JOURNAL OF PATHOLOGY, VOL.

162: 127-133 (1990)

SEQUENCE ANALYSIS OF AMPLIFIED t( 14;18) CHROMOSOMAL BREAKPOINTS IN B-CELL LYMPHOMAS S. EICK, G. KRIEGER, I. BOLZ AND M. KNEBA

Abteilung Hamatologie/Onkologie, Zentrum Innere Medizin, Klinikum der Universitat Gottingen, F. R.G. Received 9 April 1990 Accepted 30 May 1990

SUMMARY We have explored different strategies for sequencing of major breakpoint (mbr) junctional regions in t( 14;18) chromosomal translocations-the most frequent chromosomal abnormality observed in B-cell lymphomas. We demonstrate that coupling of the preparation of single-stranded DNA by asymmetric polymerase chain reaction (PCR) and direct sequencing is the method of choice for the rapid and precise determination of clone-specific bcl-2/JHfusion gene sequences. The rapidity, relative ease, and accuracy of the technique, described for the nucleotide sequence analysis of mbr t(14; 18) breakpoints, permits the analysis of a relatively large number of samples and should be considered as part of the clinical evaluation of lymphoma patients. Furthermore, by providing sequence information of clone-specific DNA regions, the procedure should reduce the risk of false-positive results from PCR. KEY WORDS-bcl-2,

lymphoma, chromosomal breakpoint, PCR, asymmetric PCR, DNA sequence analysis, N-region.

INTRODUCTION The in vitro amplification of specific DNA target sequences with the automated polymerase chain reaction (PCR) has greatly facilitated the analysis of point mutations or rearranged gene segments. The method allows amplification of DNA molecules by more than six orders of magnitude within a few hours. The high sensitivity of PCR-based methods makes them ideally suited for application in clinical diagnostics.' In particular, the combination of PCR amplification with DNA sequencing gives sequence information from limited DNA sources or even single cells.24 For clinical research the analysis of chromosomal translocations, inversions, deletions, or point mutations in specific genes or regulatory sequences has yielded new insights into the pathogenesis of various neoplasm^.^ In a significant portion of chromosomal translocations, observed in B-cell lymphomas, the immunoglobulin genes are involved. In Burkitt lymphomas, translocations of the c-myc gene into Addressee for correspondence: Dr Michael Kneba, Abteilung Harnatologie/Onkologie, Georg-August-Universitat, RobertKoch-Str. 40, D-3400 Gottingen, F.R.G.

0022-341 7/90/100127-07 $05.00 0 1990 by John Wiley & Sons, Ltd.

either the heavy or the light chain immunoglobulin gene loci, i.e., t(8; 14), t(8;22), t(2;8), have been described.CL* Similarly, most follicular B-cell lymphomas show a rearrangement of the putative oncogene bcl-2, which is transposed from its normal position on chromosome 18 into the joining region (JH)of the immunoglobulin heavy chain gene on chromosome 14. Two clusters of breakpoints, downstream of the coding region, have been characterized in the bcl-2 gene. The major breakpoint region (mbr) on chromosome 18 lies within the large 3' untranslated region of the bcl-2 gene and is involved in about 60 per cent of the t(14;18) chromosomal transloc a t i o n ~ . ~ ' ~The - " minor cluster region (mcr), which is at least 20 kb distant from the bcl-2 gene, is involved in about 25 per cent of all translocations.'* On chromosome 14, usually the 5'-portion of one of the six J, segments is joined with the bcl-2 breakpoint. The use of two oligonucleotides, one complementary to the bcl-2 gene close to the breakpoint region and the other complementary to the J, consensus sequence, allows the amplification of the bcl-2/JH fusion genes by PCR.3,4,'33'4

