68.63
3.16 9.847
ns p50.01
81.80 96.77
20.223 134.716
p50.001 p50.001
FIGURE 2. Daily changes in 5-HTP content in the pineal glands of chickens. The 5-HTP level in pineal glands isolated from chickens reared in L:D 12:12 conditions, regardless of the season, was measured in birds of different ages (A and B). Each point represents the values obtained from three pineal glands, measured in duplicate, and the results are expressed as the mean ± SEM. Circadian rhythms are determined in separate cosinor analyses (C and D). The statistical significances are marked in the text and given in Table 3.
pineal content of TRP did not change with age (Figure 3), and significant differences between the 2- and 9-d-old birds were seen only at three time points: ZT 2, 10 and 16 (p50.03). Interestingly, higher TRP levels were found in the winter in 2-d-old animals (ZT 4, 8, 10, 12, 16, 18 and 24; p50.02), whereas in 9-d-old chickens, higher levels of this compound were found in the summer, but only at three time points (ZT 8, 12 and 14; p50.03). !
Informa Healthcare USA, Inc.
The pineal TRP content changed rhythmically only in 9-d-old birds hatched in both seasons (Table 4), with a significant difference between levels of this amino acid in the day (ZT 6) and night (ZT 18) (p50.0005 in ‘‘winter’’ animals and p50.01 in ‘‘summer’’ ones).
The pineal Tph1 mRNA level The pattern and quantity of pineal Tph1 mRNA in ‘‘winter’’ chickens did not change during postembryonic
64
A. Piesiewicz et al. TABLE 3. Percentage of rhythm in the pineal 5-HTP content of 2- and 9-d-old chickens hatched in the winter and summer. Winter Age group 2-d-old 9-d-old
Summer
Percentage of rhythm
F value
p Value
Percentage of rhythm
F value
p Value
93.78 80.18
22.618 6.067
p50.025 ns
71.18 91.87
3.706 16.96
ns p50.025
FIGURE 3. Daily changes in TRP content in the pineal glands of chickens. The TRP level in pineal glands isolated from chickens reared in L:D 12:12 conditions, regardless of the season, was measured in birds of different ages (A and B). Each point represents the values obtained from three pineal glands, measured in duplicate, and the results are expressed as the mean ± SEM. Circadian rhythms are determined in separate cosinor analyses (C and D). The statistical significances are marked in the text and given in Table 4.
development (Figure 4), although higher gene expression was found in younger animals (p50.005) at two time points: ZT 4 and 14 (p50.005). Quite the contrary, in ‘‘summer’’ animals the pineal Tph1 mRNA level was lower in the younger age group, with significant differences at ZT 6, 8, 16, 18, 20, 22 and 24 (p50.04). Moreover, in 9-d-old animals the level of the Tph1
transcript was higher in the summer than in the winter (p50.02), whereas this seasonal variation was not seen in 2-d-old chickens. The pineal Tph1 mRNA level did not change rhythmically in chickens hatched in the winter (Table 5), whereas rhythmical changes were apparent in the pineal Tph1 mRNA level in animals hatched Chronobiology International
Age- and season-related changes in 5-HT synthesis
65
TABLE 4. Percentage of rhythm in the pineal TRP content of 2- and 9-d-old chickens hatched in the winter and summer. Winter Age group 2-d-old 9-d-old
Summer
Percentage of rhythm
F value
p Value
Percentage of rhythm
F value
p Value
11.44 71.73
0.581 11.416
ns p50.01
4.92 83.02
0.233 21.996
ns p50.001
FIGURE 4. Daily changes in expression of Tph1 mRNA in the pineal glands of chickens. The level of mRNA in pineal glands isolated from chickens reared in L:D 12:12 conditions, regardless of the season, was measured in birds of different ages (A and B). Each point represents the values obtained from three pineal glands, measured in duplicate, and the results are expressed as the mean ± SEM. Circadian rhythms are determined in separate cosinor analyses (C and D). The statistical significances are marked in the text and given in Table 5.
in the summer, but significant day/night differences (ZT 6 versus ZT 18) were not found.
The pineal Ddc mRNA level The pattern and quantity of pineal Ddc mRNA in ‘‘winter’’ chickens changed during postembryonic development (Figure 5). The level of the Ddc transcript was significantly higher in 2-d-old animals than in older !
Informa Healthcare USA, Inc.
birds and these differences were most pronounced at ZT 2, 4, 6, 10, 12, 14, 16, 22 and 24 (p50.04). Oppositely, in ‘‘summer’’ chickens, the pattern and quantity of Ddc mRNA in the pineal gland did not change during postembryonic development. However, some significant differences between both age groups were found at three time points: ZT 4, 14 and 20 (p50.03). Moreover, the level of Ddc mRNA was the same in 2-d-old birds
66
A. Piesiewicz et al. TABLE 5. Percentage of rhythm in pineal Tph1 gene transcription in 2- and 9-d-old chickens hatched in the winter and summer. Winter Age group 2-d-old 9-d-old
Summer
Percentage of rhythm
F value
p Value
Percentage of rhythm
F value
p Value
29.58 39.94
1.89 2.992
ns Ns
61.44 52.54
7.169 4.982
p50.025 p50.05
FIGURE 5. Daily changes in expression of Ddc mRNA in the pineal glands of chickens. The level of mRNA in pineal glands isolated from chickens reared in L:D 12:12 conditions, regardless of the season, was measured in birds of different ages (A and B). Each point represents the values obtained from three pineal glands, measured in duplicate, and the results are expressed as the mean ± SEM. Circadian rhythms are determined in separate cosinor analyses (C and D). The statistical significances are marked in the text and given in Table 6.
hatched in both seasons (Figure 5), whereas higher expression of the Ddc gene was seen in 9-d-old ‘‘summer’’ birds at the following time points: ZT 10, 12, 14, 16 and 22 (p50.03). The pineal Ddc mRNA level changed rhythmically only in 9-d-old birds hatched in the summer (Table 6), but day/night differences (ZT 6 versus ZT 18) were seen in both 2-d-old (p50.004) and 9-d-old ‘‘summer’’ chickens (p50.02).
DISCUSSION The results of this study clearly indicate existence of seasonal postembryonic maturation of the diurnal rhythm of serotonin in the chicken pineal gland. We found that the circadian rhythm of 5-HT biosynthesis in the chicken pineal gland is already established by the second day of postembryonic life in birds hatched in the summer. Contrastingly, day/night changes in the Chronobiology International
Age- and season-related changes in 5-HT synthesis
67
TABLE 6. Percentage of rhythm in pineal Ddc gene transcription in 2- and 9-d-old chickens hatched in the winter and summer. Winter Age group 2-d-old 9-d-old
Summer
Percentage of rhythm
F value
p Value
Percentage of rhythm
F value
p Value
47.49 42.59
4.069 3.338
ns ns
18.54 50.69
1.024 4.626
ns p50.05
TABLE 7. Rhythmicity of the MEL, its precursors (TRP, 5-HTP, 5-HT), activity of enzymes (AANAT, HIOMT) and mRNA level of Tph1, Ddc, Aanat and Asmt genes in the pineal gland of 2- and 9-d-old chickens hatched in the winter and summer. Crosses indicate significant rhythmicity (p50.05 +, p50.025 ++, p50.01 +++, p50.001 ++++). Summarization of the current and recently published data (Piesiewicz et al., 2012b). Measured parameters TRP Tph1 5-HTP Ddc 5-HT Aanat AANAT Asmt HIOMT MEL
2-d-old
9-d-old
Winter
Summer
Winter
Summer
++ +++ ++++ ++++ +++
++ ++++ + +++ +++ +++
+++ – ++ +++ + +++ +++ +++
++++ + + ++++ +++ +++ +++ +
pineal 5-HT level in ‘‘winter’’ animals are visible only around the 9th d post hatch. These age- and seasonrelated differences in the circadian rhythm of 5-HT corroborate our previous findings (Piesiewicz et al., 2012b). The present study was focused not only on serotonin level, but also on particular steps in the biosynthesis of this amine. We discovered significant age- and season-related differences in the level and circadian rhythm of pineal TRP content as well as in Tph1 and Ddc gene expression in this gland. In general, the circadian rhythm of TRP as well as the levels of Tph1 and Ddc mRNAs in ‘‘winter’’ chickens developed more slowly than in ‘‘summer’’ animals. Particularly spectacular changes were seen in the mRNA level of Tph1 in the summer season. These results confirm our previous finding that the pineal gland matures faster in chickens hatched in the summer than in those hatched in the winter (Piesiewicz et al., 2012b). We failed to observe any age-dependent differences in pineal 5-HTP content, regardless of the season of hatch, but this was probably due to the insufficient sensitivity of the assay method. However, we found that daily changes in the level of 5-HTP were rhythmical in 2-d-old ‘‘winter’’ and in 9-d-old ‘‘summer’’ birds. Taken together, our current results confirmed previous observations that the chicken pineal gland maturates earlier during summer season than in winter (Table 7). Moreover, only in the !
