Hindawi Publishing Corporation BioMed Research International Volume 2015, Article ID 209792, 6 pages http://dx.doi.org/10.1155/2015/209792
Research Article Sequence Variation in HSP40 Gene among 16 Toxoplasma gondii Isolates from Different Hosts and Geographical Locations Zhong-Yuan Li,1,2 Jing Lu,1,3 Dong-Hui Zhou,1 Jia Chen,1 and Xing-Quan Zhu1,2 1
State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Veterinary Parasitology of Gansu Province, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, Gansu 730046, China 2 College of Animal Science and Veterinary Medicine, Heilongjiang Bayi Agricultural University, Daqing, Heilongjiang 163319, China 3 Guangdong Dahuanong Animal Health Products Co., Ltd., Yunfu, Guangdong 527400, China Correspondence should be addressed to Xing-Quan Zhu; [email protected] Received 10 July 2015; Accepted 19 October 2015 Academic Editor: Somboon Tanasupawat Copyright © 2015 Zhong-Yuan Li et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Toxoplasma gondii with worldwide distribution has received substantial medical and scientific attentions as it causes serious clinical and veterinary problems especially for pregnant women and immunocompromised patients. Heat shock protein 40 (HSP40) plays a variety of essential roles in the pathogenesis of this protozoan parasite. In order to detail the genetic diversity of HSP40 gene, 16 T. gondii strains from different hosts and geographical locations were used in this study. Our results showed that HSP40 sequence of the examined strains was between 6621 bp and 6644 bp in length, and their A+T content was from 48.54% to 48.80%. Furthermore, sequence analysis presented 195 nucleotide mutation positions (0.12%–1.14%) including 29 positions in CDS (0.02%– 0.12%) compared with T. gondii ME49 strain (ToxoDB: TGME49 265310). Phylogenetic assay revealed that T. gondii strains representing three classical genotypes (Types I, II, and III) were completely separated into different clusters by maximum parsimony (MP) method, but Type II and ToxoDB#9 strains were grouped into the same cluster. These results suggested that HSP40 gene is not a suitable marker for T. gondii population genetic research, though three classical genotypes of T. gondii could be differentiated by restriction enzymes MscI and EarI existing in amplicon C.
1. Introduction Toxoplasma gondii infects almost all the warm-blooded animals including about one-third population of humans [1, 2] and can cause serious clinical diseases, especially in pregnant women and immunocompromised individuals such as tumor sufferers and AIDS patients [3, 4]. T. gondii can also cause abortion and congenital toxoplasmosis in livestock, leading to considerable economic losses [5, 6]. Heat shock proteins (HSPs) involved in antigen presentation and cross-presentation play important roles in activation of immune-related cells such as macrophages, lymphocytes, and DCs [7–9]. As the important member of HSPs, HSP40 associated with DNA replication, protein folding, assembling and degradation, translocation across membranes, signal transduction, and endocytosis participates in the pathogenesis of apicomplexan parasites such as Plasmodium falciparum [10, 11]. Recent studies emphasized
that different clonal types of T. gondii strains with diverse geographical distribution can cause different toxoplasmosis in animals and humans [12, 13]. In order to unveil the details of T. gondii genetic diversity, sequence variation of the type II HSP40TgSIS1 (ToxoDB: TGME49 265310, previously named TGME49 065310) [14] among T. gondii isolates from different hosts and geographical regions was examined in this study.
2. Materials and Methods 2.1. T. gondii Isolates and gDNA Preparation. Sixteen T. gondii isolates harvested from different hosts and geographical locations were used in the present study (Table 1). Genomic DNA was extracted as normal and stored at −20∘ C till used. 2.2. PCR Amplification and Sequencing. Three fragments (A, B, and C) (Figure 1) were separated based on the
2
BioMed Research International Table 1: Details of Toxoplasma gondii isolates used in this study.
Number 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 ∗
Isolate CTG TgCatBr64 GT1 RH TgPLH TgToucan MAS TgCatBr5 PTG PRU QHO TgC7 PYS GJS TgCgCa1 TgWtdSc40
Host Cat Cat Goat Human Pig Toucan Human Cat Sheep Human Sheep Cat Pig Pig Cougar Deer
Genotype∗ Reference, Type III, ToxoDB#2 Reference, ToxoDB#111 Reference, Type I, ToxoDB#10 Reference, Type I, ToxoDB#10 Type I, ToxoDB#10 Reference, ToxoDB#52 Reference, ToxoDB#17 Reference, ToxoDB#19 Reference, Type II, ToxoDB#1 Type II, ToxoDB#1 Type II, ToxoDB#1 ToxoDB#9 ToxoDB#9 ToxoDB#9 Reference, ToxoDB#66 Type 12, ToxoDB#5
Geographical location United States Brazil United States France Henan, China Costa Rica France Brazil United States France Qinghai, China Guangzhou, China Panyu, China Jingyuan, Gansu, China Canada USA
Based on the results of Zhou et al. [25, 26] and Su et al. [20]. TgCatBr64
.............A....T.......g.........a.....A....g..c..T.t.....................................................a................................................A..............a.............................t............t.
GT1 ......t......A....T......gg......g..a.....A....g.....Tc.a...........................................at...c...aggc..C.....g.-............a..c..............at..A..a.......tc..a.A..................c.....t.............t... RH
......t..G...A.A..T......gg.g.....a.a.....A....g.c...Tc.at..........................................at...c...agg.........g.-............a..cg.............at..A..a.......tcc.aC.T......c...c............t.............t...
TgPLH ......t......A....T......ggc........a.....A...Gg.....Tc.a...........................................at...c...agg....c....g.-......c.....a..c..a...........at..A..a.......tc..a..........................t...g.........t... TgToucan ..c...t......A....T......gg.........a.....A....g.....Tc.a..g........................................at...c...agg..g......g.-............a..c......t..t....at..A..a.......tc..a...............t.......g..t.............tc.. MAS
.....ct.....GA....T......gg.........a..g..A....g.....T....................................................c..a............c.....a.......a..c.......a......at..A...a......tc.ca..........................t.t...............
