J. Mol. Biol. (1978) 121, 179-192

Sequence Analysis of Operator ConstitutiveMutants of the Tryptophan Operon of Escherichia coli Gv,ORO~, N. BENNETT AND CWARLV.S Y A ~ O F S K Y

DeTartment of Biological Sciences Stanford University Stanford, Calif. 94305, U.S.A. (Received 22 August 1977, and in revised form 3 January 1978) The operator region of the tryptophan operon of Escherichia coli has been located by (1) protection of a restriction site near the site of initiation of transcription, (2) sequence ana2ysis of the endpoints of relevant deletion mutants and (3) sequence analysis of the base-pair alterations in operator constitutive point mutants. The results locate the $rp operator immediately preceding the transcription start site in a region exhibiting twofold symmetry. The base-pair alterations of the operator constitutive mutants examined have no significant effect on trp promoter activity.

1. Introduction Initiation of transcription on the tryptophan (trp) operon of Escherichia eoli is regulated by operator-repressor interaction. In vivo studies indicate that repression is mediated by a complex formed between an aporepressor, the product of trpR, and L-tryptophan (Cohen & Jacob, 1959; Morse & Yanofsky, 1969). Repressor control is exerted at the trp operator, trpO, located near the trp promoter, preceding trpE (Hiraga, 1969). In vitro experiments have shown that the aporepressor-tryptophan complex inhibits trp operon expression in a coupled transcription-translation system (Zubay et al., 1972; Zalkin et al., 1974), in S-100 extracts (McGeoch et al., 1973), and in a simplified transcription system employing purified RNA polymerase (Rose et al., 1973; Squires et al., 1973). It was suggested that the Trp repressor acts by competing with RNA polymerase for a site essential for transcription initiation (Squires et al., 1975). In recent studies it has been shown that the Trp repressor as well as RNA polymerase can protect an HpaI site, located near the site of trp messenger RNA initiation, from cleavage by HpaI restriction endonuclease (Bennett eta/., 1976). Mutant analyses indicate that the operator does not extend significantly into the transcribed portion of the operon and that a region of twofold symmetry exists in the DNA near the protected HpaI site (Bennett et al., 1976). In this report the trp operator is located more exactly by further protection experiments, by sequence analyses with deletion mutants, and by determination of the base-pair changes in operator constitutive point mutants. The effect of these mutations on the function of the trp promoter, which overlaps the trp operator, was determined. 179 0022-2836/78/I212-7992 $02.00/0 © 1978 Academic Press Inc. (London) Ltd

180

G. N. B E N N E T T AND (2. Y A N O F S K Y

2. Materials and Methods (a) Isolation of operator constitutive mutations Strains which lack t r y p t o p h a n synthetase a cammt grow on a medium supplemented with a low level of indole and a high level of 5-methyltryptophan. This is due to the fact t h a t growth on indole is dependent on t r y p t o p h a n synthetase f12 activity and this activity is reduced by 5-methyltryptophan-mediated repression and the absence of the activating effect of t r y p t o p h a n synthetase a. Such strains will grow, however, if they are repressor minus or operator constitutive. Agar supplemented with indole and 5-methyltryptophan m a y therefore be used to select trpO c and trpR mutations in strains lacking t r y p t o p h a n synthetase a. These two types of mutations can subsequently be distinguished by genetic linkage analysis, since trpO ~ mutations b u t not trpR mutations are cotransducible with the trp operon. Strains W3110 trpA14-A17 and W3110 A[tonBtrpA229] m u t t were diluted to 103 eells/ml in 5 ml of L broth and shaken overnight at 37°C. The cultures were then diluted and plated on minimal agar supplemented with indolc (1.5 /~g/ml), DT.-5-methylt r y p t o p h a n (50 ~g/ml), aeid-hydrolyzed casein (0"2~/o) and glucose (0"2~/o). After 3 days of incubation at 37°C, colonies of various sizes were picked and streaked on the same meditun. P1 lysates were prepared on groups of 6 single colony isolates from each tube. These lysates were used to transduce W3110 cysBtrpA14-A17 to eysB + on tryptophancontaining agar. Constitutives were identified b y replication to indole/5-methyltryptophan agar. Only 1 constitutive isolate from each tube was saved for further analysis. The extent of eonstitutivity was determined by assaying the level of anthranilate synthetase following growth in the presence of excess tryptophan. To determine whether operator constitutive mutations had promoter effects, each was introduced into strain W3110 trpRtrpA[EA2]tna2 by replacing the trpA[EA2] deletion. The resulting strains were grown in the presence of excess t r y p t o p h a n and assayed for anthranilate synthetase activity. (b) Enzyme assays Cultures were grown with vigorous aeration at 37°C for 3 generations in 200 to 250 ml volumes of minimal medium (Vogel & Bonner, 1956) supplemented with L-tryptophan (50 /~g/ml) and glucose (0.3°/o). The inoeula for these cultures were grown with a low level of glucose (0"06~/o) tmtil the carbon source was exhausted. W h e n the cell density reached 6 × 108 to 7 × 108 cells/ml, each culture was chilled and the cells collected b y centrifugation. The cells were washed once with 0.85% NaC1, scdimented, and then resuspended in 1 to 3 ml of 0.1 M-Tris.HC1 (pH 7.8). Cells were disrupted b y sonic oscillation and the debris removed by eentrifugation. Anthranilate synthetase was assayed as described elsewhere (Creighton & Yanofsky, 1970). (c) Introduction of trpO c mutations and trp deletions onto phage Although the transducing phage ¢80h-trpEA190 grows well on various strains of E. eoli, when it carries a large trp operon deletion such as trpAOCl418 it grows pcorly. We have found that plate lysates of such a trpO-trpC deletion phage, ¢80h-trpAOC1418 trpB + trpA +, prepared on trpO c bacteria, contain 5 to 50% progeny phage in which the trpA OC 1418 deletion is replaced b y the trpOC-trpC region of the plating bacterium. Following isolation and purification, trpO c phage were grown in 1 1 volumes and the phage purified by banding in CsC1 density gradients. Deletions trpAOC1418 and trpALC145 were introduced onto ¢80-trpEA190 as follows: bacteria with these deletions were transduced to prototrophy with phage ¢80h-trpEA190 trpB9579. Purified t r a n s d u c t a n t s were u.v.-induced and the phages obtained were used to transduce bacterial strain W3110 trpz~EA2 (a deletion of the entire operon) on indole agar plates. Growth of this strain on indole depends on the introduction of trpB + b y the transducing phage. Since the original phage was trpB-, trpB + could have been obtained only b y replacement from the chromosome. The final transductants on the indole agar plates were replicated to minimal agar and phage were purified fr.om around colonies t h a t were auxotrophic. Subsequent genetic tests verified t h a t the isolated and purified phages contained the deletions of interest.