Informa Healthcare USA, Inc.
pineal glands of the 9-d-old ‘‘summer’’ animals almost all measured parameters are rhythmical. Daily changes in the Ddc mRNA level, in comparison to Tph1, were relatively low, regardless of the age and season of hatch. Surprisingly, in the 9-d-old ‘‘summer’’ chickens, Ddc expression was rhythmic. This result was quite unexpected, because all evidence to date indicate that only the Tph1, Aanat and Asmt genes are expressed rhythmically in pinealocytes, under the control of clock genes. Moreover, this gene is generally believed to be constitutively expressed at high level (Huang et al., 2008). The first gene recognized as rhythmical, both in the pineal glands and in the chicken pineal cultures, was Tph1 (Florez et al., 1996). These authors found that the circadian rhythm of Tph1 persisted not only in L:D 12:12 conditions, but also in constant darkness. Subsequently, the circadian rhythm of Aanat expression was confirmed in chicken pineal cells cultured in L:D 12:12 conditions and in constant darkness (Bernard et al., 1997). Moreover, exposure to light during the first 6 h of the night inhibited the nocturnal increase in Aanat mRNA level. The same research group reported day/night changes in the expression of Tph1, Aanat and Asmt genes both in the pineal glands and in the chicken pineal cultures as well as day/night changes in Tph1 and Aanat expression in the chicken retina (Bernard et al., 1999). According to
68
A. Piesiewicz et al.
these authors, among the genes mediating MEL biosynthesis, only Ddc seems to be arrhythmic. Microarray analysis indicated significant daily oscillations in the level of pineal Ddc mRNA in chickens kept in L:D 12:12 conditions, without rhythmicity in D:D conditions (Bailey et al., 2003). These authors also identified orthologs of some mammalian clock genes in the chicken pineal gland, and they suggested that Tph1, Aanat and Asmt expression is under clock control. Recently published data imply that at least three of the four genes encoding enzymes participating in MEL biosynthesis are expressed rhythmically (Cassone, 2014). The results of the present study are not in complete agreement with those described above. This discrepancy may be due to differences in the experimental procedure employed, which in the present study was focused on the age and season of hatch of the animals. In the earlier microarray analysis of the chicken pineal transcriptome, 7-d-old animals were used (Bailey et al., 2003), whereas the in vitro analyses of gene expression were performed with pineal glands taken from 1 or 2-d-old animals (Bernard et al., 1997, 1999; Florez et al., 1996), and older animals were used for the in vivo analysis (Bernard et al., 1999). Moreover, in the aforementioned papers, the season of hatch was not taken into consideration. The data presented here and in recent report (Piesiewicz et al., 2012b) indicate that the chicken pineal gland matures between the 1st and 16th day of life, with the exact duration of the maturation depending on the season. Some processes that occur in this period are arrhythmic in the youngest animals and the rhythmicity develops in older individuals. The observed rhythm of Ddc gene expression probably develops between the 7th and 9th day post-hatch in the summer. Moreover, our data confirm in vivo results obtained in rats (Ishida et al., 2002). These authors identified a circadian rhythm of expression and activity of AADC in the rat suprachiasmatic nucleus: the structure known as the central oscillator in mammals. We believe that seasonal postembryonic maturation of the diurnal rhythm of melatonin in the chicken pineal gland depends on changes in serotonin biosynthesis. The results presented here confirm some data obtained in the 1980s and 1990s. The administration of TRP to chickens and rats was found to cause a rapid dosedependent increase in circulating MEL (Huether et al., 1992). Interestingly, oral TRP administration caused greater MEL elevation than the same dose given by the intraperitoneal route. Experiments conducted on pyridoxine-deficient rats have also provided some interesting information (Viswanathan et al., 1988). Pyridoxal 5-phosphate is a cofactor of the TPH enzyme and its deficiency causes reduced 5-HTP decarboxylation and ultimately results in a decrease in 5-HT. In pyridoxinedeficient rats kept in L:D 14:10 conditions, the circadian rhythm of the release of pineal NAS and MEL showed significantly lower night peaks. This suggests that 5-HT
availability is an important factor in the regulation of pineal NAS and MEL synthesis (Viswanathan et al., 1988). Intraperitoneal injection of low doses of benserazide, an AADC inhibitor, reduced levels of 5-HT and MEL in the rat pineal gland, but not in hypothalamus (Arendt et al., 1981). Intraocular administration of 5-HTP at night caused a dose-dependent increase in MEL level in the chicken retina (Thomas et al., 1998). These data suggest that the rate of MEL biosynthesis is a function of the concentration of 5-HT. A similar effect was observed in Xenopus laevis eyecup cultures (Cahill & Besharse, 1990). The administration of 5-HTP to the culture medium evoked a dose-dependent increase in MEL release and maintained the circadian rhythmicity of this release for 5 days, whereas the rhythm persisted for only 1–3 days in non-supplemented eyecup cultures. These data indicate the importance of both the substrates as well as the enzymes participating in 5-HT biosynthesis, in the regulation of MEL biosynthesis. Usually, the role of these parameters in the MEL biosynthetic pathway is not fully appreciated or and is ignored. In particular, the roles of AADC and its gene Ddc have been disregarded and not tested alongside the other parameters (Barbosa et al., 2008; Huang et al., 2008). Our results indicate that chickens kept from the day of hatch under artificial light conditions are able to recognize the season. This confirms the existence of some independent internal mechanism that recognizes the external lighting conditions, which may or may not have been experienced by the parental animals. In the literature, this mechanism is sometimes called ‘‘photoperiodic memory’’. Brandstatter et al. (2000) demonstrated that the pineal gland of the house sparrow retained ‘‘photoperiodic memory’’ both in vivo and in vitro, as in vivo synchronization to a specific photoperiod may be maintained subsequently in birds kept in prolonged darkness and also in the isolated pineal glands. Similar results have been described in migratory birds (Gwinner, 2003), what we recently discussed in detail in the previous publication (Piesiewicz et al., 2012b). The mechanisms underlying ‘‘photoperiodic memory’’ are still unknown, but epigenetic factors, such as maternal behavior, may influence the rhythmic phenotype of the offspring (Formanek et al., 2009; Janczak et al., 2007; Piesiewicz et al., 2012b). Moreover, it was showed that in chickens unpredictable food access caused seemingly adaptive responses in feeding behavior and this changed behavior was then transmitted to the offspring by epigenetic mechanisms (Natt et al., 2009). Probably this may prepare offspring for coping with unpredictable changes in environment. It was also showed that prenatal exposure of eggs to the photoperiodic lighting programs improve adaptation to a similar lighting conditions at the early stages of posthatching growth (Ozkan et al. 2012a, b), and reduce the stress susceptibility (Archer & Mench, 2013). Moreover, exposure of 19-d chick Chronobiology International
Age- and season-related changes in 5-HT synthesis embryos to a low temperature in darkness may affect melatonin production in the pineal gland (Zeman et al., 2011). However, it is yet to be determined whether and how the information on external lighting conditions experienced by laying hens (artificial photoperiod L:D 16:8, regardless of the season) and by the embryos during incubation (constant darkness) are transmitted to the newly hatched chicks, and how this may influence the pineal circadian rhythm in a season-dependent manner. It was recently proposed that changes in geomagnetic activity may also influence the circadian rhythm of some processes. Disturbances in geomagnetic activity observed close to the North pole (Alta, Norway), significantly decreased the secretion of MEL in healthy subjects during the day/night and at different times of the year (Weydahl et al., 2001). Experiments conducted on female laboratory rats over a 2-year-period indicated that the urinary excretion of 6-sulfatoxymelatonin (aMT6s) displays a seasonal rhythm and it was hypothesized that this rhythm is related to the geomagnetic field, which may act as a seasonal zeitgeber (Bartsch et al., 2012a). These authors suggested that the 11-year-sunspot cycle causes geomagnetic disturbances that probably facilitate seasonal aMT6s rhythmicity (Bartsch et al., 2012b).
CONCLUSIONS The observed differences in chicken pineal gland activity between the two age groups confirmed the rhythmical serotonin biosynthetic pathway changes during postembryonic development. The circadian rhythm of chicken pineal 5-HT biosynthesis is already established on the second day of postembryonic life and depends on the season of hatch. The efficiency of the production of this amine may limit the melatonin biosynthesis availability in the pineal gland. The apparent circadian rhythm of Ddc gene expression in 9-d-old chickens in the summer suggests that, similarly to Tph1, Aanat and Asmt, this gene may be clock controlled. This hypothesis requires verification in older animals kept both in L:D 12:12 conditions as well as in constant darkness, and in pinealocyte cultures.
ACKNOWLEDGEMENTS We would like to thank Professor Krystyna SkwarloSonta from our Department for inspiration and helpful discussion. We also acknowledge Dr Krystyna Zuzewicz from the Central Institute for Labour Protection, Warsaw, Poland for assistance in cosinor analysis.
DECLARATION OF INTEREST The authors report no conflicts of interest. The authors alone are responsible for the content and writing of this paper. !
Informa Healthcare USA, Inc.
69
This work was performed within the framework of Polish Ministry of Science and Higher Education grants NN303317733 and NN303595739.