TgCatBr5 .g.c..t......A....T......gg.........ag....A....g.....T..................................................a....a.......c..........a.......a..c.......a.....cat.aAT..a...g..tc.ca........c.................t......c.........c PTG a.....ta...T.A....T.gca..gg.....a...a...CTA....gg..g.Tc......at.t..gc.G----------------------t.g.g.ga....c...ag..c.....atg.-..gtac.at.t.a..........a......at..A....g.....tc..a..........T.g......g......t....t........t... PRU a.....tac....AA.G.T..ca..gg.........a...C.A....gg....Tc......at.t..gcCG----------------------t.g.g.ga....c...ag..c.....a.g.-g.gta..at.t.a..........ac.....at..A....g.....tc..a..........T..c...a........t....t.....cc.t... QHO a.....ta.....A....T..ca..gg.........a...C.A....gg...CTc......at.t..gc.G----------------------t.g.g.ga....c.cgag..c.....a.g.-...ta..atct.a........c.a.......t..A.g..g.....tc..a..........T.............c.t....t........t... ME49 a.....ta.....A....T..ca..gg.........a...C.A....gg....Tc......at.t..gc.G----------------------t.g.g.ga....c...ag..c.....atg.-..gta..at.t.a..........a......at..A....g.....tc..a..........T...............t....t........t... TgC7 a.....ta.....A....T..caa.gg.........a...C.A.T..gg....Tc......at.t..gc.G----------------------t.g.g.ga....c...ag..c.....a.g.-.c.ta..at.tca..........a......at..A....g....ttc..a....g.....T...g...........t....t........t... PYS a...a.ta.....A...AT..caa.gg.........a...C.A....gg....Tct.....atct..gc.G----------------------t.g.g.ga....c...ag..c.....a.g.-...ta..at.t.a..........a......atg.A....g.....tc..a..........T...............t....tc.......t... GJS a.....ta..C..A....T..ca..gg....a....a...C.A..A.gg....Tc...c.gat.tc.gc.G----------------------t.g.g.ga....c...ag..c.....a.g.-...ta..at.t.at.........a......at..A....g.c...tc..a..........T...............t....t........t... TgCgCa1 ......t......A....Tg.c...gg..ct.....a.a...AT...g.....Tc......at.t..g..G.......................a.ggc.atgt.c...ag.......aa.g......a..at...a.ac.a.tt..a..cgc.at..A.....g..t.tc..a.....gtc..T.......c..a....tc......a.c..tt... TgWtdSc40 a.....ta.....A....T..ca.agg........aa...C.A....gg....Tc......at.t.ggc.G......................t.g.g.ga....c...ag..c.....a.g.-...ta..at.t.a..........a......at..A....g.....tc..a...t......TC....a.....c..gt....t...g....t...
51 132 164 174 232 285 297 332 376 512 530 577 608 641 694 721 729 746 758 809 838 846 855 898 930 937 967 973 1021 1032 1159 1177 1195 1227 1253 1261 1287 1311 1314 1315 1357 1375 1425 1431 1432 1459 1469 1559 1566 1578 1588 1636 1881 1897 2023 2075 2140 2287 2332 2431 2442 2478 2483 2521 2564 2571 2664 2675 2698 2755 2759 2786 2787 2788 2789 2790 2791 2792 2793 2794 2795 2796 2797 2798 2799 2800 2801 2802 2803 2804 2805 2806 2807 2808 2843 2881 2909 2911 2969 2997 3010 3019 3030 3092 3100 3141 3169 3238 3249 3260 3288 3350 3353 3390 3413 3432 3450 3521 3532 3619 3644 3645 3647 3667 3672 3692 3745 3750 3753 3789 3799 3821 3826 3832 3837 3841 3846 3881 3972 4137 4167 4178 4204 4214 4224 4259 4310 4343 4368 4377 4442 4449 4512 4520 4527 4531 4540 4566 4635 4658 4721 4732 4761 4778 4801 4822 4826 4857 4869 4899 4904 4908 4920 4928 4966 5001 5066 5140 5174 5315 5354 5379 5409 5415 5451 5478 5511 5521 5565 5579 5601 5626 5639 5648 5688 5692 5702 5731 5767 5793 5831 5852 5875 5896 5906 5958 6076 6081 6102 6117 6139 6154 6237 6257 6336 6339 6344 6459
CTG gattttggtATCAGGGAGCaatgggaatcactgatcgagtTCTACGAaattaTCtcgctaatatgtattTAccagaaaaattcacttgggtttcctcatagcactgttattatttTtttgctttttcggttggtatcaggatgcctcctcacgtggatGCaggattagagttagTGCgaactttGTataagggatgtatactcaagttgagttcgtct
5
∗
1
2
3
500 bp
4
5
6
F40B
8
R40A
9
10
11
12
R40B
B
A F40A
7
3
C F40C
R40C
Figure 1: Sequence analysis of HSP40 gene among different Toxoplasma gondii strains. Color boxes indicate 12 extrons of HSP40 gene and the gray one stands for the region of 3 -UTR. Black triangle () and asterisk (∗) indicate the translation start condon (ATG) and the stop one (TAG), respectively. Three pairs of specific primers (F40A/R40A, F40B/R40B, and F40C/R40C) used in this study were marked with arrows. Upper or lower case, respectively, indicates different nucleotide of extron or intron/3 -UTR. Point (.) and stub (–) among different nucleotides indicate identical or no nucleotide here compared with that of CTG strain (bottom line). The number beside the sequence stands for the variable sequence position for nucleotide, and black bar indicates 500 bp in length.
HSP40 sequence of T. gondii ME49 isolate (ToxoDB: TGME49 265310), and the amplifications were performed by PCR using three pairs of specific primers, respectively (Table 2). Thermal cycling conditions were according to the following protocol: initial denaturation at 94∘ C for 10 min
followed by 35 cycles composing of 94∘ C for 1 min, 54.7∘ C (amplicon A), 66.8∘ C (amplicon B) or 64.0∘ C (amplicon C) for 45 s respectively, and 72∘ C for 2 min, and the additional extension step was carried out at 72∘ C for 10 min. Negative control without gDNA was included in each amplification.
BioMed Research International Table 2: Details of primers used in this study. Primer
Sequence (5 -3 )
F40A
ATGGGGAAGGTAATCACATT
R40A
CGACTGGAACTATCGATTTC
F40B
TGTGGGGCGAGAGCCAGAGG
R40B
TGCAGAGGTGCCTTGCGTTT
F40C
CCCTGCATCGCGTGAGCTTC
R40C
AACGAGTGGAAAGCCCCCGT
Amplicons A, B, and C were amplified from different T. gondii strains by PCR using F40A/R40A, F40B/R40B, and F40C/R40C, respectively.