trp O P E R A T O R I N E. OOLI

181

(d) Deletion mutants Deletions trpAOC1418 (formerly trpALC1418) a n d trpALC145 have been described (Bertrand et al., 1976). The trpAOC1418 deletion results in constitutive expression o f t h e remaining trp genes of the operon a t levels 5-fold elevated over those of trpR trp + strains. The same high levels are observed when the deletion is introduced into a trpR m u t a n t (Bertrand et al., 1976). The trpALC145 deletion also results in increased expression of t h e remaining genes of the operon b u t trp enzyme levels are repressed in strains with a n active T r p represser (Bertrand et al., 1976).

(e) Phage and ptasmid D N A D N A of the miniColEl-trp plasmid, p V H 153 (Helinski et al., 1977), was isolated as described b y Selker et al. (1977). D N A from trp transducing phage was isolated as described b y Rose et al. (1973). (f) Enzymes HhaI a n d HineII were o b t a i n e d from New E n g l a n d Biolabs (Beverly, Mass.). Calf intestinal alkaline phosphatase was purchased from Boehringer Mannheim (Indianapolis, Ind.). HpaI was prepared b y t h e m e t h o d of Sharp et al. (1973). T4 polynucleotide kinase , was a gift from A. Maxam. (g) Isolation of D N A restriction fragments for sequence analysis The D N A of each of t h e operator constitutive derivatives of ¢ 8 0 h - t r p E A 1 9 0 (see above) was digested with HpaI a n d the D N A fragments were resolved b y eleetrophoresis on agarose gels (Bennett et al., 1976). The 2 fragments (Mr ---- 5 × 106 and M r = 3"9 × 106), which flank the HpaI cleavage site near t h e trp m R N A initiation site were isolated from t h e gel b y high-speed eentrifugation (Brown et al., 1978). E a c h of t h e desired trp operatorcontaining fragments was c o n t a m i n a t e d with a fragment o f similar size from elsewhere in the phage. The 5 × 106 molecular weight HpaI fragment containing t h e region preceding position --12 (Bennett et al., 1978a) a n d the 3.9 × l0 s molecular weight HpaI fragment which contains trp operon D N A from position --11 to the HpaI site near the end of trpB, were t r e a t e d with phosphatase, 5' end-labeled and digested with H h a I . Separation of the products on a T r i s - b o r a t e / E D T A , 7 % p o l y a e r y l a m i d e gel (Maniatis et aI., 1975a) a~owed t h e isolation of t h e 67 base-pair HhaI-HpaI fragment (positions --78 to --12) derived from t h e 5 × l0 s molecular weight HpaI f r a g m e n t a n d t h e 72 base-pair HpaI-HhaI fragment (positions --11 to -[-61) derived from the 3 - 9 × 1 0 s molecular weight HpaI fragment free of the labeled ends arising from the contaminating DNA. The 67 base-pair and 72 base-pair fragments were labeled only a t their HpaI ends and thus were suitable for D N A sequence analysis of t h e region a r o u n d the transcription initiation site. Details o f t h e restriction m a p of this region a n d t h e complete sequences of t h e 67 a n d 72 basepair fragments are given elsewhere (Bennett et al., 1978a; Brown et al., 1978; Lee et al., 1978). D N A from phages ¢ 8 0 h - trpALC145 and ¢80h-trpAOC1418 was digested with HpaI a n d the fragments resolved on a Tris-borate/EDTA, 5 % polyaerylamide gel (Maniatis et al., 1975a). One band, t h a t containing t h e HpaI fragment which extends from the trp operator region to trpB, differed in size from t h e comparable fragment in an HpaI digest of the p a r e n t phage ~b80h-trpEA190. This fragment was eluted from the gel, t r e a t e d with phosphatase, 5' end-labeled, a n d digested with restriction enzyme HhaI in the case of the 145 deletion, and with H i n f I in the case of t h e 1418 deletion. The 2 labeled fragments derived from each digest were resolved on a Tris-borate/EDTA, 7% polyacrylamide gel, eluted a n d sequenced. The sequence of one of t h e HpaI ends corresponds to t h e sequence a t t h e end of trpB r e p o r t e d b y P l a t t & Yanofsky (1975). The other fragment has t h e sequence starting a t --10 a n d proceeding into t h e transcribed portion of the operon. (h) D N A sequence analysis and other methods The D N A sequencing m e t h o d o f M a x a m & Gilbert (1977) was employed. Details o f this a n d related procedures such as phosphatase t r e a t m e n t , 5' end-labeling of restriction fragments with [y-a2P]ATP a n d T4 polynueleotide kinase a n d restriction, eleetrophoresis and elution of D N A fragments are given b y B e n n e t t et at. (1978a).