REFERENCES Akasaka K, Nasu T, Katayama T, Murakami N. (1995). Development of regulation of melatonin release in pineal cells in chick embryo. Brain Res. 692:283–6. Archer GS, Mench JA. (2013). The effects of light stimulation during incubation on indicators of stress susceptibility in broilers. Poult Sci. 92:3103–8. Arendt J, Ho AK, Laud C, et al. (1981). Differential effect of benserazide (Ro4-4602) on the concentration of indoleamines in rat pineal and hypothalamus. Br J Pharmacol. 72:257–62. Bailey MJ, Beremand PD, Hammer R, et al. (2003). Transcriptional profiling of the chick pineal gland, a photoreceptive circadian oscillator and pacemaker. Mol Endocrinol. 17:2084–95. Barbosa R, Scialfa JH, Terra IM, et al. (2008). Tryptophan hydroxylase is modulated by L-type calcium channels in the rat pineal gland. Life Sci. 82:529–35. Bartsch H, Mecke D, Probst H, et al. (2012a). Longitudinal melatonin production in female laboratory rats during 1997– 2006: Possible modulatory effects of changing solar activity. Curr Aging Sci. 5:186–94. Bartsch H, Mecke D, Probst H, et al. (2012b). Search for seasonal rhythmicity of pineal melatonin production in rats under constant laboratory conditions: Spectral chronobiological analysis, and relation to solar and geomagnetic variables. Chronobiol Int. 29:1048–61. Bebas P, Goodall CP, Majewska M, et al. (2009). Circadian clock and output genes are rhythmically expressed in extratesticular ducts and accessory organs of mice. FASEB J. 23:523–33. Bernard M, Guerlotte J, Greve P, et al. (1999). Melatonin synthesis pathway: Circadian regulation of the genes encoding the key enzymes in the chicken pineal gland and retina. Reprod Nutr Dev. 39:325–34. Bernard M, Iuvone PM, Cassone VM, et al. (1997). Avian melatonin synthesis: Photic and circadian regulation of serotonin N-acetyltransferase mRNA in the chicken pineal gland and retina. J Neurochem. 68:213–24. Borjigin J, Zhang LS, Calinescu AA. (2012). Circadian regulation of pineal gland rhythmicity. Mol Cell Endocrinol. 349:13–9. Brandstatter R, Kumar V, Abraham U, Gwinner E. (2000). Photoperiodic information acquired and stored in vivo is retained in vitro by a circadian oscillator, the avian pineal gland. Proc Natl Acad Sci USA. 97:12324–8. Cahill GM, Besharse JC. (1990). Circadian regulation of melatonin in the retina of Xenopus laevis: Limitation by serotonin availability. J Neurochem. 54:716–9. Cassone VM. (2014). Avian circadian organization: A chorus of clocks. Front Neuroendocrinol. 35:76–88. Chong NW, Bernard M, Klein DC. (2000). Characterization of the chicken serotonin N-acetyltransferase gene. Activation via clock gene heterodimer/E box interaction. J Biol Chem. 275: 32991–8. Florez JC, Seidenman KJ, Barrett RK, et al. (1996). Molecular cloning of chick pineal tryptophan hydroxylase and circadian oscillation of its mRNA levels. Brain Res Mol Brain Res. 42: 25–30. Formanek L, Richard-Yris MA, Houdelier C, Lumineau S. (2009). Epigenetic maternal effects on endogenous rhythms in precocial birds. Chronobiol Int. 26:396–414. Guerrero JM, Reiter RJ. (2002). Melatonin-immune system relationships. Curr Top Med Chem. 2:167–79. Gwinner E. (2003). Circannual rhythms in birds. Curr Opin Neurobiol. 13:770–8.
70
A. Piesiewicz et al.
Herichova I, Zeman M, Mackova M, Griac P. (2001). Rhythms of the pineal N-acetyltransferase mRNA and melatonin concentrations during embryonic and post-embryonic development in chicken. Neurosci Lett. 298:123–6. Huang Z, Liu T, Chattoraj A, et al. (2008). Posttranslational regulation of TPH1 is responsible for the nightly surge of 5-HT output in the rat pineal gland. J Pineal Res. 45:506–14. Huether G, Poeggeler B, Reimer A, George A. (1992). Effect of tryptophan administration on circulating melatonin levels in chicks and rats: Evidence for stimulation of melatonin synthesis and release in the gastrointestinal tract. Life Sci. 51:945–53. Ishida Y, Yokoyama C, Inatomi T, et al. (2002). Circadian rhythm of aromatic L-amino acid decarboxylase in the rat suprachiasmatic nucleus: Gene expression and decarboxylating activity in clock oscillating cells. Genes Cells. 7:447–59. Janczak AM, Torjesen P, Palme R, Bakken M. (2007). Effects of stress in hens on the behaviour of their offspring. Appl Anim Behav Sci. 107:66–77. Lovenberg W, Weissbach H, Udenfriend S. (1962). Aromatic L-amino acid decarboxylase. J Biol Chem. 237:89–93. Majewski P, Adamska I, Pawlak J, et al. (2005a). Seasonality of pineal gland activity and immune functions in chickens. J Pineal Res. 39:66–72. Majewski P, Dziwinski T, Pawlak J, et al. (2005b). Antiinflammatory and opioid-mediated effects of melatonin on experimental peritonitis in chickens. Life Sci. 76:1907–20. Markowska M, Bentkowski P, Kloc M, Pijanowska J. (2009). Presence of melatonin in Daphnia magna. J Pineal Res. 46: 242–4. Natt D, Lindqvist N, Stranneheim H, et al. (2009). Inheritance of acquired behaviour adaptations and brain gene expression in chickens. PloS one. 4:e6405. Ozkan S, Yalcin S, Babacanoglu E, et al. (2012a). Photoperiodic lighting (16 hours of light:8 hours of dark) programs during incubation: 1. Effects on growth and circadian physiological traits of embryos and early stress response of broiler chickens. Poult Sci. 91:2912–21. Ozkan S, Yalcin S, Babacanoglu E, et al. (2012b). Photoperiodic lighting (16 hours of light:8 hours of dark) programs during incubation: 2. Effects on early posthatching growth, blood physiology, and production performance in broiler chickens in relation to posthatching lighting programs. Poult Sci. 91: 2922–30. Pang SF, Li L, Ayre EA, et al. (1998). Neuroendocrinology of melatonin in reproduction: Recent developments. J Chem Neuroanat. 14:157–66.
Piesiewicz A, Kedzierska U, Adamska I, et al. (2012a). Pineal arylalkylamine N-acetyltransferase (Aanat) gene expression as a target of inflammatory mediators in the chicken. Gen Comp Endocrinol. 179:143–51. Piesiewicz A, Kedzierska U, Podobas E, et al. (2012b). Seasondependent postembryonic maturation of the diurnal rhythm of melatonin biosynthesis in the chicken pineal gland. Chronobiol Int. 29:1227–38. Portaluppi F, Smolensky MH, Touitou Y. (2010). Ethics and methods for biological rhythm research on animals and human beings. Chronobiol Int. 27:1911–29. Reiter RJ, Tan DX, Fuentes-Broto L. (2010). Melatonin: A multitasking molecule. Prog Brain Res. 181:127–51. Skwarlo-Sonta K, Nowak K, Joachimiak E, et al. (2011). Season-related postmebryonic development of the melatonin biosynthesis circadian rhythm in chicken. In Haldar PBC, Basu P, eds. Avian pineal gland as a clock and calendar. Varanasi U.P. India: Imagination Editor & Printers, pp. 153–66. Thomas KB, Brown AD, Iuvone PM. (1998). Elevation of melatonin in chicken retina by 5-hydroxytryptophan: Differential light/ dark responses. Neuroreport. 9:4041–4. Turkowska E, Rai S, Majewski PM, Skwarło-Son´ta K. (2013). Diurnal and seasonal changes in IL-6 and IL-18 gene expression in blood leukocytes of male chickens with experimental peritonitis: The impact of lighting conditions and melatonin. J Anim Feed Sci. 22:149–57. Underwood H, Steele CT, Zivkovic B. (2001). Circadian organization and the role of the pineal in birds. Microsc Res Tech. 53: 48–62. Viswanathan M, Siow YL, Paulose CS, Dakshinamurti K. (1988). Pineal indoleamine metabolism in pyridoxine-deficient rats. Brain Res. 473:37–42. Voisin P, Guerlotte J, Bernard M, et al. (1992). Molecular cloning and nucleotide sequence of a cDNA encoding hydroxyindole O-methyltransferase from chicken pineal gland. Biochem J. 282: 571–6. Weydahl A, Sothern RB, Cornelissen G, Wetterberg L. (2001). Geomagnetic activity influences the melatonin secretion at latitude 70 N. Biomed Pharmacother. 55:57s–62s. Zeman M, Gwinner E, Somogyiova E. (1992). Development of melatonin rhythm in the pineal gland and eyes of chick embryo. Experientia. 48:765–8. Zeman M, Pavlik P, Lamosova D, et al. (2011). Entrainment of rhythmic melatonin production by light and temperature in the chick embryo. Avian Poult Biol Rev. 15:197–204.