PCR amplifications were confirmed by agarose gel electrophoresis as previously described [15]. All the PCR products were purified using spin columns (Promega, Madison, USA), ligated with pMD18-T vector (TaKaRa, Dalian, China), and transformed into E. coli DH5𝛼 competent cells (Promega) according to the manufacturers’ instructions. The positive colonies confirmed by PCR were sequenced by Shanghai Sangon Biological Engineering Biotechnology Company. All the experiments were run in triplicate. 2.3. Sequence Analysis and Phylogenetic Reconstruction. The sequences of all the examined T. gondii strains were amplified step by step and sequenced. Alignment analysis based on the obtained sequences including the reference one (ToxoDB: TGME49 265310) was carried out with Clustal X 1.83 [16], and the number of sequence variation compared with ME49 strain was calculated as previously described [17]. Phylogenetic reconstructions were performed by maximum parsimony (MP) method using PAUP∗ 4.0b10 [18], and 100 random addition searches using tree-bisection reconnection (TBR) were carried out for each MP assay. Bootstrap probability (BP) was calculated from 1,000 bootstrap replicates with 10 random additions per replicate in PAUP.
3 in HSP40 genomic locations and 29 positions in CDS (0.02%– 0.12%) in comparison with T. gondii ME49 strain (ToxoDB: TGME49 265310), which was lower than our previous reports of GRA5 [21], ROP38 [22], ROP47 [23], eIF4A [15], and other genes of T. gondii, such as GRA6 [24]. Moreover, 141 transitions (A ↔ G and C ↔ T) and 54 transversions (A ↔ C, A ↔ T, G ↔ T, and G ↔ C) (𝑅 = transition/transversion = 2.6) were also identified, and the distance of evolutionary divergence was 0.1%–1.0% among the examined T. gondii strains (Table 3). Nucleotide polymorphisms analysis revealed two polymorphic restriction sites MscI and EarI in the sequence of amplicon C (2252 bp in length), which can differentiate three classical genotypes of T. gondii (Types I, II, and III) (Figure 2) [19, 20, 25, 26]. In brief, the PCR products of TgToucan, MAS, TgCatBr5, and T. gondii Type I strains (GT1, RH, and TgPLH) were digested into four segments (81, 165, 811, and 1195 bp); Type II strains (PTG, PRU, and QHO), ToxoDB#9 (TgC7, PYS, and GJS), TgCgCa1, and TgWtdSc40 were composed of three parts (81, 811, and 1360 bp); and the PCR products of Type III (CTG) and TgCatBr64 were cut into five sections (81, 165, 381, 811, and 814 bp). The results suggested that all the examined T. gondii strains could not be completely separated into their own groups by PCR-RFLP especially for ToxoDB#9 strains. Phylogenetic reconstruction was constructed based on HSP40 sequences of the 17 T. gondii strains including T. gondii ME49 isolates (ToxoDB: TGME49 265310) (Figure 3) [18]. Our results showed that T. gondii strains belonging to Type II (PRU, QHO, ME49, and PTG), Type 12 (TgWtdSc40), or ToxoDB#9 (PYS, TgC7 and GJS) were grouped into the same cluster, whereas TgToucan (ToxoDB#52) was gathered into the cluster of Type I (RH, GT1, and TgPLH), suggesting that the examined T. gondii strains could not be completely separated by MP method though three classical genotypes of T. gondii (Types I, II, and III) were clustered into different groups.
4. Conclusion
2.4. Characterization of T. gondii Isolates by PCR-RFLP. To evaluate whether HSP40 gene was suitable for genotyping of T. gondii isolates, PCR-RFLP method was also used in this study as previously described [19, 20]. All the PCR products of amplicon C were digested with two restriction enzymes MscI and EarI by incubating at 37∘ C for 4 h according to the manufacturer’s instructions (NEB, Beijing, China). And the restriction fragments were separated by electrophoresis as previously described [21].
Our data suggested that HSP40 gene is not a suitable marker for T. gondii population genetic study, though three classical genotypes of T. gondii (Types I, II, and III) could be differentiated by polymorphic restriction endonuclease sites MscI and EarI existing in amplicon C.
3. Results and Discussion
Authors’ Contribution
Our results showed that HSP40 gene of all the examined strains was between 6621 bp and 6644 bp in length spliced by amplicons A (2430 bp), B (2107–2130 bp), and C (2252 bp), and their A+T contents varied from 48.54% to 48.80% (Figure 1, Table 3). The alignment of all the 17 sequences revealed nucleotide mutations at 195 positions (0.12%–1.14%)
Zhong-Yuan Li and Jing Lu contributed equally to this work.
Conflict of Interests All the authors declare no conflict of interests.
Acknowledgments This project support was provided, in part, by the National Natural Science Foundation of China (Grant no. 31172316)
∗
DNA
cDNA
CDS
𝑅 = transition/transversion; — means no data here.
Item
Number of intron 1 2 3 4 5 6 7 8 9 10 11 Length (bp) 6621–6644 1620 1011 471 595 320 278 501 629–651 533-534 547 287 367 473 A+T (%) 48.54–48.80 45.12–45.56 45.20–45.70 44.80–45.65 48.40–48.91 45.62–46.56 45.68–46.40 51.70–52.10 53.90–54.99 48.78–50.28 51.74–52.47 54.70–55.75 45.78–46.32 47.36–47.78 Transition 141 36 26 7 15 5 3 8 14 12 10 9 6 16 Transversion 54 5 3 2 6 0 0 4 8 10 9 5 1 4 𝑅∗ 2.6 7.2 8.6 3.5 2.5 — — 2 1.7 1.2 1.1 1.8 6 4 Distance (%) 0.1–1.0 0.1–0.7 0–1.1 0–1.1 0–1.4 0–0.9 0–1.1 0–1.8 0–1.9 0–2.1 0–1.8 0–2.1 0–1.1 0.2–1.5
Table 3: Sequence characteristics of Toxoplasma gondii HSP40 including its expressed regions and introns.
4 BioMed Research International
BioMed Research International
5
(bp)
M 1 2 3 4
5 6 7 8 9 10 11 12 13 14 15 16
2000 1000 750 500 250 100
Figure 2: PCR-RFLP analysis based on the PCR products of amplicon C. Lane M indicates DL2000; lanes 1–16 stand for T. gondii Type I (GT1, RH, and TgPLH); TgToucan, MAS, and TgCatBr5, Type II (PTG, PRU, and QHO); ToxoDB#9 (TgC7, PYS, and GJS), TgCgCa1, and TgWtdSc40, Type III (CTG); and TgCatBr64, respectively.