o

"~ ~

A C~

*q.

:

~~""~

•

" " ~'-i

..~i ~

~/

'~

~ " ' ~~ ~' " "~

~

"

~' " ~~ '~

~

i~ ~

"

~rp O P E R A T O R

IN E. UOLI

183

3. Results (a) Location of the t r p operator by protection of restriction sites It was reported that Trp aporepressor in the presence of tryptophan can protect t h e H p a I s i t e a t p o s i t i o n s - - 9 t o - - 1 4 o f t h e trp o p e r o n f r o m c l e a v a g e b y t h e c o r r e s p o n d i n g r e s t r i c t i o n e n d o n u c l e a s e ( B e n n e t t et al., 1976). W e h a v e a l s o e x a m i n e d protection of a nearby HincII site (positions --32 to --37) by the same procedure. I n t h i s case, D N A o f t h e p l a s m i d p V H 153 w a s u s e d . F i g u r e 1 s h o w s t h a t R N A p o l y m e r a s e p r o t e c t s b o t h t h e HpaI ( p o s i t i o n s - - 9 t o - - 1 4 ) a n d H i n c I I s i t e s ( p o s i t i o n s - - 3 2 t o - - 3 7 ) b u t t h a t T r p r e p r e s s o r p r o t e c t s o n l y t h e HpaI site. T h i s i n d i c a t e s that the DNA region involved in strong interaction with the Trp repressor does not