128

S. EICK E T A L .

We have developed a PCR procedure which permits visual detection of bcl-2/JH fusion genes in ethidium bromide-stained agarose gels.I5 The high specificity of the assay allows rapid DNA sequence determination of previously uncharacterized t( 14; 18)chromosomal breakpoints. Between thechromosome- 18 and -14 breakpoints insertions of variable lengths are found. These insertions, called Nsegments in analogy to those found at the V-D-J joints of heavy chain immunoglobulin and T-cell antigen receptor genes, are obviously incorporated by terminal transferase (TdT), independent from template DNA.I6 The variations in the breakpoint positions in bcl-2 and J, genes, together with the highly variable extranucleotide insertions in the junctional region N-segments,” represent clonespecific target sequences which allow the construction of oligonucleotides for clone-specific PCR. These specific DNA tumour markers should reduce the risk of false-positive results due to carryover of amplified DNA segments, inherent in all PCRbased detection schemes.’.l8 However, in order to obtain reliable results with the use of N-specific primers it is of critical importance that every determined N-region base is correct. For a broad application of this technique in clinical diagnostics rapid and simple DNA sequencing procedures have to be available. In order to find optimal experimental conditions for rapid and accurate DNA sequence analysis of major breakpoint bcl-2/JH junctional regions (mbr), we explored different strategies for the sequencing of these fusion gene segments. MATERIALS AND METHODS Using standard methods,” high molecular weight DNA was extracted from snap-frozen peripheral blood, bone marrow, or lymph node biopsy specimens which were collected during routine diagnostic procedures on lymphoma patients attending our institution for diagnosis and treatment. The lymphomas were categorized according to the Kiel classification,20 using conventional morphological and immunohistological techniques. Siandurd PCR conditions 1 pg of genomic DNA was used for amplification in an automated thermocycler (Biomed, Theres, F.R.G.) during 40 cycles of PCR in loop1 of PCR buffer ( 1 0 m ~Tris-HC1 (pH 8.3), 5 0 m ~KCl, 2.5 mM MgCl,, 200 ,UM each deoxynucleotide, 0.02

per cent gelatin) containing 50 pmol each of oligos 1 and 2 , and 2.5 units of Taq Polymerase (CetusPerkin Elmer, Emeryville, CA). Cycle conditions were 92°C (denaturation) for 1 min and 65°C (annealing and extension) for 1 min. The first denaturation and the last extension step were extended to 6 min. Amplification products were analysed on 2 per cent low melting agarose gel (Nusieve, GTG; FMC, Rockland, ME). The specific bands were excised and DNA was isolated by phenol extraction followed by ethanol precipitation. Upscaling and cloning of specijic PCR fragments 1&20 ng of specific DNA was reamplified for a further 20 cycles under standard PCR conditions with l00pmol of oligo 1’ and 2’. Four parallel reamplifications yielded up to 20 pg of DNA with EcoRI restriction sites incorporated by the oligos 3 and 4 to both ends. After EcoRI digestion, the specific fragments were isolated from low melting agarose gel and used for direct sequencing. An aliquot was ligated into pUC19 vector2’and transformed into DH5a. Plasmid preparations were made following a standard protocol.” Asymmetric PCR 1&20 ng of specific DNA was subjected to asymmetric amplification ( 3 5 4 0 cycles) under standard PCR conditions but with one of the two oligos reduced from 50 pmol to 1 pmol. Efficient asymmetric amplification was controlled after agarose gel electrophoresis of an aliquot of the sample. DNA sequence analysis The nucleotide sequence of specific DNA fragments was determined using the dideoxy chain-termination method22with modified T7-polymera~e.~~ All reagents were taken from the ‘T7-Sequencing Kit’ (Pharmacia, Freiburg, F.R.G.) following protocol instructions. Short sequencing reactions gave good results with 5 pmol of labelled nucleotides (a[35S]-dATP> 1000 Ci/mmol; Amersham-Buchler, Braunschweig, F.R.G.). Probes were run on 8 per cent polyacrylamide gels. After 1-2 days exposure time of the dried acrylamide gels to X-ray film, approximately 200 bases could be resolved, with the first readable base beginning 4-20 nucleotides from the 3’-end of the sequencing primer.

( a ) Sequencing cloned D N A 4 pg of ‘miniprep’ DNA samples24were purified using ‘Gene Clean’

129

CHROMOSOMAL BREAKPOINTS IN B-CELL LYMPHOMAS

Table I-List

of synthetic oligonucleotides for PCR and sequencing 3'

5'

(1) (2) (1') (2') (3)

: : : : : : :

J,

bcl-2 J, EcoRI bcl-2 EMRI bcl-2 internal M- 13 universal M- 13 reverse

+

+

Reference 33 11 33 11 11 21 21

GGTGACCAGGGTCCCTTGGCCCCAG GCAATTCCGCATTTAATTCATGGTATTCAGGAT GTCGACGAATTC-oligo 1 GTCGACGAATTC-oligo 2 GAGTTGCTTTACGTG GTAAAACGACGGCCAGT CAGGAAACAGCTATGAC