Chronobiology International
Copyright of Chronobiology International: The Journal of Biological & Medical Rhythm Research is the property of Taylor & Francis Ltd and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
ORIGINAL ARTICLE
Seasonal postembryonic maturation of the diurnal rhythm of serotonin in the chicken pineal gland Aneta Piesiewicz, Urszula Kedzierska, Elzbieta Turkowska, Iwona Adamska, and Pawel M. Majewski Department of Animal Physiology, Faculty of Biology, University of Warsaw, Poland
Previously, we have demonstrated the postembryonic development of chicken (Gallus gallus domesticus L.) pineal gland functions expressed as changes in melatonin (MEL) biosynthesis. Pineal concentrations of MEL and its precursor serotonin (5-HT) were shown to increase between the 2nd and 16th day of life. We also found that levels of the mRNAs encoding the enzymes participating in the final two steps of MEL biosynthesis from 5-HT: arylalkylamineN-acetyltransferase (AANAT) and hydroxyindole-O-methyltransferase (HIOMT), as well as their enzymatic activities, were raised during postembryonic development. Moreover, the manner of these changes was season-of-hatch dependent, even in animals kept under constant laboratory conditions (L:D 12:12). The most pronounced changes were seen in the concentrations of 5-HT and MEL, as well as in Aanat mRNA level and its enzymatic activity. The high daily variability in 5-HT content suggested that season- and age-dependent changes in the activity of the chicken pineal gland might rely on the availability of 5-HT, i.e. it may be limited by changes in pineal tryptophan (TRP) and/or 5-hydroxytryptophan (5-HTP) levels as well as by the activity of tryptophan hydroxylase (TPH) and aromatic L-amino acid decarboxylase (AADC): two enzymes participating in the conversion of TRP to 5-HT. The present study was undertaken with the following objectives: (1) to examine whether the pineal concentration of the 5-HT precursors TRP and 5-HTP exhibit age- and season-related changes; (2) to look for season-related differences in the transcription of the Tph1 and Ddc genes encoding enzymes TPH and AADC; (3) to identify the step(s) in postembryonic development in which these season-related variations in pineal gland function are most pronounced. Male Hy-line chickens hatched in the summer or winter, from eggs laid by hens held in L:D 16:8 conditions were kept from the day of hatch in L:D 12:12 conditions. At the age of 2 or 9 days, animals were sacrificed every 2 or 4 h over a 24-h period and their pineal glands were isolated under dim red light and processed for the measurement of (i) the pineal content of TRP, 5-HTP and 5-HT, and (ii) the level of Tph1 and Ddc mRNAs. Circadian rhythmicity of all the measured parameters was evaluated by the cosinor method. The pineal levels of TRP and 5-HT as well as the Tph1 and Ddc transcripts changed during postembryonic development in a season-related way. Whereas, the 5-HTP concentration did not vary between animals from both age groups, regardless of the season. Circadian rhythmicity of all the measured parameters was dependent on both the age and the season of hatch, and was greatest in older animals in the summer. These findings indicated that the efficiency of season-related MEL biosynthesis, reported previously, is limited by 5-HT availability and this limitation depends on the transcription of both the Tph1 and Ddc genes. Moreover, Ddc mRNA level in 9-d-old birds changed rhythmically, even though this gene is generally considered to be arrhythmic. Keywords: 5-Hydroxytryptophan, aromatic L-amino acid decarboxylase, birds, chronobiology, photoperiodic memory, rhythmicity, tryptophan hydroxylase, tryptophan
INTRODUCTION
decarboxylase gene (Ddc), converts 5-HTP to 5-hydroxytryptamine (serotonin, 5-HT) (Lovenberg et al., 1962). 5-HT is then transformed to N-acetylserotonin (NAS) by arylalkylamine-N-acetyltransferase (AANAT; E.C. 2.3.1.87), encoded by the arylalkylamine-N-acetyltransferase gene (Aanat) (Bernard et al., 1997). Finally, hydroxyindole-O-methyltransferase (HIOMT; E.C.2.1.1.4), encoded by the acetylserotonin O-methyltransferase gene (Asmt), converts NAS to MEL (Voisin et al., 1992). The genes encoding each of the enzymes participating in the MEL biosynthetic pathway have
The biosynthesis of melatonin (MEL) is a wellcharacterized sequence of enzymatic reactions starting with the hydroxylation of the essential amino acid tryptophan (TRP) to 5-hydroxytryptophan (5-HTP), catalyzed by tryptophan hydroxylase (TPH; E.C. 1.14.16.4), which in chickens is encoded by the tryptophan hydroxylase 1 gene (Tph1) (Chong et al., 2000). The next enzyme, aromatic L-amino acid decarboxylase (AADC; E.C.4.1.1.28), encoded by the dopa
Submitted May 30, 2014, Returned for revision July 23, 2014, Accepted August 11, 2014
Correspondence: Pawel M. Majewski, Department of Animal Physiology, Faculty of Biology, University of Warsaw, Miecznikowa 1, 02-096 Warsaw, Poland. E-mail: [email protected]
59
60
A. Piesiewicz et al.
been indentified in several species, cloned and sequenced. In the chicken (Gallus gallus domesticus L.), at least three of these enzymes, TPH, AANAT and HIOMT, are regulated indirectly by the molecular clock within pinealocytes and directly by light at the transcriptional, translational and post-translational levels, so the pineal MEL biosynthesis is a rhythmic dynamic process (Cassone, 2014). MEL is an universal and multifunctional molecule found in both vertebrates and invertebrates (Markowska et al., 2009; Reiter et al., 2010). In vertebrates, this hormone, synthesized in the pineal gland, is known to regulate many physiological processes such as seasonal reproduction (Pang et al., 1998), locomotor activity (Underwood et al., 2001) and immunity (Guerrero & Reiter, 2002; Majewski et al., 2005a, b; Piesiewicz et al., 2012a; Turkowska et al., 2013). The biosynthesis of MEL is controlled by central regulatory factors including the neurotransmitters released from the autonomic nervous system and the plasticity of the SCN-pineal circuit (Borjigin et al., 2012). Moreover, like other hormones, MEL biosynthesis may be regulated by peripheral oscillators (Bebas et al., 2009). A notable finding of studies on the circadian rhythm of MEL biosynthesis is the postembryonic maturation of this process. The MEL rhythm was demonstrated in vivo in the pineal glands and eyes of 18- and 20-d-old chicken embryos incubated in L:D 16:8 conditions (Zeman et al., 1992). Moreover, when eggs were incubated in L:D 12:12 conditions the expression of Aanat mRNA exhibited increasing amplitude from the 16th day of embryonic life (Herichova et al., 2001). Similarly, in vitro studies have revealed the circadian rhythm of MEL release from pinealocytes isolated from 18-d-old chicken embryos and kept in constant darkness (Akasaka et al., 1995). Unfortunately, in the above reports, the season of hatch was not mentioned. However, an early study in our laboratory, conducted on 3-wk-old chickens, kept from the day of hatch under controlled laboratory conditions (L:D 12:12), indicated that the peak of nocturnal activity of pineal AANAT, the enzyme thought to be responsible for MEL rhythmicity, is shifted depending on the season (Majewski et al., 2005a). Thereafter, we identified an age-related postembryonic increase in pineal AANAT activity in chickens hatched in both seasons, i.e. ‘‘winter’’ or ‘‘summer’’ birds (Skwarlo-Sonta et al., 2011). Recently, we found that the circadian rhythm of the Aanat mRNA level, its encoded enzyme activity, as well as the 5-HT and MEL contents of the pineal gland developed more slowly in ‘‘winter’’ animals than in ‘‘summer’’ ones (Piesiewicz et al., 2012b). These differences persisted until the 9th d post-hatch, but were no longer seen in 16-d-old chickens. The only exception was the rhythm of Asmt transcription, where the lowest amplitude was observed in 2-d-old birds hatched in the summer. Interestingly, the pineal 5-HT content
exhibited daily variability in chickens hatched in both seasons, regardless of their age. However, the observed changes were not rhythmical in ‘‘winter’’ animals. These results suggest that chickens kept from the day of hatch under artificial light conditions are able to recognize the natural season and/or artificial light-induced reproduction of birds affects pineal functions (Piesiewicz et al., 2012b). Taken together, these findings led us to hypothesize that postembryonic maturation of MEL biosynthesis in the chicken pineal gland is limited by the availability of 5-HT. Thus, the present study was undertaken to determine the influence of age and the season of hatch on the diurnal rhythm of particular steps in 5-HT biosynthesis in the chicken pineal gland. We have examined daily changes in the pineal content of the 5-HT precursors 5-HTP and TRP as well as changes in the mRNA levels of the Tph1 and Ddc genes encoding enzymes that participate in 5-HT biosynthesis. All experiments were performed on 2- and 9-d-old male chickens, kept from the day of hatch in L:D 12:12 conditions.