FIG. 1. Protection of the HpaI restriction site ( -- 9 to -- 14) a n d lack of protection of the HincII site (--32 to --37) b y Trp repressor. The protection a n d digestions were carried out under t h e conditions described previously (Bennett et al., 1976; B r o w n et al., 1978). Slots (a) to (e) are from a n agarose gel with electrophoresis performed as described b y Selker et al. (1977). (a) A HincII digest of pVH153; fragments of approx. 3.4 × 106, 1.8 × 106, 0-8 × 106, 0"45 × 106 a n d 0.4 × 106 molecular weight are observed. I n addition, there is a 23-base-pair fragment corresponding to the region of the trp p r o m o t e r - o p e r a t o r between t h e HpaI site (--9 to --14) a n d a n adjacent HincII site (--32 to --37). (b) A HincII digest in the presence o f T r p repressor; fragments of approx. 3-4 × 10 e, 1-8 × 108, 0.8 × 106, 0.45 × 106 a n d 0.4 x 106 molecular weight are observed. I f b o t h HineII sites (--9 to --14) a n d ( --32 to --37) are protected, a p a t t e r n such as slot (f) would be obtained. I f only one of t h e HincII sites within the trp p r o m o t e r - o p e r a t o r is protected, there would be only a small (23 basepairs) increase in size in either the 0.8 × 106 or 3.4 X l0 s molecular weight fragments, which would n o t be resolved in this gel. T h a t only one of the H i n c I I sites (i.e. the HpaI site, --9 to --14) is protected from HincII digestion, is shown in slots (1) a n d (m). (c) A HpaI digest of pVH153; fragments of approx. 4.3 × l0 s and 2.6 × l0 s molecular weight. (d) A HpaI digest in the presence of Trp repressor. Only one of the HpaI sites is protected, giving a new f r a g m e n t of approx. 6.9 × l0 s molecular weight. The location of the protected HpaI site within the trp operon is described b y Brown et al. (1978). (e) Undigested pVH153 DNA. The 2 b a n d s correspond to nicked a n d supercoiled forms of the plasmid. Slots (f) to (i) are from another agarose gel a n d show t h e protection of b o t h t h e HpaI site a n d the adjacent HincII site in pVH153 b y R N A polymerase. The experim e n t a l conditions are those described b y B e n n e t t et al. (1976) a n d B r o w n eta/. (1978). Slots if) a n d (h) show the fragments expected w h e n t h e HincII site (--32 to --37) a n d the HpaI site ( - 9 to --14) are protected from digestion. (Other evidence t h a t R N A polymerase does protect b o t h of these restriction sites w h e n b o u n d a t t h e trp promoter is presented b y B r o w n eta/. (1978).) (f) A HincII digest of pVH153 in the presence of R N A polymerase. The largest f r a g m e n t is approx. 4.2 × l0 s in molecular weight a n d arises from protection of t h e HincII sites between t h e 3.4 × l0 s a n d 0.8 × l0 s molecular weight fragments (i.e. t h e HpaI site a t --9 to --14 a n d a site a t --32 to --37). The remaining fragments are equivalent to those in slot Ca). (g) A HincII digest; molecular weights of fragments are as in slot Ca). (h) A HpaI digest in t h e presence of R N A polymerase. F r a g m e n t s of approx. 6.9 × l0 s (the fragment arising b y protection of 1 of the 2 HpaI sites), 4.3 × l0 s a n d 2.6 × l0 s molecular weight are observed. (i) A HpaI digest; fragments of 4.3 × l0 s a n d 2.6 × l0 s molecular weight are observed. The HpaI site on pVH153 which is protected b y R N A polymerase is described b y B r o w n et al. (1978). Slots (j) to (m) are from a Trisborate/magnesium, 10~o polyacrylamide gel (Maniatis et al., 1975a). The 82-base-pair D N A f r a g m e n t is a HpaII-MboII fragment derived from t h e S. typhimu~ium trp p r o m o t e r - o p e r a t o r region (Bennett et al., 1978b), a n d spans the region from --59 to -}-23. I t is labeled only a t t h e 5' end (at the MboII site) in the trp leader region. Digestions were carried out u n d e r t h e conditions used to generate the samples visualized in slots (a) to (d). W e used 1 ~g of pVH158 plasmid D N A a n d the radioactively labeled D N A was detected b y autoradiography. O indicates the origin a n d X marks t h e position of the xylene cyanol F F dye. (j) A HpaI digest, f r a g m e n t of 34 base-pairs. (k) A HpaI digest in the presence of Trp repressor; t h e full length f r a g m e n t (82 base-pairs) is observed. (1) A HincII digest, f r a g m e n t of 34 base-pairs. (m) A HincII digest in t h e presence of Trp repressor, f r a g m e n t of 57 base-pairs. This experiment shows t h a t t h e HincII site a t -- 9 to -- 14 (i.e. t h e HpaI site) is protected b y Trp repressor from digestion b y HincII b u t t h a t the HincII site a t --32 to --37 is not. I t also serves as a control for slots Ca) a n d (b) in t h a t it demonstrates t h a t Trp repressor is functional u n d e r t h e conditions of HincII digestion.

184

G . N . B E N N E T T AND C. Y A N O F S K Y

extend as far to the left as --32 to --37. A similar result was obtained with the corresponding region of the t~T operon of Salmonella typhimurium (Fig. 1). (b) Location of the trp operator by analysis of deletion mutants I n phage lambda trp 46 (Franklin, 1971), lambda sequences are fused to the t ~ operon at approximately 17 base-pairs preceding the trp m R N A start site (Fig. 2). The D N A of this phage does not bind Trp repressor, therefore it lacks trp operator activity (Bennett et al., 1976). This result defines a minimal leftward extent of the trp operator. The rightward extent of the region required for operator ftmetion was determined b y analysis of the two t~T deletion m u t a n t s trpAOC1418 and trpALC145 described b y Bertrand et al. (1976). Deletion trpALC145 was found b y both R N A (Bennett et al., 1976) and DNA sequence analysis to have an altered sequence beyond position -}-1. This m u t a n t has normal operator function in vivo (Bertrand et al., 1976) and in vitro (G. Bennett, unpublished work), indicating t h a t the trp operator does not extend beyond position + 1 (Fig. 2). D N A sequence analysis of the deletion m u t a n t