I

genomic DNA 1st amplification

1

I

4 0 cycles (oligos 1+2)

I

J-\ lR'\

asymmetric PCR

symmetric PCR

2 0 cycles (oligos 1'. 2')

2nd amplification

EcoAl

ds DNA

cloning

+

denaturing

0

sequencing

35 cycles

u 0 0 0

ss DNA

I

1

sequencing

Fig. I-Strategies for the amplification and sequencing of the bcl-2/JHfusion gene segments. For details see text

(USB) according to the manufacturer's instruction. Following alkaline denaturation and ethanol precipitation, both strands of the insert were sequenced after 30 min annealing at 37°C of 2 pmol M 13universal or reverse primer (Table I), or alternatively with the primers 1 (JH)or 3 (bcl-2, internal).

( b ) Sequencing double-strunded (ds) DNA2-5 p g of specific PCR product, 20 pmol of sequencing primer (oligo 1 or 3, Table I), and l p l of 10 per cent NP40 or alternatively 1 p1 of DMSO were added to a final volume of 14 pl." The mixture was boiled for 3 min and immediately cooled on dry ice to minimize renaturation. Alternatively, alkaline

denaturation in 0.2 M NaOH and subsequent DNA precipitation were practiced. After adding 3 pl of P ( Ci/mmol, labelling mix, 1 p1 O ~ U - [ ' ~ S ] - ~ A>T1000 10 pCi/pl), and 3 units of T7-polymerase, the resulting mixture was divided equally into four tubes, each containing 2 . 5 ~ 1of the specific ddNTP mix. Subsequent steps were done according to protocol instructions (T7-Sequencing Kit, Pharmacia).

( c ) Sequencing single-stranded (ss) DNA-DNA from asymmetric amplification was extracted once with 1 volume of chloroform/isoamylalcohol(24:1). The probe was subsequently desalted and separated from free oligos and nucleotides with a Centricon

130

S . EICK ET AL.

AGCT

RESULTS AND DISCUSSION

AGCT

Experimental conditions for specific amplification of the t( 14;18) major breakpoint region have been de~cribed.~,’’ Several methods for the sequencBCL-2 ing of PCR-amplified DNA segments have also been To determine the conditions for optimal speed and accuracy of the overall procedure, we investigated three different approaches for sequencing previously uncharacterized bcl-2/JH N fusion gene fragments in a set of follicular B-cell lymphomas. An overview of the DNA amplification e and sequencing strategies used is shown in Fig. 1. The first amplification yields about 10CL500ng of DNA after 40 cycles of PCR. Reamplification of JH6 10-20 ng of the specific fragment with oligos 1’ and 2‘ yielded up to 20pg of DNA with EcoRI restricFle? pFlel tion sites flanking both ends. Aliquots of this ampliFig. 2-DNA sequence of the bcl-2/JH-PCRproduct in patient fication were cloned into the EcoRI site of pUC19. Fle determined directly (left) or after cloning into pUC 19 (right). The remaining PCR product was used for direct The base substitution (T to C transition) in the N-region (marked by the open arrow) which was found in one out of four cloned sequencing. Sequences could be read from cloned isolates (right) could not be detected when the PCR product was DNA molecules as well as from ‘upscaled’ PCR directly sequenced (left). The junction of bcl-2 (mbr), N-region, preparations of template DNA. However, sequencand JH6is shown. The bcl-2 and J,6 breakpoints which are joined ing results from several cloned isolates, derived together by a stretch of 24 N-region nucleotides are indicated by from individual patients, showed various singlesolid arrows base substitutions compared with a bcl-2 cDNA sequence.“ The sequences of several cloned molecules from one individual patient were analysed and a consensus sequence was established. A comparison a b c dM bp of these results with data from directly sequenced PCR product showed that several observed base substitutions were indeed ‘pseudo-point mutations’ 603 due to misincorporation by Taq polymerase. The error frequency (mutation rate) incorporated by Taq DNA polymerase in the temperature range ds -310 I ) 234 useful for PCR (50-70°C) during a single round I ) 194 ss of DNA synthesis is 1 per 9000 nucleotides. After -118 30 cycles of PCR the base substitution error accumulates to 0.25 per cent per synthesized n~cleotide.~’~’~ Fig. 3-DNAs from four t(14;18) lymphomas (lanes a d ) were We compared DNA sequences from several amplified by asymmetric PCR with oligos 1 and 2 and run on an cloned isolates with data from directly sequenced ethidium bromide-stained agarose gel. The upper bands (range 260-320 bp) represent double-stranded (ds) DNA; the lower PCR products of six different lymphoma DNAs. bands (range 22G260 bp) the single-stranded (ss) DNA. Unspe- Seven base substitution errors (0.38 per cent) were cific bands in lane c above 600 bp did not disturb the direct found within 1852 sequenced bases of cloned molsequencing reaction. M stands for Haelll-digested q 174 phage ecules (4 x T to C, 3 x A to G transitions). In two DNA patients, this ‘mutation’ involved the N-region. An example is shown in Fig. 2. The base exchange in the 100 concentrator (Amicon, Danvers, MA) by N-region of the bcl-2/JHjuncture (T to C transition) repeated washing/centrifugation steps. Half of the which was detected in one out of four cloned isoconcentrated DNA sample was primed at 37°C for lates of this individual fusion gene could not be 15 min with 2 pmol of the appropriate oligo and confirmed when the PCR product was directly sequenced. Thus, our data provide further evidence used directly for sequencing.