PYS TgC7
63
ToxoDB#9
GJS PTG
62
100
64
ME49 PRU
100
II
QHO TgWtdSc40 TgCgCa1
93
TgToucan TgPLH
98
100
GT1
I
RH 50
93
MAS TgCatBr5
TgCatBr64
CTG
III
10.0
Figure 3: Phylogenetic analysis of HSP40 gene among 17 Toxoplasma gondii strains using maximum parsimony (MP) method. Three clusters of the classical genotypes (Types I, II, and III) and ToxoDB#9 were denoted. The numbers along branches indicate bootstrap values (%).
and the Science Fund for Creative Research Groups of Gansu Province (Grant no. 1210RJIA006).
[7] Z. Li, A. Menoret, and P. Srivastava, “Roles of heat-shock proteins in antigen presentation and cross-presentation,” Current Opinion in Immunology, vol. 14, no. 1, pp. 45–51, 2002.
References
[8] G. Kaul and H. Thippeswamy, “Role of heat shock proteins in diseases and their therapeutic potential,” Indian Journal of Microbiology, vol. 51, no. 2, pp. 124–131, 2011.
[1] J. G. Montoya and O. Liesenfeld, “Toxoplasmosis,” The Lancet, vol. 363, no. 9425, pp. 1965–1976, 2004. [2] D. Schl¨uter, W. D¨aubener, G. Schares, U. Groß, U. Pleyer, and C. L¨uder, “Animals are key to human toxoplasmosis,” International Journal of Medical Microbiology, vol. 304, no. 7, pp. 917–929, 2014. [3] K. Kim and L. M. Weiss, “Toxoplasma: the next 100 years,” Microbes and Infection, vol. 10, no. 9, pp. 978–984, 2008. [4] L. M. Weiss and J. P. Dubey, “Toxoplasmosis: a history of clinical observations,” International Journal for Parasitology, vol. 39, no. 8, pp. 895–901, 2009. [5] J. P. Dubey, Toxoplasmosis of Animals and Humans, CRC Press, Boca Raton, Fla, USA, 2nd edition, 2010. [6] P. Zhou, Z. Chen, H.-L. Li et al., “Toxoplasma gondii infection in humans in China,” Parasites & Vectors, vol. 4, article 165, 2011.
[9] T. J. Borges, L. Wieten, M. J. C. van Herwijnen et al., “The antiinflammatory mechanisms of Hsp70,” Frontiers in Immunology, vol. 3, article 95, 2012. [10] P. Acharya, S. Chaubey, M. Grover, and U. Tatu, “An exported heat shock protein 40 associates with pathogenesis-related knobs in Plasmodium falciparum infected erythrocytes,” PLoS ONE, vol. 7, no. 9, Article ID e44605, 2012. [11] S. K¨ulzer, S. Charnaud, T. Dagan et al., “Plasmodium falciparum-encoded exported hsp70/hsp40 chaperone/cochaperone complexes within the host erythrocyte,” Cellular Microbiology, vol. 14, no. 11, pp. 1784–1795, 2012. [12] L. D. Sibley and J. W. Ajioka, “Population structure of Toxoplasma gondii: clonal expansion driven by infrequent recombination and selective sweeps,” Annual Review of Microbiology, vol. 62, pp. 329–351, 2008.
6 [13] F. Robert-Gangneux and M.-L. Dard´e, “Epidemiology of and diagnostic strategies for toxoplasmosis,” Clinical Microbiology Reviews, vol. 25, no. 2, pp. 264–296, 2012. [14] M. J. Figueras, O. A. Martin, P. C. Echeverria et al., “Toxoplasma gondii Sis1-like J-domain protein is a cytosolic chaperone associated to HSP90/HSP70 complex,” International Journal of Biological Macromolecules, vol. 50, no. 3, pp. 725–733, 2012. [15] J. Chen, S.-F. Fang, D.-H. Zhou, Z.-Y. Li, G.-H. Liu, and X.-Q. Zhu, “Sequence variation in the Toxoplasma gondii eIF4A gene among strains from different hosts and geographical locations,” Genetics and Molecular Research, vol. 13, no. 2, pp. 3356–3361, 2014. [16] J. D. Thompson, T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins, “The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools,” Nucleic Acids Research, vol. 25, no. 24, pp. 4876– 4882, 1997. [17] N. B. Chilton, R. B. Gasser, and I. Beveridge, “Differences in a ribosomal DNA sequence of morphologically indistinguishable species within the Hypodontus macropi complex (Nematoda: Strongyloidea),” International Journal for Parasitology, vol. 25, no. 5, pp. 647–651, 1995. [18] D. L. Swofford, PAUP∗ . Phylogenetic Analysis Using Parsimony. Version 4.0b10, Sinauer Associates, Sunderland, Mass, USA, 2002. [19] C. Su, X. Zhang, and J. P. Dubey, “Genotyping of Toxoplasma gondii by multilocus PCR-RFLP markers: a high resolution and simple method for identification of parasites,” International Journal for Parasitology, vol. 36, no. 7, pp. 841–848, 2006. [20] C. Su, E. K. Shwab, P. Zhou, X.-Q. Zhu, and J. P. Dubey, “Moving towards an integrated approach to molecular detection and identification of Toxoplasma gondii,” Parasitology, vol. 137, no. 1, pp. 1–11, 2010. [21] J. Chen, Z.-Y. Li, D.-H. Zhou, G.-H. Liu, and X.-Q. Zhu, “Genetic diversity among Toxoplasma gondii strains from different hosts and geographical regions revealed by sequence analysis of GRA5 gene,” Parasites & Vectors, vol. 5, article 279, 2012. [22] Y. Xu, N. Z. Zhang, J. Chen et al., “Toxoplasma gondii rhoptry protein 38 gene: sequence variation among isolates from different hosts and geographical locations,” Genetics and Molecular Research, vol. 13, no. 3, pp. 4839–4844, 2014. [23] J. L. Wang, T. T. Li, Z. Y. Li, S. Y. Huang, H. R. Ning, and X. Q. Zhu, “Rhoptry protein 47 gene sequence: a potential novel genetic marker for population genetic studies of Toxoplasma gondii,” Experimental Parasitology, vol. 154, pp. 1–4, 2015. [24] A. Fazaeli, P. E. Carter, M. L. Darde, and T. H. Pennington, “Molecular typing of Toxoplasma gondii strains by GRA6 gene sequence analysis,” International Journal for Parasitology, vol. 30, no. 5, pp. 637–642, 2000. [25] P. Zhou, H. Zhang, R.-Q. Lin et al., “Genetic characterization of Toxoplasma gondii isolates from China,” Parasitology International, vol. 58, no. 2, pp. 193–195, 2009. [26] P. Zhou, H. Nie, L.-X. Zhang et al., “Genetic characterization of Toxoplasma gondii isolates from pigs in China,” Journal of Parasitology, vol. 96, no. 5, pp. 1027–1029, 2010.