--25

--20

t

I

Deletions in or near the trp operator --15 --10 --5 +1 +5 t

t

t

•

i

ATGATCGAACTAGTTAACTAGTACGCAAGTTCA + 2trp46 (O - ) ~GCTTGG trpALC145 (O ÷) -CAACGTTTTGAC trp,~OC1418 (0-) FIG. 2. The sequence of the strand of trp operon DNA homologous to trp mRNA is shown around the transcription initiation site defined by Squires et al. (1976). A line with an arrowhead indicates that the normal trp operon sequence is present in this region. The sequence which replaces the wild-type sequence beyond the deletion endpoint is shown for trpALC145 and trpAOC1418. Also indicated is the operator character of each deletion (in parentheses). Hyphens have been omitted from the sequences. trpAOC1418 showed t h a t it contains an altered sequence beginning at position --5 (Fig. 3). This m u t a n t is operator constitutive (Bertrand et al., 1976), thus the rightward endpoint of the region required for operator function m u s t be between positions - - 5 and ~-1 (Fig. 2). (c) Analysis of operator constitutive point mutants Five spontaneous and four presumed mutT-induced trpO c mutants, isolated as described in Materials and Methods, were selected for expression and sequence analyses. The m u t a n t s exhibited different levels of constitutivity, ranging from 20~/o to a m a x i m u m of 70% of the level typical of trpR m u t a n t s (Table 1). (Analyses with other t~oO ° point m u t a n t s as well have failed to detect a n y which are fully constitutive.) The nine trpO ° mutations were introduced into a trpR background so t h a t we could determine ff any of the mutations affected promoter function. As seen in Table 1, none of the mutations reduced operon expression when in a trpR background. The position of the base-pair change in the operator region of each m u t a n t was determined b y D N A sequence analysis (Maxam & Gilbert, 1977). Each trpO c region was introduced onto a phage as described in Materials and Methods and the phage

T

C

G

A

,1flip . . . .

~-,

T ~ B

"

T ~ m

A C IP

'-* '

*-

:..... " ~ : ~ 'file

~

•

.:~.~.~

:. . . . : "

.

•

.

~ . : ,:,~ . ' ~

-

.

,--"

? :

FIG. 3. DNA sequencing gel of the HpaI-HinfI fragment from q~8Oh-trp,~OC1418. The fragm e n t was 5' end-labeled a t the HpaI terminus at --11 on the strand homologous to trp m R N A {Fig. 2). The sequencing gel (20% polyacrylamide, 7 M-urea in 50 m~I-Tris-borate (pH 8-3), 1 m~'~EDTA) was run at 600 V for 9 h. The sequence derived is indicated along the side and corresponds to positions - 1 0 to + 1 5 (Figs 2 and 6).

G. N . B E N N E T T

186

AND

C. Y A N O F S K Y

TABLE 1

Operon expression and base-pair changes in t r p 0 c mutants Mutant

Oc1318 O°2 0°3 Oq 1 O~37 Oc712 Oe6 O°1924 Oc3136

Mutagen

Base-pair change Position Type

mutT spontaneous spontaneous spontaneous spontaneous

mutT spontaneous

mutT mutT

--6 -- 7 --7 -- 7 -- 7 --7 -- 15 --16 --16

G-C A. T A .T A. T A. T A.T A. T T .A T .A

Anthranflate synthetase spee. act~ ( % of trpR trpO +)

trpR +

trpR

44 59 65 69 61 35 22 41 45

95 109 105 96 94 100 104 121 105

-~ T - A -~ T . A -+ T .A -+ T . A -+ T . A --> C - G -~ G. C --> G . C --> G . C

DNA cleaved with the restriction enzyme HTaI. This enzyme cuts trp operator DNA at the HpaI restriction site at --9 to --14, allowing convenient sequence analyses in both directions from the cut ends. Sample sequencing gels are shown in Figures 4 and 5. As indicated in Table 1, each trpO c point m u t a n t has a single base-pair change in the immediate vicinity of the HpaI restriction site. Several of the mutations are repeats, and in one case different base-pair changes at the same position (--7) have different effects on constitutivity. Three of the four mutT-induced trpO ~ mutants have the expected base-pair change, A - T to C.G (Yanofsky et al., 1966). The fourth has the opposite change, G. C to A. T, and could be due to a spontaneons mutation. Interestingly, all but one of the nine trpO c mutations involved transversions. (d) Operon expression in leader deletion strains Deletions trpAOC1418 and trpALC145 terminate just before and beyond the site of transcription initiation, respectively. In order to determine whether either of these deletions affects trp promoter function, each was introduced into the standard trpR background (as was done with the trpO c point mutants; see Materials and Methods) and enzyme levels were measured in cultures grown with excess tryptophan. For comparison we grew a trpR trp + strain and a strain lacking the attenuator, trpR trpzILDl02. The latter strain has a deletion endpoint at position + 2 5 (Squires et al., 1976); it shows maximal expression of the operon. It is apparent from the data in Table 2 that operon expression in the trpAOC1418 and trpALC145 deletion strains TABLE 2

Operon exp~ssion in leader de~twn strains S~am

trpR trpR trp,dLD l 02 trpR trp£OC1418 trpR trpALC145

Tryptophan synthetase spee. act. t

18.6 125 60 77

Average of 3 s e p a r a t e d e t e r m i n a t i o n s .