-

a-

-

--

131

CHROMOSOMAL BREAKPOINTS I N B-CELL LYMPHOMAS

AGCT AG C T

PRIMER I -

AGCT

N

O

I

I

JH 5

ACC T

N

PRIMER

J

H6

N

E L - 2

B C L-2

BCL-2

B CL-2

fig. +DNA sequences of four representative bcl-Z/J, fusion genes, determined by direct sequencing of the asymmetrically (50pmol oligo 1, 1 pmol oligo 2) amplified PCR products. Sequencing reactions were primed with oligo 5 (bcl-2-internal). Sequenced probes were loaded on an 8 per cent polyacrylamide gel and run at 2000 V for 2 h. The junctions of J,3, J,4, J,5, and J,6, N-segments, and the bcl-2 mbr are shown in the autoradiogram. The sequences between the consensus J,-primer (top) and the N-region allow the determination of the involved J, element.33 Bcl-2 breakpoints on chromosome 18 are indicated by arrows. Between the bcl-2 breakpoints and the beginning of the particular J,-segment, clone-specific N-regions of variable length (2-26 bp) were identified

that the high error frequency of Taq PCR can clearly be identified by sequencing several cloned isolates. Accurate sequence data are obtained by analysing several clones per patient and establishing a consensus sequence, or by direct sequence analysis of the PCR p r o d ~ c t . ~If' a sufficient number of target sequences are present in the genomic DNA sample, misincorporation events are averaged out by direct sequencing of PCR products, because they account for less than 1 per cent at each nucleotide po~ition.~'.~~ Beside base substitution errors introduced by Taq polymerase, contamination of PCR reagents,

instruments, and the whole laboratory environment with PCR-amplified target DNA may be another source of error in PCR These problems were initially a major problem in our laboratory after having cloned six different t( 1438) junctional regions. In search for additional lymphoma DNAs carrying the mbr t( 14;18), we directly sequenced several false t( 14;18)-positive, PCRamplified DNAs. They could be clearly identified as stemming from previously cloned bcl-2/JH fusion genes by virtue of their unique N-segment and chromosome 14 and 18 breakpoints (data not shown). This problem was solved by using three

132

S . EICK ET AL.