BioMed Research International
Research Article Sequence Variation in HSP40 Gene among 16 Toxoplasma gondii Isolates from Different Hosts and Geographical Locations Zhong-Yuan Li,1,2 Jing Lu,1,3 Dong-Hui Zhou,1 Jia Chen,1 and Xing-Quan Zhu1,2 1
State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Veterinary Parasitology of Gansu Province, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, Gansu 730046, China 2 College of Animal Science and Veterinary Medicine, Heilongjiang Bayi Agricultural University, Daqing, Heilongjiang 163319, China 3 Guangdong Dahuanong Animal Health Products Co., Ltd., Yunfu, Guangdong 527400, China Correspondence should be addressed to Xing-Quan Zhu; [email protected] Received 10 July 2015; Accepted 19 October 2015 Academic Editor: Somboon Tanasupawat Copyright © 2015 Zhong-Yuan Li et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Toxoplasma gondii with worldwide distribution has received substantial medical and scientific attentions as it causes serious clinical and veterinary problems especially for pregnant women and immunocompromised patients. Heat shock protein 40 (HSP40) plays a variety of essential roles in the pathogenesis of this protozoan parasite. In order to detail the genetic diversity of HSP40 gene, 16 T. gondii strains from different hosts and geographical locations were used in this study. Our results showed that HSP40 sequence of the examined strains was between 6621 bp and 6644 bp in length, and their A+T content was from 48.54% to 48.80%. Furthermore, sequence analysis presented 195 nucleotide mutation positions (0.12%–1.14%) including 29 positions in CDS (0.02%– 0.12%) compared with T. gondii ME49 strain (ToxoDB: TGME49 265310). Phylogenetic assay revealed that T. gondii strains representing three classical genotypes (Types I, II, and III) were completely separated into different clusters by maximum parsimony (MP) method, but Type II and ToxoDB#9 strains were grouped into the same cluster. These results suggested that HSP40 gene is not a suitable marker for T. gondii population genetic research, though three classical genotypes of T. gondii could be differentiated by restriction enzymes MscI and EarI existing in amplicon C.
1. Introduction Toxoplasma gondii infects almost all the warm-blooded animals including about one-third population of humans [1, 2] and can cause serious clinical diseases, especially in pregnant women and immunocompromised individuals such as tumor sufferers and AIDS patients [3, 4]. T. gondii can also cause abortion and congenital toxoplasmosis in livestock, leading to considerable economic losses [5, 6]. Heat shock proteins (HSPs) involved in antigen presentation and cross-presentation play important roles in activation of immune-related cells such as macrophages, lymphocytes, and DCs [7–9]. As the important member of HSPs, HSP40 associated with DNA replication, protein folding, assembling and degradation, translocation across membranes, signal transduction, and endocytosis participates in the pathogenesis of apicomplexan parasites such as Plasmodium falciparum [10, 11]. Recent studies emphasized
that different clonal types of T. gondii strains with diverse geographical distribution can cause different toxoplasmosis in animals and humans [12, 13]. In order to unveil the details of T. gondii genetic diversity, sequence variation of the type II HSP40TgSIS1 (ToxoDB: TGME49 265310, previously named TGME49 065310) [14] among T. gondii isolates from different hosts and geographical regions was examined in this study.
2. Materials and Methods 2.1. T. gondii Isolates and gDNA Preparation. Sixteen T. gondii isolates harvested from different hosts and geographical locations were used in the present study (Table 1). Genomic DNA was extracted as normal and stored at −20∘ C till used. 2.2. PCR Amplification and Sequencing. Three fragments (A, B, and C) (Figure 1) were separated based on the
2
BioMed Research International Table 1: Details of Toxoplasma gondii isolates used in this study.
Number 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 ∗
Isolate CTG TgCatBr64 GT1 RH TgPLH TgToucan MAS TgCatBr5 PTG PRU QHO TgC7 PYS GJS TgCgCa1 TgWtdSc40
Host Cat Cat Goat Human Pig Toucan Human Cat Sheep Human Sheep Cat Pig Pig Cougar Deer
Genotype∗ Reference, Type III, ToxoDB#2 Reference, ToxoDB#111 Reference, Type I, ToxoDB#10 Reference, Type I, ToxoDB#10 Type I, ToxoDB#10 Reference, ToxoDB#52 Reference, ToxoDB#17 Reference, ToxoDB#19 Reference, Type II, ToxoDB#1 Type II, ToxoDB#1 Type II, ToxoDB#1 ToxoDB#9 ToxoDB#9 ToxoDB#9 Reference, ToxoDB#66 Type 12, ToxoDB#5
Geographical location United States Brazil United States France Henan, China Costa Rica France Brazil United States France Qinghai, China Guangzhou, China Panyu, China Jingyuan, Gansu, China Canada USA
Based on the results of Zhou et al. [25, 26] and Su et al. [20]. TgCatBr64
.............A....T.......g.........a.....A....g..c..T.t.....................................................a................................................A..............a.............................t............t.
GT1 ......t......A....T......gg......g..a.....A....g.....Tc.a...........................................at...c...aggc..C.....g.-............a..c..............at..A..a.......tc..a.A..................c.....t.............t... RH
......t..G...A.A..T......gg.g.....a.a.....A....g.c...Tc.at..........................................at...c...agg.........g.-............a..cg.............at..A..a.......tcc.aC.T......c...c............t.............t...
TgPLH ......t......A....T......ggc........a.....A...Gg.....Tc.a...........................................at...c...agg....c....g.-......c.....a..c..a...........at..A..a.......tc..a..........................t...g.........t... TgToucan ..c...t......A....T......gg.........a.....A....g.....Tc.a..g........................................at...c...agg..g......g.-............a..c......t..t....at..A..a.......tc..a...............t.......g..t.............tc.. MAS
.....ct.....GA....T......gg.........a..g..A....g.....T....................................................c..a............c.....a.......a..c.......a......at..A...a......tc.ca..........................t.t...............