25 125 74 78

Fro. 4. D N A sequencing gel of HhaI-HpaI fragments of phage containing t h e m u t a t i o n s trpO¢3136 a n d trpO¢712. The fragments were 5' end-labeled a t t h e HpaI end a t position --12 o n t h e s t r a n d complementary to trp m R N A . The gel is as described for Fig. 3. The sequences deduced are written along t h e sides a n d correspond to positions --13 to --32. The gel o n t h e left is t h a t of trpOC712; it contains the wild-type sequence in this region. The sequence of the wild-type trp operon in this region has been reported (Bennett et al., 1976,1978a). The gel on t h e r i g h t is t h a t of trpO°3136; it has a base change a t position --16; i.e. t h e A residue a t this position in t h e wild-type sequence is replaced b y a C residue.

FIG. 5. DNA sequencing gel of HpaX-HhaI fragments of phage containing the mutations trpOC3136 and trpOCT12. The fragments were 5' end-labeled at the HpaI site at position --11 on the strand homologous to trp mRNA. The gel is as described for Fig. 3. The sequences deduced are written along the sides and correspond to positions --10 to -{-10. The close spacing of the terminal A and C residues was the result of an inadequate pre-electrophoresis on this particular run. The gel on the left is t h a t of trpOa3136; it contains the wild-type sequence in this region. The gel on the right is t h a t of trpOe712; it shows a base change at position --7; i.e. the A residue at this position in the wild-type sequence is replaced b y a C residue.

trp OPERATOR IN g. UOLI

189

is high, but not at the level of the reference attenuator deletion strain, trpR trpALDl02. Since expression of the operon in trpR trpALDl02 is about 400-fold elevated over that of trpR + trp + strains, we may calculate that the trp promoters of trpR trpAOC1418 and trpR trpALC145 function at least 54% and 62% as well as the unaltered trl) promoter of trpR trpALD102. These values are minimal estimates, however, since either or both deletions may be slightly polar. 4. Discussion The possibility that the trp operator overlaps the trp promoter was suggested by the results of transcription experiments in vitro (Squires et al., 1975); Trp repressor and RNA polymerase appeared to compete for a common site on trp operon DNA. The position at which transcription is initiated (Squires et al., 1976), the sequence of the region preceding the transcription start site (Bennett et al., 1976,1978a), and the segment of DNA which interacts with RNA polymerase (Brown et al., 1978), have been established, and tMs information serves as a basis for a more detailed examination of the possibility of promoter-operator overlap. A specific interaction of Trp repressor with t ~ operon DNA near the transcription initiation site was shown by protection of the HpaI site located at position --9 to --14 (Fig. 6). This site is within the region at which RNA polymerase binds to the trp promoter (Brown et al., 1978). The analyses of deletion mutants reported in this paper and previously (Bennett et al., 1976) show that the operator extends from a position more than 17 base-pairs preceding the transcription start site to between positions --5 and ~-1. Sequence analysis of a number of operator constitutive point mutants (Table 1) located base-pair changes within this region (Fig. 6) and firmly identified the DNA segment recognized by Trp repressor. This segment of DNA shows twofold symmetry involving 18 of the 20 base-pairs between --21 and --2. The axis of symmetry is at the cleavage site of HpaI, as shown in Figure 6. The presence of regions of twofold symmetry in other operators has also been observed (Gilbert & Maxam, 1973; Maniatis et al., 1975b; Musso et al., 1977). The position of the trp operator relative to the transcription initiation site differs from that of the lac operator (Gilbert & Maxam, 1973), which occurs largely just beyond the site of transcription initiation (Maizels, 1973), although both/ac and trp repressors apparently act by excluding access to the promoter by RNA polymerase (Squires et al., 1975; Majors, 1975). In contrast, the gal operator is located about 60 base-pairs preceding the transcription start site and exerts its control by blocking cyclic AMP-receptor protein activation of the gal promoter (Musso et al., 1977). Repression of transcription at the lambda promoters P,. and PR involves interaction of the repressor with a series of adjacent binding sites preceding the site of transcription initiation, thereby competing with RNA polymerase (Maniatis et al., 1975b; Ptashne et al., 1976). Lack of protection of the HincII site at --32 to --37 (Fig. 1) suggests that Trp repressor does not recognize multiple adjacent binding sites as does the lambda repressor (Maniatis & Ptashne, 1973; Ptashne et al., 1976). The base changes found in operator constitutive mutants are shown in Figure 6. The data in Table 1 indicate that none of the point mutants is fully constitutive. trp operon expression in deletion mutant trpAOC1418, however, is unaffected by the presence of Trp repressor (Bertrand et al., 1976). This result may indicaie that more than a single base-pair of the operator has been replaced in this deletion mutant.

190

G . N . B E N N E T T AND C. YANOFSKY The ,rp operator region

--30 -25 -20 •

v

-15 -IO

•

•

-5

I

5

•

•

•

v

I0 >v

15

20

•

•

trpmRNA ' 'f=-~ 5'A CAATTAATCATCGAACTAGTTAA CTAGTAC GCAAGTTCACGTAAAAAGGGTA3n

E.coli .

.

.

.

.

3,TGT TA ..ATT .AGTACf_.ST7 GAT.CA~TTG.ATCATGCGTTCAAGTGCATT T T TC C C AT 5, II; II .