totally separated rooms, each with its own equipment and chemicals for (a) extraction of genomic DNA, (b) pipetting of the PCR reagents, and (c) analysis of PCR products. A method of sequence analysis oft( 14;18)chromosomal breakpoints which circumvents cloning or excessive production of specific DNA fragments via PCR is the asymmetric amplification of DNA followed by direct sequencing of the single-stranded product. In this procedure, one of the two PCR primers is added in 50- to 100-fold molar excess. During the first cycles target DNA is exponentially amplified until the limiting primer is consumed. At this point, one DNA strand is amplified linearily. After 20 further cycles of amplification this strand is theoretically produced in a 20-fold molar excess over the double-stranded PCR fragment and can be directly sequenced with a complementary primer. One typical result of asymmetric amplifications is shown in Fig. 3, Aliquots of the reactions were analysed on an ethidium bromide-stained 2 per cent agarose gel. The lower bands represent the single-stranded DNAs after 35 cycles of PCR. The relative amount is underestimated because ethidium bromide intercalates more efficiently in doublestranded DNA (upper bands). The excellent capacity of asymmetric PCR in producing intact singlestranded DNA for sequencing is shown in Fig. 4 with the example of four representative, previously uncharacterized bcl-2/JH fusion genes. The results shown in Fig. 4 were obtained within 3 days, starting with 40 cycles of PCR on genomic DNA. Sequence analysis of several amplified DNA fragments from the DNA of different patients enabled the identification of individual J,-segments, when data were compared with published germline J,-seq~ences.~’As shown in Fig. 4, specific and efficient amplifications of bcl-2 sequences fused to J,3, J,4, J,5, and J,6 gene segments were practicable despite the presence of up to three mismatches (for J,6) between J,-consensus primer 1 (Table I) and human germline J,-seq~ences.’~ In summary, all three procedures that we investigated for DNA sequence analysis of amplified mbr t( 14;18) junctional regions yielded useful results. Exact data were obtained most quickly by asymmetric amplification and direct sequencing. The accuracy and rapidity of this method for the molecular analysis oft( 14;18) chromosomal breakpoints-the most frequent chromosomal abnormality in B-cell lymphomas-permit the analysis of a relatively large number of samples, and in the future this method may become part of the evaluation of

patients with lymphatic neoplasms. Moreover, this approach should help to reduce the problem of false-positive results from PCR by analysing the nucleotide sequence of patient-specific DNA. ACKNOWLEDGEMENTS

We thank Dr M. Bergholz, Institute of Pathology, University of Gottingen for providing biopsy material. The oligonucleotides were synthesized by Dr Brysch, MPI fur Biophysikalische Chemie, Gottingen. This work was supported in part by the Deutsche Krebshilfe. REFERENCES I . Eisenstein BI. The polymerase chain reaction: a new method of using molecular genetics for medical diagnosis. N Engl J Med 1990; 322: 178-1 83. 2. Higuchi R, von Beroldingen CH, Sensabaugh GF, Ehrlich HA. DNA typing from single hairs. Nature 1988; 332 543-546. 3. Crescenci M, Set0 M, Herzi GP, Weiss PD, Griffith RC, Korsmeyer SJ. Thermostable DNA polymerase-chain amplification of t(14;18) chromosome breakpoints and detection of minimal residual disease. Proc Nut1 Acad Sci U S A 1988; 85: 48694873. 4. Lee MS, Chang KS, Cabanillas F, Trujillo EJ, Freireich J, Stass SA. Detection of minimal residual cells carrying the t(14;18) by DNA sequence amplification. Science 1987; 237: 175-178. 5. Friend SH, Drya TP, Weinberg RA. Oncogenes and tumorsuppressing genes. N Engl J Med 1988; 318 618-622. 6. Tau R, Kirsch I, Morton C, el al. Translocation of the c - m y gene into the immunoglobulin heavy chain locus in human Burkitt’s lymphoma and murine plasmacytoma cells. Proc Narl Acad Sci U S A 1982; 7 9 7837-7841. 7. Dalla-Favera R, Martinotti S, Gallo R, Croce CM. Translocation and rearrangements of the c - m y oncogene locus in human undifferentiated B-cell lymphomas. Science 1983; 219 963-967. 8. Leder P, Battey J, Lenoir G, el al. Translocation among antibody genes in human cancer. Science 1983; 222: 765-771. 9. Lipford E, Wright JJ, Urba W, e f al. Refinement of lymphoma cytogenetics by the chromosome 18q21 major breakpoint region. Blood 1987;6 1816-1823. 10. Weiss LM, Warnke RA, Sklar J, Cleary ML. Molecular analysis of the t( 14;18) chromosomal translocation in malignant lymphomas. N Engl J M e d 1987; 1 9 1185-1 189. 1 I . Cleary ML, Smith SD, Sklar J. Cloning and structural analysis of cDNAs for bcl-2 and a hybrid bcl-2/immunoglobulin transcript resultingfrom the t(1418) translocation. Cefl 1986; 1: 19-28. 12. Cleary ML, Galili N, Sklar J. Detection of a second t(14;18) breakpoint cluster region in human follicular lymphomas. J Exp Med 1986; 1: 315-320. 13. Stetlet Stevenson M, Raffeld M, Cohen P, Cossman J. Detection of occult follicular lymphoma by specific DNA amplification. Blood 1988; 5 1822-1825. 14. Ngan BY, Nourse J, Cleary ML. Detection of chromosomal translocation t( l4;18) within the minor cluster region of bcl-2 by polymerase chain reaction and direct genomic sequencing of the enzymatically amplified DNA in follicular lymphomas. Blood 1989;7 3 1759-1762. 15. Kneba M, Eick S, Willigeroth S, P I al. Polymerase chain reaction analysis oft( l4;18) junctional regions in B-cell lymphomas. Leukemia Lymphoma 1990; 162: in press. 16. Desiderio SV, Yancopoulos GD, Paskind M, el al. Insertion of N regions into heavy-chain genes is correlated with expression of terminal desoxytransferase in B cells. Nature 1984;2 5 752-755. 17. Lieber MR, Hesse JE, Mizuuchi K, Gellert M . Lymphoid V(D)J