MATERIALS AND METHODS Animals and experimental design Experiments were performed on male Hy-Line chickens hatched in winter (January) and summer (June). Eggs were obtained from a commercial farm where the laying hens were kept in a fully controlled lightproof house (L:D 16:8) with free access to food and water. The eggs were incubated in a hatchery in constant darkness at the appropriate temperature. On the day of hatch, the chickens were transported from the hatchery (H&P, Orzesze-Gardawice, Poland) to the animal facility of the Faculty of Biology, University of Warsaw, and kept under controlled light (L:D 12:12, lights on at 04:00) and temperature conditions (initially 32 ± 2 C and decreased gradually to reach 26 C), with free access to the standard food and water. During the light phase, the lamps provided 250 lux in each cage. Chickens of 2- or 9-d-old were sacrificed every 2 or 4 h over a 24-h period. The pineal glands were isolated under dim red light of 510 lux intensity, immediately frozen in liquid nitrogen and stored at 80 C prior to further analysis. All procedures were performed in accordance with the regulations of the Polish Ethical Council for the care and use of laboratory animals and the European Community Directive for the ethical use of experimental animals, and conformed to the ethical standards of this journal (Portaluppi et al., 2010). Measurement of 5-HT and 5-HTP To measure the 5-HT and 5-HTP content, each pineal gland was sonicated (Bandelin electronic, Berlin, Germany) in 25 ml of a solution composed of 0.1 M perchloric acid, 0.02% EDTA and 0.02% sodium bisulfate (Sigma, St. Louis, MO). After centrifugation (5 min, Chronobiology International
Age- and season-related changes in 5-HT synthesis 13 000g, 4 C), the supernatants were passed through ISO-Disc Nylon filters (54143-U, Sigma, St. Louis, MO) and analyzed by HPLC (Dionex System, Sunnyvale, CA) using an Agilent Zorbax SB-C18 (5 mm, 4.6 250 mm) reversed-phase column (Agilent Technologies, Santa Clara, CA). The mobile phase consisted of 0.1 M sodium acetate, 0.1 M citric acid, 0.15 mM EDTA and 10% methanol (Sigma, St. Louis, MO). The flow rate was 1 ml/min and the gold electrode potential of the electrochemical detector was set at + 0.9 V against a Ag/AgCl reference electrode. Dilutions (100, 10, 1, 0.1, 0.01 mM) of 5-HT and 5-HTP (Sigma, St. Louis, MO) were used to produce a standard curve for quantification. The results are expressed as the mean ± SEM in pmol/pineal gland.
Measurement of TRP Pineal glands were sonicated (Bandelin electronic, Berlin, Germany) in 25 ml of ice-cold sodium phosphate buffer (50 mM, pH 6.8) and duplicate 10 ml aliquots were taken to measure TRP concentration with a BridgeIt L-tryptophan Fluorescence Assay Kit (Mediomics, St. Louis, MO) using a microplate fluorometer (Ascent, Thermo-labsystems, Milford, MA; excitation 485 nm/emission 680 nm). The results are expressed as the mean ± SEM in nmol/pineal gland. Isolation and quantification of mRNA Total RNA was isolated from pineal glands using Ron’s Tissue RNA Mini Kit (Bioron GmbH, Ludwigshafen, Germany). The RNA concentration was measured spectrophotometrically (NanoDrop-1000, Thermo Scientific, Waltham, MA) and its quality was assessed by gel electrophoresis. DNase treatment of the prepared RNA was performed using RQ1-RNase-Free DNase (Promega, Fitchburg, WI). Reverse transcription (RT) reaction mixtures contained 650 ng total RNA, 200 U M-MuLV reverse transcriptase (Bioron GmbH, Ludwigshafen, Germany), 0.5 mM dNTPs (New England Biolabs, Ipswich, MA), 75 mM oligo dT (Bioron GmbH, Ludwigshafen, Germany), 20 U RNasin RNase inhibitor N211A (New England Biolabs, Ipswich, MA), 10 ml of 5x M-MuLV reverse transcriptase buffer (Bioron GmbH, Ludwigshafen, Germany), plus nuclease-free water (NFH2O, Qiagen, Venlo, Netherlands) to give a final volume of 20 ml. RT reactions were performed in a thermal cycler (Icycler, Bio-Rad, Hercules, CA) using the following incubation temperature profile: 68 C for 7 min, 4 C for 5 min, and then following M-MuLV reverse transcriptase addition, 42 C for 90 min and 3 min at 80 C. The RT products were used in quantitative realtime PCR assays (qPCR) performed in 96-well black plates (Techne, Stone, Staffordshire, UK). Each qPCR mixture was comprised of a cDNA template (4% of the RT product), 10 ml 2xSYBR green I PCR master mix (Kapa SybrFast Universal qPCR Kit, KapaBiosystem, Woburn, MA), 0.5 mM gene-specific forward and reverse primers (Table 1) and NFH2O to bring the final volume to 20 ml. The reactions were performed in a Quantica thermal !
Informa Healthcare USA, Inc.
61
TABLE 1. Primers used for RT-qPCR analysis. Gene (accession no.)
Primer set (50 – 30 )
Tph1 (U26428.1)
Forward: ACTGTATACCGAGAGCTTAACAA Reverse: GTGAAAAACTCTGAATGCTAATC Forward: TATAACACTGTTTGGGTCCTATC Reverse: AGGAAACTTTTAAGGAGAGAGAA Forward: CAGACTCTTACCACAGCCCCTTT Reverse: CAAGTTTGCAACCAAGATTCACC
Ddc (XM419032.2) Tbp (D83135)
cycler (Techne, Stone, Staffordshire, UK) using the following conditions: 95 C for 20 s, followed by 40 cycles of denaturation (95 C for 3 s), annealing with extension (58/63 C for 30 s). Each sample was assayed in duplicate. Fragments of the Tph1, Ddc and Tbp (TATAbinding protein, reference gene) cDNAs were separately amplified by PCR, cloned and used as quantification standards for qPCR. Transcript quantification was performed using Quantica software (Techne, Stone, Staffordshire, UK). The results were normalized to the level of Tbp transcript and expressed as the number of mRNA copies per 100 copies of Tbp mRNA. The isolation of RNA and RT-qPCR were performed no later than 1 month after pineal gland collection.
Statistical analysis The data presented as mean values ± SEM were analyzed using nonparametric statistical tests. For comparison of the results for the two different age groups in one season as well as for the same age groups in different seasons at each time point, the Mann–Whitney U test was applied. The significance of day/night changes in each parameter was assessed by one-way analysis of variance (ANOVA), followed by the Tukey post hoc test. Differences were considered significant at p50.05. Statistical analyses were performed using STATISTICA 10PL software (StatSoft, Tulsa, OK). In addition, data were analyzed by the cosinor method as previously described (Piesiewicz et al., 2012b). Circadian variability is presented as a cosine curve, being an approximation of the cosine function. The midline estimating statistics of the rhythm and the rhythm percentage were computed and are presented in the tables, separately for each parameter. Rejection with p50.05 of the zero-amplitude assumption for the approximating function was considered to demonstrate significance of rhythmicity. RESULTS The pineal 5-HT content The pattern and quantity of pineal 5-HT content in ‘‘winter’’ chickens did not change during postembryonic development (Figure 1), but there were significant differences between the daily fluctuations of 5-HT recorded in 2- and 9-d-old animals. The level of 5-HT was higher in the older chickens at the following time points: ZT 2, 14, 18, 20 and 24 (p50.045). On the
62
A. Piesiewicz et al.
FIGURE 1. Daily changes in 5-HT content in the pineal glands of chickens. The 5-HT level in pineal glands isolated from chickens reared in L:D 12:12 conditions, regardless of the season, was measured in birds of different ages (A and B). Each point represents the values obtained from three pineal glands, measured in duplicate, and the results are expressed as the mean ± SEM. Circadian rhythms are determined in separate cosinor analyses (C and D). The statistical significances are marked in the text and given in Table 2.
contrary, the pattern of daily changes of this pineal amine in ‘‘summer’’ birds was already established in 2d-old chickens (Figure 1), whereas its level increased during postembryonic development (p50.02). Higher pineal 5-HT levels were found in 2-d-old ‘‘summer’’ chickens compared to ‘‘winter’’ animals at ZT 8, 14, 18 and 20 (p50.03). In 9-d-old ‘‘summer’’ chickens this difference was evident at the end of the light period (ZT 10) and remained significant at night (ZT 12, 14, 16, 18 and 22; p50.04). The pineal 5-HT content in chickens hatched in the winter changed rhythmically only in 9-d-old birds (Table 2), with a significant difference (p50.0002) between levels in the middle of the day (ZT 6) and the middle of the night (ZT 18). On the contrary, in the summer, levels of 5-HT already displayed a diurnal rhythm in 2-d-old animals (Table 2), with maximal values observed at night in both age groups (p50.0002).