.

.

.

.

.

.

.

.

/-~al sitef c c protected by repressor

.

.

.

.

. . . .

.

.

.

.

.

.

.

.

. . . . . .

GA } O¢ mutahons T

A

FIG. 6. Summary of information on the trp operator. The DNA sequence of the region around the transcription initiation site is shown (with hyphens omitted). The direction of transcription from the initiation site is indicated b y an arrow over position -~1. The s y m m e t r y element is denoted b y similar bars above and below the sequence. The axis of s y m m e t r y between base-pairs --11 and --12 is denoted by a dot between the 2 strands. The sequence recognized by the restriction endonuclease HpaI is indicated at positions --9 to --14. This is the cleavage site which is protected b y Trp repressor in the presence of tryptophan. The vertical arrows below positions --16, --15, --7 and --6 point to the base substitutions which have been found at these positions in operator constitutive mutants. The base sequence of the corresponding region of the trp operon o f ~ . typhimurium (Bennett et al., 1978b) is shown directly below the E. coti sequence. Only those base-pairs which are different are indicated.

Several of the base alterations observed in operator constitutive point mutants (Table 1) are at position --7. These are of two types, A --> C and A --> T; they show different residual repression by Trp reprcssor (Table 1). The different sensitivity to repressor probably arises from a difference in the ability of the interacting moiety of the repressor to form the appropriate contact with these changed base-pairs. It is interesting to note that the symmetrically opposed O° base changes ( A - ~ C at --16 and --7) exhibit nearly the same level of trp operon expression (Table 1). The nucleotJde sequence of the region corresponding to the trp operator of S. typhimurium has been reported (Bennett et al., 1978b). Figure 6 shows that the sequence is identical to that of E. coIi in the segment where base alterations have been found in operator constitutive E. coli mutants. The similarity includes the region of twofold symmetry centered between --11 and --12. This result correlates with the in vivo observation reported by Manson & Yanofsky (1976) that Trp r~pressor of E. coli can regulate the trio operon of S. typhimurium and vice versa. Physical interaction of the E. coli Trp repressor with the S. typhimurium trp operator was demonstrated b y Bennett et al. (1978b), who observed that the E. coli repressor could protect the analogous HpaI site (positions --9 to --14) from cleavage. Although base changes in operator constitutive mutants are found on both sides of the HpaI site, none was observed in this six-base-pair recognition sequence. Possible explanations of this could be (1) base-pairs in this region are not as critical to the binding of repressor and individual changes produce decreases in operator function which are too small to be detected in the selection procedure; (2) base alterations in the six-base-pair segment do affect operator function but they also reduce t~T promoter activity to a level prohibiting recovery with the selection procedure used (see Materials and Methods). Several observations bear on this point.

trp O P E R A T O R I~, E. GOLI

191

Pribnow (1975) has proposed t h a t the resemblance of a promoter sequence to an ideal common sequence T-A-T-Pu-A-T-G, in the seven-base-pair region --12 to --6, m a y influence promoter function. The observation t h a t the UV5 lac promoter m u t a t i o n improves correlation with this ideal sequence (J. Gralla, unpublished results) and increases lac promoter activity is consistent with this view. Since the trp promoter sequence in this region (Fig. 6) does not m a t c h the ideal Pribnow sequence, there would be several possibilities for alterations which would produce a closer m a t c h and thus theoretically increase trp promoter activity. The data in Table 1 show t h a t the operator constitutive mutations studied do not affect trp promoter function significantly. These changes are all in the region preceding the initiation site. I t has been found t h a t base changes in some lac promoter m u t a n t s occur in this region (--8 to --16: Dickson et al., 1975; J. Gralla, unpublished results). I t is interesting that, at least in the case of the trp promoter, certain of these base-pairs can be altered without affecting the level of operon expression. The findings (Table 2) t h a t the levels of trp operon expression in deletion m u t a n t s t~TALC145 and trp,~OC1418 are only modestly reduced relative to a strain exhibiting maximal expression, indicate t h a t the region beyond these deletion endpoints (~-1 in trpALC145 and --5 in trpAOC1418) can be altered without drastically reducing promoter activity. The exact transcription start point in these deletion strains has not been established but in both cases there is a purine base at a suitable position (~-1 or --1) for initiation (Fig. 2). This result suggests t h a t base-specific recognition of the D N A beyond the initiation site is not a major factor in determining promoter activity. The authors are greatly indebted to Virginia Horn, Miriam Bonner and Magda van Cleemput for their aid with various aspects of this investigation. These studies were supported by grants from the United States Public Health Service (GM09738), the National Science Foundation (PCM73-06774) and the American Heart Association. One author (G. B.) is a postdoctoral fellow of the United States Public Health Service and the other (C. Y.) is a Career Investigator of the American Heart Association. These studies were performed using standard microbiological procedures which conform to the National Institutes of Health guidelines.