CHROMOSOMAL BREAKPOINTS IN B-CELL LYMPHOMAS recombination: nucleotide insertion at signal joints as well as coding joints. Proc Narl AcadSci USA 1988; 85: 8588-8592. 18. Kwok S, Higuchi R. Avoiding false positives with PCR. Nature 1989; 3 3 9 237-238. 19. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a Laboratory Manual. Cold Spring Harbour, NY: Cold Spring Harbour Laboratory Press, 1989. 20. Stansfeld AG, Diebold J, Noel H, er al. Updated Kiel classification for lymphomas. Lancet 1988; i: 292-293. 2 1. Vieira J, Messing J. The pUC plasmid, an M I3 mp7 derived system for mutagenesis and sequencing with synthetic universal primers. Gene 1982; 19: 259-268. 2 2 . Sanger F, Micklen S, Coulson AR. DNA sequencing with chainterminating inhibitors. Proc Natl Acad Sci U S A 1977; 7 4 5463-5467. 23. Tabor S, Richardson CC. DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Proc Narl Scud Sri USA 1987; 8 4 47674771 24. Birnboim C, Doly J. Rapid alkaline extraction procedure for screeningrecombinant plasmid DNA. Nucleic Acids Res 1979;7: 1513-1523. 25. Winship PR. An improved method for directly sequencing PCR amplified material using dimethyl sulphoxide. Nucleic Acid.7 Res 1989; 3: 1266. 26. Scharf SJ, Long CM, Erlich HA. Sequence analysis of the HLA-DR

27.

28. 29.

30. 31. 32. 33.

133

beta and HLA-DQ beta loci from three pemphigus vulgaris patients. Hum Immunol1988;1: 61-69. Kogan SC, Doherty M, Gitschier J. An improved method for prenatal diagnosis of genetic diseases by analysis of amplified DNA sequences: application to hemophilia A. N EnglJ Med 1987; 317: 985-990. Collins SJ. Direct sequencing of amplified genomic fragments documents N-ras point mutations in myeloid leukemia. Oncogene Res 1988; 2: 117-123. Innis MA, Myambo KB, Gelfand DH, Brow MA. DNA sequencing with Thermus aquaticus DNA polymerase and direct sequencing of polymerase chain reaction-amplified DNA. Proc Natl Acad Sci USA 1988; 24: 9436-9440. Engelke DR, Hoener PA, Collins FS. Direct sequencing ofenzymatically amplified human genomic DNA. Proc Nall Acad Sci U S A 1988; 85: 544-548. Saiki RK, Gelfand DH, Stoffel S, er a/. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 1988; 239: 487491. Tindall KR, Kunkel TA. Fidelity of DNA synthesis by the Thermus aquaticus DNA polymerase. Biochemistry 1988; 27: 6008-601 3 Ravetch JV, Siebenlist U, Korsmeyer S, Waldmann T, Leder P. Structure of the human immunoglobulin j~locus: characterization of embryonic and rearranged J and D genes. Cell 1981; 27: 583-591.