The pineal 5-HTP content In both ‘‘winter’’ and ‘‘summer’’ animals, the pineal 5-HTP level did not change during postembryonic development. However, the patterns of fluctuations in its content seemed to be well-pronounced in the summer (Figure 2). The pineal 5-HTP content changed rhythmically in 2-d-old chickens hatched in the winter and in 9-d-old animals hatched in the summer (Table 3), but significant day/night differences were not found. The pineal TRP content The pattern and quantity of pineal TRP content in chickens hatched in the winter changed during postembryonic development (Figure 3). The level of this essential amino acid was lower in 9-d-old animals than in younger birds, and this difference was most pronounced at ZT 8, 10, 12, 16, 18 and 22 (p50.03). Contrastingly, in chickens hatched in the summer the Chronobiology International
Age- and season-related changes in 5-HT synthesis
63
TABLE 2. Percentage of rhythm in the pineal 5-HT content of 2- and 9-d-old chickens hatched in the winter and summer. Winter Age group 2-d-old 9-d-old
Summer
Percentage of rhythm
F value
p Value
Percentage of rhythm
F value
p Value
41.26 68.63
3.16 9.847
ns p50.01
81.80 96.77
20.223 134.716
p50.001 p50.001
FIGURE 2. Daily changes in 5-HTP content in the pineal glands of chickens. The 5-HTP level in pineal glands isolated from chickens reared in L:D 12:12 conditions, regardless of the season, was measured in birds of different ages (A and B). Each point represents the values obtained from three pineal glands, measured in duplicate, and the results are expressed as the mean ± SEM. Circadian rhythms are determined in separate cosinor analyses (C and D). The statistical significances are marked in the text and given in Table 3.
pineal content of TRP did not change with age (Figure 3), and significant differences between the 2- and 9-d-old birds were seen only at three time points: ZT 2, 10 and 16 (p50.03). Interestingly, higher TRP levels were found in the winter in 2-d-old animals (ZT 4, 8, 10, 12, 16, 18 and 24; p50.02), whereas in 9-d-old chickens, higher levels of this compound were found in the summer, but only at three time points (ZT 8, 12 and 14; p50.03). !
Informa Healthcare USA, Inc.
The pineal TRP content changed rhythmically only in 9-d-old birds hatched in both seasons (Table 4), with a significant difference between levels of this amino acid in the day (ZT 6) and night (ZT 18) (p50.0005 in ‘‘winter’’ animals and p50.01 in ‘‘summer’’ ones).
The pineal Tph1 mRNA level The pattern and quantity of pineal Tph1 mRNA in ‘‘winter’’ chickens did not change during postembryonic
64
A. Piesiewicz et al. TABLE 3. Percentage of rhythm in the pineal 5-HTP content of 2- and 9-d-old chickens hatched in the winter and summer. Winter Age group 2-d-old 9-d-old
Summer
Percentage of rhythm
F value
p Value
Percentage of rhythm
F value
p Value
93.78 80.18
22.618 6.067
p50.025 ns
71.18 91.87
3.706 16.96
ns p50.025
FIGURE 3. Daily changes in TRP content in the pineal glands of chickens. The TRP level in pineal glands isolated from chickens reared in L:D 12:12 conditions, regardless of the season, was measured in birds of different ages (A and B). Each point represents the values obtained from three pineal glands, measured in duplicate, and the results are expressed as the mean ± SEM. Circadian rhythms are determined in separate cosinor analyses (C and D). The statistical significances are marked in the text and given in Table 4.
development (Figure 4), although higher gene expression was found in younger animals (p50.005) at two time points: ZT 4 and 14 (p50.005). Quite the contrary, in ‘‘summer’’ animals the pineal Tph1 mRNA level was lower in the younger age group, with significant differences at ZT 6, 8, 16, 18, 20, 22 and 24 (p50.04). Moreover, in 9-d-old animals the level of the Tph1
transcript was higher in the summer than in the winter (p50.02), whereas this seasonal variation was not seen in 2-d-old chickens. The pineal Tph1 mRNA level did not change rhythmically in chickens hatched in the winter (Table 5), whereas rhythmical changes were apparent in the pineal Tph1 mRNA level in animals hatched Chronobiology International
Age- and season-related changes in 5-HT synthesis
65
TABLE 4. Percentage of rhythm in the pineal TRP content of 2- and 9-d-old chickens hatched in the winter and summer. Winter Age group 2-d-old 9-d-old
Summer
Percentage of rhythm
F value
p Value
Percentage of rhythm
F value
p Value
11.44 71.73
0.581 11.416
ns p50.01
4.92 83.02
0.233 21.996
ns p50.001
FIGURE 4. Daily changes in expression of Tph1 mRNA in the pineal glands of chickens. The level of mRNA in pineal glands isolated from chickens reared in L:D 12:12 conditions, regardless of the season, was measured in birds of different ages (A and B). Each point represents the values obtained from three pineal glands, measured in duplicate, and the results are expressed as the mean ± SEM. Circadian rhythms are determined in separate cosinor analyses (C and D). The statistical significances are marked in the text and given in Table 5.
in the summer, but significant day/night differences (ZT 6 versus ZT 18) were not found.
The pineal Ddc mRNA level The pattern and quantity of pineal Ddc mRNA in ‘‘winter’’ chickens changed during postembryonic development (Figure 5). The level of the Ddc transcript was significantly higher in 2-d-old animals than in older !
Informa Healthcare USA, Inc.
birds and these differences were most pronounced at ZT 2, 4, 6, 10, 12, 14, 16, 22 and 24 (p50.04). Oppositely, in ‘‘summer’’ chickens, the pattern and quantity of Ddc mRNA in the pineal gland did not change during postembryonic development. However, some significant differences between both age groups were found at three time points: ZT 4, 14 and 20 (p50.03). Moreover, the level of Ddc mRNA was the same in 2-d-old birds
66
A. Piesiewicz et al. TABLE 5. Percentage of rhythm in pineal Tph1 gene transcription in 2- and 9-d-old chickens hatched in the winter and summer. Winter Age group 2-d-old 9-d-old
Summer
Percentage of rhythm
F value
p Value
Percentage of rhythm
F value
p Value
29.58 39.94
1.89 2.992
ns Ns
61.44 52.54
7.169 4.982
p50.025 p50.05
FIGURE 5. Daily changes in expression of Ddc mRNA in the pineal glands of chickens. The level of mRNA in pineal glands isolated from chickens reared in L:D 12:12 conditions, regardless of the season, was measured in birds of different ages (A and B). Each point represents the values obtained from three pineal glands, measured in duplicate, and the results are expressed as the mean ± SEM. Circadian rhythms are determined in separate cosinor analyses (C and D). The statistical significances are marked in the text and given in Table 6.
hatched in both seasons (Figure 5), whereas higher expression of the Ddc gene was seen in 9-d-old ‘‘summer’’ birds at the following time points: ZT 10, 12, 14, 16 and 22 (p50.03). The pineal Ddc mRNA level changed rhythmically only in 9-d-old birds hatched in the summer (Table 6), but day/night differences (ZT 6 versus ZT 18) were seen in both 2-d-old (p50.004) and 9-d-old ‘‘summer’’ chickens (p50.02).
DISCUSSION The results of this study clearly indicate existence of seasonal postembryonic maturation of the diurnal rhythm of serotonin in the chicken pineal gland. We found that the circadian rhythm of 5-HT biosynthesis in the chicken pineal gland is already established by the second day of postembryonic life in birds hatched in the summer. Contrastingly, day/night changes in the Chronobiology International
Age- and season-related changes in 5-HT synthesis
67
TABLE 6. Percentage of rhythm in pineal Ddc gene transcription in 2- and 9-d-old chickens hatched in the winter and summer. Winter Age group 2-d-old 9-d-old
Summer
Percentage of rhythm
F value
p Value
Percentage of rhythm
F value
p Value
47.49 42.59
4.069 3.338
ns ns
18.54 50.69
1.024 4.626
ns p50.05
TABLE 7. Rhythmicity of the MEL, its precursors (TRP, 5-HTP, 5-HT), activity of enzymes (AANAT, HIOMT) and mRNA level of Tph1, Ddc, Aanat and Asmt genes in the pineal gland of 2- and 9-d-old chickens hatched in the winter and summer. Crosses indicate significant rhythmicity (p50.05 +, p50.025 ++, p50.01 +++, p50.001 ++++). Summarization of the current and recently published data (Piesiewicz et al., 2012b). Measured parameters TRP Tph1 5-HTP Ddc 5-HT Aanat AANAT Asmt HIOMT MEL
2-d-old
9-d-old
Winter
Summer
Winter
Summer
++ +++ ++++ ++++ +++
++ ++++ + +++ +++ +++
+++ – ++ +++ + +++ +++ +++
++++ + + ++++ +++ +++ +++ +
pineal 5-HT level in ‘‘winter’’ animals are visible only around the 9th d post hatch. These age- and seasonrelated differences in the circadian rhythm of 5-HT corroborate our previous findings (Piesiewicz et al., 2012b). The present study was focused not only on serotonin level, but also on particular steps in the biosynthesis of this amine. We discovered significant age- and season-related differences in the level and circadian rhythm of pineal TRP content as well as in Tph1 and Ddc gene expression in this gland. In general, the circadian rhythm of TRP as well as the levels of Tph1 and Ddc mRNAs in ‘‘winter’’ chickens developed more slowly than in ‘‘summer’’ animals. Particularly spectacular changes were seen in the mRNA level of Tph1 in the summer season. These results confirm our previous finding that the pineal gland matures faster in chickens hatched in the summer than in those hatched in the winter (Piesiewicz et al., 2012b). We failed to observe any age-dependent differences in pineal 5-HTP content, regardless of the season of hatch, but this was probably due to the insufficient sensitivity of the assay method. However, we found that daily changes in the level of 5-HTP were rhythmical in 2-d-old ‘‘winter’’ and in 9-d-old ‘‘summer’’ birds. Taken together, our current results confirmed previous observations that the chicken pineal gland maturates earlier during summer season than in winter (Table 7). Moreover, only in the !