REFERENCES Bennett, G. N., Schweingruber, M. E., Brown, K. D., Squires, C. & Yanofsky, C. (1976). Proc. Nat. Acad. Sei., U.S.A. 73, 2351-2355. Bennett, G. N., Sehweingruber, M. E., Brown, K. D., Squires, C. & Yanofsky, C. (1978a). J. Mol. Biol. 121, 113-117. Bennett, G. N., Brown, K. D. & Yanofsky, C. (1978b). J. Mol. Biol. 121, 139-152 Bertrand, K., Squires, C. & Yanofsky, C. (1976). J. Mol. Biol. 103, 319-337. Brown, K. D., Bennett, G. N., Lee, F., Sehweingruber, M. E. & Yanofsky, C. (1978). J. Mot. Biol. 121, 153-177. Cohen, G. & Jacob, F. (1959). CRSH Aead. Sci. 248, 3490. Creighton, T. E. & Yanofsky, C. (1970). Methods Enzymol. 17A, 365-380. Dickson, R. C., Abelson, J., Barnes, W. M. & Reznikoff, W. F. (1975). Science, 187, 27-35. Franldin, N. (1971). In The Bacteriophage JLambda (Hershey, A. D., ed.), pp. 621-638, Cold Spring Harbor Laboratories, Cold Spring Harbor. Gilbert, W. & Maxam, A. (1973). Proe. Nat. Aead. Sci., U.S.A. 76, 3581-3584. Helinski, D. R., Hershfield, V., Figurski, D. & Meyer, 1~. J. (1977). In lOth Miles International Symposium, Impact of Recombinant Molecules in Science and Society (Beers, I=L F & Bassett, E. G., eds), pp. 151-165, Raven Press, New York.

192

G.N.

BENNETT

AND

C. Y A N O F S K Y

Hiraga, S. (1969). J. il~ol.Biol. sg, 159-179. Lee, F., Bertrand, K., Be,mett, G. & Yanofsky, C. (1978). J. Mot. Biol. 121, 193-217. Maizels, N. (1973). Prec. Nat. Aead. Sci., U.S.A. 70, 3585-3589. Majors, J. (1975). Prec. Nat. Acad. Sci., U.S.A. 72, 4394-4398. Maniatis, T. & Ptashne, M. (1973). Prec. Nat. Aead. Sci., U.S.A. 70, 1531-1535. Maniatis, T., Jeffrey, A. & van de Sande, H. (1975a). Biochemistry, 14, 3787-3794.

Maniatis, T., Ptashne, M., Baekman, K., Kleid, D., Flashman, S., Jeffrey, A. & Maurer, R. (1975b). Cell, 5, 109-113. Manson, M. D. & Yanofsky, C. (1976). J. Bacteriol. 126, 679-689. Maxam, A. & Gilbert, W. (1977). Prec. Nat. Acad. Sci., U.S.A. 74, 560-564. MeGeoch, D., McGeoeh, J. & Morse, D. (1973). Nature New Biol. 245, 137-140. Morse, D. E. & Yanofsky, C. (1969). J. Mot. Biol. 44, 185-193. Musso, 1%., Di Lauro, R., Rosenberg, M. & de Crombrugghe, B. (1977). Prec. Nat. Acad. Sci., U.S.A. 74, 106-110. Platt, T. & Yanofsky, C. {1975). Prec. Nat. Acad. Sci., U.S.A. 72, 2399-2403. Pribnow, D, (1975). J. Mol. Biol. 99, 419-443. Ptashne, M., Baclunan, K., Humayun, M. Z., Jeffrey, A., Maurer, R., Meyer, B. & Sauer, R. T. (1976). Science, 194, 156-161. Rose, J. K., Squires, C. L., Yanofsky, C., Yang, H.-L. & Zubay, G. (1973). Nature New Biol. 245, 133-137. Selker, E., Brown, K. & Yanofsky, C. (1977). J. Bacteriol. 129, 388-394. Sharp, P. A., Sugden, B. & Sambrook, J. (1973). Biochemistry, 12, 3055-3063. Squires, C. L., Rose, J. K., Yanofsky, C., Yang, H.-L. & Zubay, G. (1973). Nature New Biol. 245, 131-133. Squires, C. L., Lee, F. D. & Yanofsky, C. (1975). J. Mol. Biol. 92, 93-111. Squires, C., Lee, F., Bertrand, K., Squires, C. L., Bronson, M. J. & Yanofsky, C. (1976). J. Mol. Biol. 10S, 351-381. Vogel, H. J. & Bonner, D. M. (1956). J. Biol. Chem. 218, 97-106. Yanofsky, G., Cox, E. C. & Horn, V. (1966). Prec. Nat. Acad. Sci., U.S.A. 55, 274-281. Zalkin, H., Yanofsky, C. & Squires, C. L. (1974). J. Biol. Chem. 249, 465-475. Zubay, G., Morse, D. E., Schrenk, W. J. & Miller, J. H. M. (1972). Prec. Nat. Acad. Sci., U.S.A. 69, 1100-1103.