TgCatBr5 .g.c..t......A....T......gg.........ag....A....g.....T..................................................a....a.......c..........a.......a..c.......a.....cat.aAT..a...g..tc.ca........c.................t......c.........c PTG a.....ta...T.A....T.gca..gg.....a...a...CTA....gg..g.Tc......at.t..gc.G----------------------t.g.g.ga....c...ag..c.....atg.-..gtac.at.t.a..........a......at..A....g.....tc..a..........T.g......g......t....t........t... PRU a.....tac....AA.G.T..ca..gg.........a...C.A....gg....Tc......at.t..gcCG----------------------t.g.g.ga....c...ag..c.....a.g.-g.gta..at.t.a..........ac.....at..A....g.....tc..a..........T..c...a........t....t.....cc.t... QHO a.....ta.....A....T..ca..gg.........a...C.A....gg...CTc......at.t..gc.G----------------------t.g.g.ga....c.cgag..c.....a.g.-...ta..atct.a........c.a.......t..A.g..g.....tc..a..........T.............c.t....t........t... ME49 a.....ta.....A....T..ca..gg.........a...C.A....gg....Tc......at.t..gc.G----------------------t.g.g.ga....c...ag..c.....atg.-..gta..at.t.a..........a......at..A....g.....tc..a..........T...............t....t........t... TgC7 a.....ta.....A....T..caa.gg.........a...C.A.T..gg....Tc......at.t..gc.G----------------------t.g.g.ga....c...ag..c.....a.g.-.c.ta..at.tca..........a......at..A....g....ttc..a....g.....T...g...........t....t........t... PYS a...a.ta.....A...AT..caa.gg.........a...C.A....gg....Tct.....atct..gc.G----------------------t.g.g.ga....c...ag..c.....a.g.-...ta..at.t.a..........a......atg.A....g.....tc..a..........T...............t....tc.......t... GJS a.....ta..C..A....T..ca..gg....a....a...C.A..A.gg....Tc...c.gat.tc.gc.G----------------------t.g.g.ga....c...ag..c.....a.g.-...ta..at.t.at.........a......at..A....g.c...tc..a..........T...............t....t........t... TgCgCa1 ......t......A....Tg.c...gg..ct.....a.a...AT...g.....Tc......at.t..g..G.......................a.ggc.atgt.c...ag.......aa.g......a..at...a.ac.a.tt..a..cgc.at..A.....g..t.tc..a.....gtc..T.......c..a....tc......a.c..tt... TgWtdSc40 a.....ta.....A....T..ca.agg........aa...C.A....gg....Tc......at.t.ggc.G......................t.g.g.ga....c...ag..c.....a.g.-...ta..at.t.a..........a......at..A....g.....tc..a...t......TC....a.....c..gt....t...g....t...
51 132 164 174 232 285 297 332 376 512 530 577 608 641 694 721 729 746 758 809 838 846 855 898 930 937 967 973 1021 1032 1159 1177 1195 1227 1253 1261 1287 1311 1314 1315 1357 1375 1425 1431 1432 1459 1469 1559 1566 1578 1588 1636 1881 1897 2023 2075 2140 2287 2332 2431 2442 2478 2483 2521 2564 2571 2664 2675 2698 2755 2759 2786 2787 2788 2789 2790 2791 2792 2793 2794 2795 2796 2797 2798 2799 2800 2801 2802 2803 2804 2805 2806 2807 2808 2843 2881 2909 2911 2969 2997 3010 3019 3030 3092 3100 3141 3169 3238 3249 3260 3288 3350 3353 3390 3413 3432 3450 3521 3532 3619 3644 3645 3647 3667 3672 3692 3745 3750 3753 3789 3799 3821 3826 3832 3837 3841 3846 3881 3972 4137 4167 4178 4204 4214 4224 4259 4310 4343 4368 4377 4442 4449 4512 4520 4527 4531 4540 4566 4635 4658 4721 4732 4761 4778 4801 4822 4826 4857 4869 4899 4904 4908 4920 4928 4966 5001 5066 5140 5174 5315 5354 5379 5409 5415 5451 5478 5511 5521 5565 5579 5601 5626 5639 5648 5688 5692 5702 5731 5767 5793 5831 5852 5875 5896 5906 5958 6076 6081 6102 6117 6139 6154 6237 6257 6336 6339 6344 6459
CTG gattttggtATCAGGGAGCaatgggaatcactgatcgagtTCTACGAaattaTCtcgctaatatgtattTAccagaaaaattcacttgggtttcctcatagcactgttattatttTtttgctttttcggttggtatcaggatgcctcctcacgtggatGCaggattagagttagTGCgaactttGTataagggatgtatactcaagttgagttcgtct
5
∗
1
2
3
500 bp
4
5
6
F40B
8
R40A
9
10
11
12
R40B
B
A F40A
7
3
C F40C
R40C
Figure 1: Sequence analysis of HSP40 gene among different Toxoplasma gondii strains. Color boxes indicate 12 extrons of HSP40 gene and the gray one stands for the region of 3 -UTR. Black triangle () and asterisk (∗) indicate the translation start condon (ATG) and the stop one (TAG), respectively. Three pairs of specific primers (F40A/R40A, F40B/R40B, and F40C/R40C) used in this study were marked with arrows. Upper or lower case, respectively, indicates different nucleotide of extron or intron/3 -UTR. Point (.) and stub (–) among different nucleotides indicate identical or no nucleotide here compared with that of CTG strain (bottom line). The number beside the sequence stands for the variable sequence position for nucleotide, and black bar indicates 500 bp in length.
HSP40 sequence of T. gondii ME49 isolate (ToxoDB: TGME49 265310), and the amplifications were performed by PCR using three pairs of specific primers, respectively (Table 2). Thermal cycling conditions were according to the following protocol: initial denaturation at 94∘ C for 10 min
followed by 35 cycles composing of 94∘ C for 1 min, 54.7∘ C (amplicon A), 66.8∘ C (amplicon B) or 64.0∘ C (amplicon C) for 45 s respectively, and 72∘ C for 2 min, and the additional extension step was carried out at 72∘ C for 10 min. Negative control without gDNA was included in each amplification.
BioMed Research International Table 2: Details of primers used in this study. Primer
Sequence (5 -3 )
F40A
ATGGGGAAGGTAATCACATT
R40A
CGACTGGAACTATCGATTTC
F40B
TGTGGGGCGAGAGCCAGAGG
R40B
TGCAGAGGTGCCTTGCGTTT
F40C
CCCTGCATCGCGTGAGCTTC
R40C
AACGAGTGGAAAGCCCCCGT
Amplicons A, B, and C were amplified from different T. gondii strains by PCR using F40A/R40A, F40B/R40B, and F40C/R40C, respectively.