Informa Healthcare USA, Inc.
pineal glands of the 9-d-old ‘‘summer’’ animals almost all measured parameters are rhythmical. Daily changes in the Ddc mRNA level, in comparison to Tph1, were relatively low, regardless of the age and season of hatch. Surprisingly, in the 9-d-old ‘‘summer’’ chickens, Ddc expression was rhythmic. This result was quite unexpected, because all evidence to date indicate that only the Tph1, Aanat and Asmt genes are expressed rhythmically in pinealocytes, under the control of clock genes. Moreover, this gene is generally believed to be constitutively expressed at high level (Huang et al., 2008). The first gene recognized as rhythmical, both in the pineal glands and in the chicken pineal cultures, was Tph1 (Florez et al., 1996). These authors found that the circadian rhythm of Tph1 persisted not only in L:D 12:12 conditions, but also in constant darkness. Subsequently, the circadian rhythm of Aanat expression was confirmed in chicken pineal cells cultured in L:D 12:12 conditions and in constant darkness (Bernard et al., 1997). Moreover, exposure to light during the first 6 h of the night inhibited the nocturnal increase in Aanat mRNA level. The same research group reported day/night changes in the expression of Tph1, Aanat and Asmt genes both in the pineal glands and in the chicken pineal cultures as well as day/night changes in Tph1 and Aanat expression in the chicken retina (Bernard et al., 1999). According to
68
A. Piesiewicz et al.
these authors, among the genes mediating MEL biosynthesis, only Ddc seems to be arrhythmic. Microarray analysis indicated significant daily oscillations in the level of pineal Ddc mRNA in chickens kept in L:D 12:12 conditions, without rhythmicity in D:D conditions (Bailey et al., 2003). These authors also identified orthologs of some mammalian clock genes in the chicken pineal gland, and they suggested that Tph1, Aanat and Asmt expression is under clock control. Recently published data imply that at least three of the four genes encoding enzymes participating in MEL biosynthesis are expressed rhythmically (Cassone, 2014). The results of the present study are not in complete agreement with those described above. This discrepancy may be due to differences in the experimental procedure employed, which in the present study was focused on the age and season of hatch of the animals. In the earlier microarray analysis of the chicken pineal transcriptome, 7-d-old animals were used (Bailey et al., 2003), whereas the in vitro analyses of gene expression were performed with pineal glands taken from 1 or 2-d-old animals (Bernard et al., 1997, 1999; Florez et al., 1996), and older animals were used for the in vivo analysis (Bernard et al., 1999). Moreover, in the aforementioned papers, the season of hatch was not taken into consideration. The data presented here and in recent report (Piesiewicz et al., 2012b) indicate that the chicken pineal gland matures between the 1st and 16th day of life, with the exact duration of the maturation depending on the season. Some processes that occur in this period are arrhythmic in the youngest animals and the rhythmicity develops in older individuals. The observed rhythm of Ddc gene expression probably develops between the 7th and 9th day post-hatch in the summer. Moreover, our data confirm in vivo results obtained in rats (Ishida et al., 2002). These authors identified a circadian rhythm of expression and activity of AADC in the rat suprachiasmatic nucleus: the structure known as the central oscillator in mammals. We believe that seasonal postembryonic maturation of the diurnal rhythm of melatonin in the chicken pineal gland depends on changes in serotonin biosynthesis. The results presented here confirm some data obtained in the 1980s and 1990s. The administration of TRP to chickens and rats was found to cause a rapid dosedependent increase in circulating MEL (Huether et al., 1992). Interestingly, oral TRP administration caused greater MEL elevation than the same dose given by the intraperitoneal route. Experiments conducted on pyridoxine-deficient rats have also provided some interesting information (Viswanathan et al., 1988). Pyridoxal 5-phosphate is a cofactor of the TPH enzyme and its deficiency causes reduced 5-HTP decarboxylation and ultimately results in a decrease in 5-HT. In pyridoxinedeficient rats kept in L:D 14:10 conditions, the circadian rhythm of the release of pineal NAS and MEL showed significantly lower night peaks. This suggests that 5-HT
availability is an important factor in the regulation of pineal NAS and MEL synthesis (Viswanathan et al., 1988). Intraperitoneal injection of low doses of benserazide, an AADC inhibitor, reduced levels of 5-HT and MEL in the rat pineal gland, but not in hypothalamus (Arendt et al., 1981). Intraocular administration of 5-HTP at night caused a dose-dependent increase in MEL level in the chicken retina (Thomas et al., 1998). These data suggest that the rate of MEL biosynthesis is a function of the concentration of 5-HT. A similar effect was observed in Xenopus laevis eyecup cultures (Cahill & Besharse, 1990). The administration of 5-HTP to the culture medium evoked a dose-dependent increase in MEL release and maintained the circadian rhythmicity of this release for 5 days, whereas the rhythm persisted for only 1–3 days in non-supplemented eyecup cultures. These data indicate the importance of both the substrates as well as the enzymes participating in 5-HT biosynthesis, in the regulation of MEL biosynthesis. Usually, the role of these parameters in the MEL biosynthetic pathway is not fully appreciated or and is ignored. In particular, the roles of AADC and its gene Ddc have been disregarded and not tested alongside the other parameters (Barbosa et al., 2008; Huang et al., 2008). Our results indicate that chickens kept from the day of hatch under artificial light conditions are able to recognize the season. This confirms the existence of some independent internal mechanism that recognizes the external lighting conditions, which may or may not have been experienced by the parental animals. In the literature, this mechanism is sometimes called ‘‘photoperiodic memory’’. Brandstatter et al. (2000) demonstrated that the pineal gland of the house sparrow retained ‘‘photoperiodic memory’’ both in vivo and in vitro, as in vivo synchronization to a specific photoperiod may be maintained subsequently in birds kept in prolonged darkness and also in the isolated pineal glands. Similar results have been described in migratory birds (Gwinner, 2003), what we recently discussed in detail in the previous publication (Piesiewicz et al., 2012b). The mechanisms underlying ‘‘photoperiodic memory’’ are still unknown, but epigenetic factors, such as maternal behavior, may influence the rhythmic phenotype of the offspring (Formanek et al., 2009; Janczak et al., 2007; Piesiewicz et al., 2012b). Moreover, it was showed that in chickens unpredictable food access caused seemingly adaptive responses in feeding behavior and this changed behavior was then transmitted to the offspring by epigenetic mechanisms (Natt et al., 2009). Probably this may prepare offspring for coping with unpredictable changes in environment. It was also showed that prenatal exposure of eggs to the photoperiodic lighting programs improve adaptation to a similar lighting conditions at the early stages of posthatching growth (Ozkan et al. 2012a, b), and reduce the stress susceptibility (Archer & Mench, 2013). Moreover, exposure of 19-d chick Chronobiology International
Age- and season-related changes in 5-HT synthesis embryos to a low temperature in darkness may affect melatonin production in the pineal gland (Zeman et al., 2011). However, it is yet to be determined whether and how the information on external lighting conditions experienced by laying hens (artificial photoperiod L:D 16:8, regardless of the season) and by the embryos during incubation (constant darkness) are transmitted to the newly hatched chicks, and how this may influence the pineal circadian rhythm in a season-dependent manner. It was recently proposed that changes in geomagnetic activity may also influence the circadian rhythm of some processes. Disturbances in geomagnetic activity observed close to the North pole (Alta, Norway), significantly decreased the secretion of MEL in healthy subjects during the day/night and at different times of the year (Weydahl et al., 2001). Experiments conducted on female laboratory rats over a 2-year-period indicated that the urinary excretion of 6-sulfatoxymelatonin (aMT6s) displays a seasonal rhythm and it was hypothesized that this rhythm is related to the geomagnetic field, which may act as a seasonal zeitgeber (Bartsch et al., 2012a). These authors suggested that the 11-year-sunspot cycle causes geomagnetic disturbances that probably facilitate seasonal aMT6s rhythmicity (Bartsch et al., 2012b).
CONCLUSIONS The observed differences in chicken pineal gland activity between the two age groups confirmed the rhythmical serotonin biosynthetic pathway changes during postembryonic development. The circadian rhythm of chicken pineal 5-HT biosynthesis is already established on the second day of postembryonic life and depends on the season of hatch. The efficiency of the production of this amine may limit the melatonin biosynthesis availability in the pineal gland. The apparent circadian rhythm of Ddc gene expression in 9-d-old chickens in the summer suggests that, similarly to Tph1, Aanat and Asmt, this gene may be clock controlled. This hypothesis requires verification in older animals kept both in L:D 12:12 conditions as well as in constant darkness, and in pinealocyte cultures.
ACKNOWLEDGEMENTS We would like to thank Professor Krystyna SkwarloSonta from our Department for inspiration and helpful discussion. We also acknowledge Dr Krystyna Zuzewicz from the Central Institute for Labour Protection, Warsaw, Poland for assistance in cosinor analysis.
DECLARATION OF INTEREST The authors report no conflicts of interest. The authors alone are responsible for the content and writing of this paper. !
Informa Healthcare USA, Inc.
69
This work was performed within the framework of Polish Ministry of Science and Higher Education grants NN303317733 and NN303595739.