PCR amplifications were confirmed by agarose gel electrophoresis as previously described [15]. All the PCR products were purified using spin columns (Promega, Madison, USA), ligated with pMD18-T vector (TaKaRa, Dalian, China), and transformed into E. coli DH5𝛼 competent cells (Promega) according to the manufacturers’ instructions. The positive colonies confirmed by PCR were sequenced by Shanghai Sangon Biological Engineering Biotechnology Company. All the experiments were run in triplicate. 2.3. Sequence Analysis and Phylogenetic Reconstruction. The sequences of all the examined T. gondii strains were amplified step by step and sequenced. Alignment analysis based on the obtained sequences including the reference one (ToxoDB: TGME49 265310) was carried out with Clustal X 1.83 [16], and the number of sequence variation compared with ME49 strain was calculated as previously described [17]. Phylogenetic reconstructions were performed by maximum parsimony (MP) method using PAUP∗ 4.0b10 [18], and 100 random addition searches using tree-bisection reconnection (TBR) were carried out for each MP assay. Bootstrap probability (BP) was calculated from 1,000 bootstrap replicates with 10 random additions per replicate in PAUP.
3 in HSP40 genomic locations and 29 positions in CDS (0.02%– 0.12%) in comparison with T. gondii ME49 strain (ToxoDB: TGME49 265310), which was lower than our previous reports of GRA5 [21], ROP38 [22], ROP47 [23], eIF4A [15], and other genes of T. gondii, such as GRA6 [24]. Moreover, 141 transitions (A ↔ G and C ↔ T) and 54 transversions (A ↔ C, A ↔ T, G ↔ T, and G ↔ C) (𝑅 = transition/transversion = 2.6) were also identified, and the distance of evolutionary divergence was 0.1%–1.0% among the examined T. gondii strains (Table 3). Nucleotide polymorphisms analysis revealed two polymorphic restriction sites MscI and EarI in the sequence of amplicon C (2252 bp in length), which can differentiate three classical genotypes of T. gondii (Types I, II, and III) (Figure 2) [19, 20, 25, 26]. In brief, the PCR products of TgToucan, MAS, TgCatBr5, and T. gondii Type I strains (GT1, RH, and TgPLH) were digested into four segments (81, 165, 811, and 1195 bp); Type II strains (PTG, PRU, and QHO), ToxoDB#9 (TgC7, PYS, and GJS), TgCgCa1, and TgWtdSc40 were composed of three parts (81, 811, and 1360 bp); and the PCR products of Type III (CTG) and TgCatBr64 were cut into five sections (81, 165, 381, 811, and 814 bp). The results suggested that all the examined T. gondii strains could not be completely separated into their own groups by PCR-RFLP especially for ToxoDB#9 strains. Phylogenetic reconstruction was constructed based on HSP40 sequences of the 17 T. gondii strains including T. gondii ME49 isolates (ToxoDB: TGME49 265310) (Figure 3) [18]. Our results showed that T. gondii strains belonging to Type II (PRU, QHO, ME49, and PTG), Type 12 (TgWtdSc40), or ToxoDB#9 (PYS, TgC7 and GJS) were grouped into the same cluster, whereas TgToucan (ToxoDB#52) was gathered into the cluster of Type I (RH, GT1, and TgPLH), suggesting that the examined T. gondii strains could not be completely separated by MP method though three classical genotypes of T. gondii (Types I, II, and III) were clustered into different groups.
4. Conclusion
2.4. Characterization of T. gondii Isolates by PCR-RFLP. To evaluate whether HSP40 gene was suitable for genotyping of T. gondii isolates, PCR-RFLP method was also used in this study as previously described [19, 20]. All the PCR products of amplicon C were digested with two restriction enzymes MscI and EarI by incubating at 37∘ C for 4 h according to the manufacturer’s instructions (NEB, Beijing, China). And the restriction fragments were separated by electrophoresis as previously described [21].
Our data suggested that HSP40 gene is not a suitable marker for T. gondii population genetic study, though three classical genotypes of T. gondii (Types I, II, and III) could be differentiated by polymorphic restriction endonuclease sites MscI and EarI existing in amplicon C.
3. Results and Discussion
Authors’ Contribution
Our results showed that HSP40 gene of all the examined strains was between 6621 bp and 6644 bp in length spliced by amplicons A (2430 bp), B (2107–2130 bp), and C (2252 bp), and their A+T contents varied from 48.54% to 48.80% (Figure 1, Table 3). The alignment of all the 17 sequences revealed nucleotide mutations at 195 positions (0.12%–1.14%)
Zhong-Yuan Li and Jing Lu contributed equally to this work.
Conflict of Interests All the authors declare no conflict of interests.
Acknowledgments This project support was provided, in part, by the National Natural Science Foundation of China (Grant no. 31172316)
∗
DNA
cDNA
CDS
𝑅 = transition/transversion; — means no data here.
Item
Number of intron 1 2 3 4 5 6 7 8 9 10 11 Length (bp) 6621–6644 1620 1011 471 595 320 278 501 629–651 533-534 547 287 367 473 A+T (%) 48.54–48.80 45.12–45.56 45.20–45.70 44.80–45.65 48.40–48.91 45.62–46.56 45.68–46.40 51.70–52.10 53.90–54.99 48.78–50.28 51.74–52.47 54.70–55.75 45.78–46.32 47.36–47.78 Transition 141 36 26 7 15 5 3 8 14 12 10 9 6 16 Transversion 54 5 3 2 6 0 0 4 8 10 9 5 1 4 𝑅∗ 2.6 7.2 8.6 3.5 2.5 — — 2 1.7 1.2 1.1 1.8 6 4 Distance (%) 0.1–1.0 0.1–0.7 0–1.1 0–1.1 0–1.4 0–0.9 0–1.1 0–1.8 0–1.9 0–2.1 0–1.8 0–2.1 0–1.1 0.2–1.5
Table 3: Sequence characteristics of Toxoplasma gondii HSP40 including its expressed regions and introns.
4 BioMed Research International
BioMed Research International
5
(bp)
M 1 2 3 4
5 6 7 8 9 10 11 12 13 14 15 16
2000 1000 750 500 250 100
Figure 2: PCR-RFLP analysis based on the PCR products of amplicon C. Lane M indicates DL2000; lanes 1–16 stand for T. gondii Type I (GT1, RH, and TgPLH); TgToucan, MAS, and TgCatBr5, Type II (PTG, PRU, and QHO); ToxoDB#9 (TgC7, PYS, and GJS), TgCgCa1, and TgWtdSc40, Type III (CTG); and TgCatBr64, respectively.
PYS TgC7
63
ToxoDB#9
GJS PTG
62
100
64
ME49 PRU
100
II
QHO TgWtdSc40 TgCgCa1
93
TgToucan TgPLH
98
100
GT1
I
RH 50
93
MAS TgCatBr5
TgCatBr64
CTG
III
10.0
Figure 3: Phylogenetic analysis of HSP40 gene among 17 Toxoplasma gondii strains using maximum parsimony (MP) method. Three clusters of the classical genotypes (Types I, II, and III) and ToxoDB#9 were denoted. The numbers along branches indicate bootstrap values (%).
and the Science Fund for Creative Research Groups of Gansu Province (Grant no. 1210RJIA006).
[7] Z. Li, A. Menoret, and P. Srivastava, “Roles of heat-shock proteins in antigen presentation and cross-presentation,” Current Opinion in Immunology, vol. 14, no. 1, pp. 45–51, 2002.
References
[8] G. Kaul and H. Thippeswamy, “Role of heat shock proteins in diseases and their therapeutic potential,” Indian Journal of Microbiology, vol. 51, no. 2, pp. 124–131, 2011.
[1] J. G. Montoya and O. Liesenfeld, “Toxoplasmosis,” The Lancet, vol. 363, no. 9425, pp. 1965–1976, 2004. [2] D. Schl¨uter, W. D¨aubener, G. Schares, U. Groß, U. Pleyer, and C. L¨uder, “Animals are key to human toxoplasmosis,” International Journal of Medical Microbiology, vol. 304, no. 7, pp. 917–929, 2014. [3] K. Kim and L. M. Weiss, “Toxoplasma: the next 100 years,” Microbes and Infection, vol. 10, no. 9, pp. 978–984, 2008. [4] L. M. Weiss and J. P. Dubey, “Toxoplasmosis: a history of clinical observations,” International Journal for Parasitology, vol. 39, no. 8, pp. 895–901, 2009. [5] J. P. Dubey, Toxoplasmosis of Animals and Humans, CRC Press, Boca Raton, Fla, USA, 2nd edition, 2010. [6] P. Zhou, Z. Chen, H.-L. Li et al., “Toxoplasma gondii infection in humans in China,” Parasites & Vectors, vol. 4, article 165, 2011.
[9] T. J. Borges, L. Wieten, M. J. C. van Herwijnen et al., “The antiinflammatory mechanisms of Hsp70,” Frontiers in Immunology, vol. 3, article 95, 2012. [10] P. Acharya, S. Chaubey, M. Grover, and U. Tatu, “An exported heat shock protein 40 associates with pathogenesis-related knobs in Plasmodium falciparum infected erythrocytes,” PLoS ONE, vol. 7, no. 9, Article ID e44605, 2012. [11] S. K¨ulzer, S. Charnaud, T. Dagan et al., “Plasmodium falciparum-encoded exported hsp70/hsp40 chaperone/cochaperone complexes within the host erythrocyte,” Cellular Microbiology, vol. 14, no. 11, pp. 1784–1795, 2012. [12] L. D. Sibley and J. W. Ajioka, “Population structure of Toxoplasma gondii: clonal expansion driven by infrequent recombination and selective sweeps,” Annual Review of Microbiology, vol. 62, pp. 329–351, 2008.
6 [13] F. Robert-Gangneux and M.-L. Dard´e, “Epidemiology of and diagnostic strategies for toxoplasmosis,” Clinical Microbiology Reviews, vol. 25, no. 2, pp. 264–296, 2012. [14] M. J. Figueras, O. A. Martin, P. C. Echeverria et al., “Toxoplasma gondii Sis1-like J-domain protein is a cytosolic chaperone associated to HSP90/HSP70 complex,” International Journal of Biological Macromolecules, vol. 50, no. 3, pp. 725–733, 2012. [15] J. Chen, S.-F. Fang, D.-H. Zhou, Z.-Y. Li, G.-H. Liu, and X.-Q. Zhu, “Sequence variation in the Toxoplasma gondii eIF4A gene among strains from different hosts and geographical locations,” Genetics and Molecular Research, vol. 13, no. 2, pp. 3356–3361, 2014. [16] J. D. Thompson, T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins, “The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools,” Nucleic Acids Research, vol. 25, no. 24, pp. 4876– 4882, 1997. [17] N. B. Chilton, R. B. Gasser, and I. Beveridge, “Differences in a ribosomal DNA sequence of morphologically indistinguishable species within the Hypodontus macropi complex (Nematoda: Strongyloidea),” International Journal for Parasitology, vol. 25, no. 5, pp. 647–651, 1995. [18] D. L. Swofford, PAUP∗ . Phylogenetic Analysis Using Parsimony. Version 4.0b10, Sinauer Associates, Sunderland, Mass, USA, 2002. [19] C. Su, X. Zhang, and J. P. Dubey, “Genotyping of Toxoplasma gondii by multilocus PCR-RFLP markers: a high resolution and simple method for identification of parasites,” International Journal for Parasitology, vol. 36, no. 7, pp. 841–848, 2006. [20] C. Su, E. K. Shwab, P. Zhou, X.-Q. Zhu, and J. P. Dubey, “Moving towards an integrated approach to molecular detection and identification of Toxoplasma gondii,” Parasitology, vol. 137, no. 1, pp. 1–11, 2010. [21] J. Chen, Z.-Y. Li, D.-H. Zhou, G.-H. Liu, and X.-Q. Zhu, “Genetic diversity among Toxoplasma gondii strains from different hosts and geographical regions revealed by sequence analysis of GRA5 gene,” Parasites & Vectors, vol. 5, article 279, 2012. [22] Y. Xu, N. Z. Zhang, J. Chen et al., “Toxoplasma gondii rhoptry protein 38 gene: sequence variation among isolates from different hosts and geographical locations,” Genetics and Molecular Research, vol. 13, no. 3, pp. 4839–4844, 2014. [23] J. L. Wang, T. T. Li, Z. Y. Li, S. Y. Huang, H. R. Ning, and X. Q. Zhu, “Rhoptry protein 47 gene sequence: a potential novel genetic marker for population genetic studies of Toxoplasma gondii,” Experimental Parasitology, vol. 154, pp. 1–4, 2015. [24] A. Fazaeli, P. E. Carter, M. L. Darde, and T. H. Pennington, “Molecular typing of Toxoplasma gondii strains by GRA6 gene sequence analysis,” International Journal for Parasitology, vol. 30, no. 5, pp. 637–642, 2000. [25] P. Zhou, H. Zhang, R.-Q. Lin et al., “Genetic characterization of Toxoplasma gondii isolates from China,” Parasitology International, vol. 58, no. 2, pp. 193–195, 2009. [26] P. Zhou, H. Nie, L.-X. Zhang et al., “Genetic characterization of Toxoplasma gondii isolates from pigs in China,” Journal of Parasitology, vol. 96, no. 5, pp. 1027–1029, 2010.
BioMed Research International