REFERENCES Akasaka K, Nasu T, Katayama T, Murakami N. (1995). Development of regulation of melatonin release in pineal cells in chick embryo. Brain Res. 692:283–6. Archer GS, Mench JA. (2013). The effects of light stimulation during incubation on indicators of stress susceptibility in broilers. Poult Sci. 92:3103–8. Arendt J, Ho AK, Laud C, et al. (1981). Differential effect of benserazide (Ro4-4602) on the concentration of indoleamines in rat pineal and hypothalamus. Br J Pharmacol. 72:257–62. Bailey MJ, Beremand PD, Hammer R, et al. (2003). Transcriptional profiling of the chick pineal gland, a photoreceptive circadian oscillator and pacemaker. Mol Endocrinol. 17:2084–95. Barbosa R, Scialfa JH, Terra IM, et al. (2008). Tryptophan hydroxylase is modulated by L-type calcium channels in the rat pineal gland. Life Sci. 82:529–35. Bartsch H, Mecke D, Probst H, et al. (2012a). Longitudinal melatonin production in female laboratory rats during 1997– 2006: Possible modulatory effects of changing solar activity. Curr Aging Sci. 5:186–94. Bartsch H, Mecke D, Probst H, et al. (2012b). Search for seasonal rhythmicity of pineal melatonin production in rats under constant laboratory conditions: Spectral chronobiological analysis, and relation to solar and geomagnetic variables. Chronobiol Int. 29:1048–61. Bebas P, Goodall CP, Majewska M, et al. (2009). Circadian clock and output genes are rhythmically expressed in extratesticular ducts and accessory organs of mice. FASEB J. 23:523–33. Bernard M, Guerlotte J, Greve P, et al. (1999). Melatonin synthesis pathway: Circadian regulation of the genes encoding the key enzymes in the chicken pineal gland and retina. Reprod Nutr Dev. 39:325–34. Bernard M, Iuvone PM, Cassone VM, et al. (1997). Avian melatonin synthesis: Photic and circadian regulation of serotonin N-acetyltransferase mRNA in the chicken pineal gland and retina. J Neurochem. 68:213–24. Borjigin J, Zhang LS, Calinescu AA. (2012). Circadian regulation of pineal gland rhythmicity. Mol Cell Endocrinol. 349:13–9. Brandstatter R, Kumar V, Abraham U, Gwinner E. (2000). Photoperiodic information acquired and stored in vivo is retained in vitro by a circadian oscillator, the avian pineal gland. Proc Natl Acad Sci USA. 97:12324–8. Cahill GM, Besharse JC. (1990). Circadian regulation of melatonin in the retina of Xenopus laevis: Limitation by serotonin availability. J Neurochem. 54:716–9. Cassone VM. (2014). Avian circadian organization: A chorus of clocks. Front Neuroendocrinol. 35:76–88. Chong NW, Bernard M, Klein DC. (2000). Characterization of the chicken serotonin N-acetyltransferase gene. Activation via clock gene heterodimer/E box interaction. J Biol Chem. 275: 32991–8. Florez JC, Seidenman KJ, Barrett RK, et al. (1996). Molecular cloning of chick pineal tryptophan hydroxylase and circadian oscillation of its mRNA levels. Brain Res Mol Brain Res. 42: 25–30. Formanek L, Richard-Yris MA, Houdelier C, Lumineau S. (2009). Epigenetic maternal effects on endogenous rhythms in precocial birds. Chronobiol Int. 26:396–414. Guerrero JM, Reiter RJ. (2002). Melatonin-immune system relationships. Curr Top Med Chem. 2:167–79. Gwinner E. (2003). Circannual rhythms in birds. Curr Opin Neurobiol. 13:770–8.
70
A. Piesiewicz et al.
Herichova I, Zeman M, Mackova M, Griac P. (2001). Rhythms of the pineal N-acetyltransferase mRNA and melatonin concentrations during embryonic and post-embryonic development in chicken. Neurosci Lett. 298:123–6. Huang Z, Liu T, Chattoraj A, et al. (2008). Posttranslational regulation of TPH1 is responsible for the nightly surge of 5-HT output in the rat pineal gland. J Pineal Res. 45:506–14. Huether G, Poeggeler B, Reimer A, George A. (1992). Effect of tryptophan administration on circulating melatonin levels in chicks and rats: Evidence for stimulation of melatonin synthesis and release in the gastrointestinal tract. Life Sci. 51:945–53. Ishida Y, Yokoyama C, Inatomi T, et al. (2002). Circadian rhythm of aromatic L-amino acid decarboxylase in the rat suprachiasmatic nucleus: Gene expression and decarboxylating activity in clock oscillating cells. Genes Cells. 7:447–59. Janczak AM, Torjesen P, Palme R, Bakken M. (2007). Effects of stress in hens on the behaviour of their offspring. Appl Anim Behav Sci. 107:66–77. Lovenberg W, Weissbach H, Udenfriend S. (1962). Aromatic L-amino acid decarboxylase. J Biol Chem. 237:89–93. Majewski P, Adamska I, Pawlak J, et al. (2005a). Seasonality of pineal gland activity and immune functions in chickens. J Pineal Res. 39:66–72. Majewski P, Dziwinski T, Pawlak J, et al. (2005b). Antiinflammatory and opioid-mediated effects of melatonin on experimental peritonitis in chickens. Life Sci. 76:1907–20. Markowska M, Bentkowski P, Kloc M, Pijanowska J. (2009). Presence of melatonin in Daphnia magna. J Pineal Res. 46: 242–4. Natt D, Lindqvist N, Stranneheim H, et al. (2009). Inheritance of acquired behaviour adaptations and brain gene expression in chickens. PloS one. 4:e6405. Ozkan S, Yalcin S, Babacanoglu E, et al. (2012a). Photoperiodic lighting (16 hours of light:8 hours of dark) programs during incubation: 1. Effects on growth and circadian physiological traits of embryos and early stress response of broiler chickens. Poult Sci. 91:2912–21. Ozkan S, Yalcin S, Babacanoglu E, et al. (2012b). Photoperiodic lighting (16 hours of light:8 hours of dark) programs during incubation: 2. Effects on early posthatching growth, blood physiology, and production performance in broiler chickens in relation to posthatching lighting programs. Poult Sci. 91: 2922–30. Pang SF, Li L, Ayre EA, et al. (1998). Neuroendocrinology of melatonin in reproduction: Recent developments. J Chem Neuroanat. 14:157–66.
Piesiewicz A, Kedzierska U, Adamska I, et al. (2012a). Pineal arylalkylamine N-acetyltransferase (Aanat) gene expression as a target of inflammatory mediators in the chicken. Gen Comp Endocrinol. 179:143–51. Piesiewicz A, Kedzierska U, Podobas E, et al. (2012b). Seasondependent postembryonic maturation of the diurnal rhythm of melatonin biosynthesis in the chicken pineal gland. Chronobiol Int. 29:1227–38. Portaluppi F, Smolensky MH, Touitou Y. (2010). Ethics and methods for biological rhythm research on animals and human beings. Chronobiol Int. 27:1911–29. Reiter RJ, Tan DX, Fuentes-Broto L. (2010). Melatonin: A multitasking molecule. Prog Brain Res. 181:127–51. Skwarlo-Sonta K, Nowak K, Joachimiak E, et al. (2011). Season-related postmebryonic development of the melatonin biosynthesis circadian rhythm in chicken. In Haldar PBC, Basu P, eds. Avian pineal gland as a clock and calendar. Varanasi U.P. India: Imagination Editor & Printers, pp. 153–66. Thomas KB, Brown AD, Iuvone PM. (1998). Elevation of melatonin in chicken retina by 5-hydroxytryptophan: Differential light/ dark responses. Neuroreport. 9:4041–4. Turkowska E, Rai S, Majewski PM, Skwarło-Son´ta K. (2013). Diurnal and seasonal changes in IL-6 and IL-18 gene expression in blood leukocytes of male chickens with experimental peritonitis: The impact of lighting conditions and melatonin. J Anim Feed Sci. 22:149–57. Underwood H, Steele CT, Zivkovic B. (2001). Circadian organization and the role of the pineal in birds. Microsc Res Tech. 53: 48–62. Viswanathan M, Siow YL, Paulose CS, Dakshinamurti K. (1988). Pineal indoleamine metabolism in pyridoxine-deficient rats. Brain Res. 473:37–42. Voisin P, Guerlotte J, Bernard M, et al. (1992). Molecular cloning and nucleotide sequence of a cDNA encoding hydroxyindole O-methyltransferase from chicken pineal gland. Biochem J. 282: 571–6. Weydahl A, Sothern RB, Cornelissen G, Wetterberg L. (2001). Geomagnetic activity influences the melatonin secretion at latitude 70 N. Biomed Pharmacother. 55:57s–62s. Zeman M, Gwinner E, Somogyiova E. (1992). Development of melatonin rhythm in the pineal gland and eyes of chick embryo. Experientia. 48:765–8. Zeman M, Pavlik P, Lamosova D, et al. (2011). Entrainment of rhythmic melatonin production by light and temperature in the chick embryo. Avian Poult Biol Rev. 15:197–204.
Chronobiology International
Copyright of Chronobiology International: The Journal of Biological & Medical Rhythm Research is the property of Taylor & Francis Ltd and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
