Plant Molecular Biology 16: 475-478, 1991. © 1991 Kluwer Academic Publishers. Printed in Belgium.

475

Plant Molecular Biology Update

Sequences of two hsc 70 cDNAs from Lycopersicon esculentum Tsai-Yun Lin 1, Nicholas B. Duck ~, Jill Winter 2 and William R. Folk 1 1Department of Biochemistry, University of Missouri, Columbia, MO 65211, USA; 2Sandoz Crop Protection, 975 California Ave., Palo Alto, CA 94304-1104, USA Received 9 October 1990; accepted in revised form 9 November 1990

Heat shock and other forms of stress induce the abundant synthesis of several classes of proteins in bacteria, fungi, yeast, insects, mammals and higher plants [5, 12]. Heat-shock proteins (hsp's) in higher organisms can be grouped into a family of 1 7 - 3 0 k D a low molecular weight hsp's, a family of 60 kDa hsp's (termed chaperonins), a family of ca. 70 kDa hsp's, a small hsp 83 family and an uncharacterized > 100 kDa hsp. The hsp70 gene family includes members which are strictly heat-inducible as well as cognate genes that are expressed in the absence of heat stress [6]. Pelham [16] has suggested that following stress, hsp 70 binds to partially unfolded proteins and prevents aggregation; hsp70 then uses the energy of ATP hydrolysis to undergo a conformational change and release itself from its substrate. More recently, a cytosolic form of human hsp 70 (hsp 72/73) has been shown to bind newly synthesized proteins and is believed to promote protein folding concomitant with synthesis and assembly [1]. These proteins have also been shown to be involved in the disassembly of clathrin cages around coated vesicles [4]. In yeast, hsp70 family members are required for transport of protein precursors into the mitochondria and endoplasmic reticulum and may be involved in unfolding proteins into a transport competent state [7]. In this paper, we report the nucleotide sequences of two tomato hsc 70 genes and the predicted amino acid sequences of their gene products.

A c D N A library in 2gtl0 made from tomato cv. VF36 mature pistil poly(A) RNA (a gift from Kim Sachs, Monsanto) was screened with a petunia hsp70 c D N A gene [20] under low stringency conditions (hybridization: 40~/o formamide, 5 x SSC, 1 x Denhardt's solution, 300 g m L - 1 tRNA, 1~o SDS, 42 °C; wash: 2 x SSC, 0.1~o SDS, 50 °C). The EcoRI fragments of the positive plaques were selected and subcloned into pUC 19. Restriction endonuclease fragments were subcloned into M13mpl8 or m p l 9 for sequence analysis of both strands of DNA. The D N A coding sequences of two tomato genes, hsc-1 and hsc-2 (Fig. 1) indicate that they share 81 ~/o identity at the nucleotide level. These two genes have high homology to hsp 70 genes of petunia [20], maize [17], yeast, mouse, rat, human, Drosophila and Xenopus [5]. The predicted translation initiation sites of hsc-1 and hsc-2 match Kozak's rule [ 11]. The open reading frame of hsc-1 encodes a protein of 71.3 kDa (650 aa), while hsc-2 encodes a protein of 70.7 kDa (644 aa). They are 92~/o conserved (Fig. 1). The predicted pI value ofhcs-1 is 4.9 and of hsc-2 is 4.83. Possible glycosylation sites include NXT at 38-40 and 425-427, NXS at 155-157 and 496-498 for both genes, and NXT at 492-494 for hsc-2 only [13]. Hsc70's and hsp70's in plants and other systems are known to bind to ATP and to use the energy of ATP hydrolysis for their functions [15]. For the hsc70 and the hsp70 proteins of

The nucleotide sequence data reported will appear in the EMBL, GenBank and D D B J Nucleotide Sequence Databases under the accession numbers X54029 (hsc-l) and X54030 (hsc-2).

476 Hsc-1

ttctttttttctctgataaeegtcgcagtgtaaagea

Hsc-2

ATG GCC GGA AAA GGT GAA

ccttcttcaaagctttcattcagatttcagctcctctttcctcagtaaetagccgaetctaaaagaaaagat

~

Hsc-I* HSC-2

..... M *

A *

C ..G ..A G *

g *

G *

E *

GGA CCG GCG ATC GGA ATT GAT TTG GGG ACT ACG TAT TCT TGT GTC GGC GTT TGG CAA CAT GAT CGT GTG GAG ATC ATC ..................... C.C . . T . . . . . A ..C .,A ..C ..... T .,A ........ C ........ T ..A ..... T G P A 1 G ] D L G T T Y S C V G V U Q H D R V E l I •

*

~

*

11r

*

*

*

*

*

*

*

*

18

... 6

96 32

*

GCT AAT GAT CAA GGA AAC AGA ACT ACA CCG TCT TAT GTC GGA TTC ACT GAC ACT GAA CGT CTC ATT GGT GAT GCT GCT ..C ........... T ........ G ..G ..... C ..C ,.T ..T ........ T T.... G .................... C A N D Q G N R T T P S Y V G F T D T E R L I G D A A

174

AAG AAT CAG GTC GCC CTG AAT CCA ATT AAC ACC GTT TTC GAT GCA AAG CGG CTT ATT GGT AGG AGG TTC AGT GAT GCG ..A ..... A ...... A....... T ..C ..... G ..... T ..... T . . A A . . T,G . . . . . . . . . . . . . . T ........ T K N Q V A L N P ] N T V F D A K R L I G R R F S D A

252

TCT GTA CAA GAG GAC ATG AAA TTG TGG CCT TTC AAG GTT ATT CCT GGC CCT GGT GAT AAG CCA ATG ATT GTT GTT ACC ..... G . . G AGT . . . . . . . . G ..A ..... A ................. T ..... C .................... C .A. S V Q E D M K L W P F K V I P G P G D K P M l V V T * ~ * S * * * * * * ~ * ~ * t * * * * * * * * * * N

330

TAT AAG GGT GAA GAA /tAG GAA TTT GCT GCT GAA GAA ATC TCT TCT ATG GTC CTG ACA AAG ATG AAG GAA ATC GCA GAG ..C ........ G . . G , . , C.G . , . T . . . . G . , G . . G . . . . . A ........ G . . C ,TT . . . . . . . . A ........ T . .A Y K G E E K E F A A E E ! S S M V L T I( M K E I A E . . ; ; * /t * * * ~ Q /t S * * Vr * * * * * * | * ~ *

408

GCC TTC CTT GGA TCT ACT GTG AAA AAT GCT GTG GTG ACT GTG CCA GCC TAC TTC AAT GAC TCA CAA CGC CAG GCT ACA C . .C ,.T ......... A.A . . . . . T ..G ........... T ..... T .......... CT . . . . . . . . T ... • .T ..... A F I.. G S T V K N A V V T V P A Y F N D S O R Q A T * * W It * * * * T * * * * * * * * * * * * S * * * *

486

AAG GAT GCA GGA GTT ATT TCT GGA CTA AAT GTC ATG CGT ATT ATT AAT GAA CCT ACA GCT GCT GCC ATT GCC TAT GGA • .T .T . . . . . . . . . • .C . . . . . . . . G ........... C ........ A . .G , , A . . . . . T ..... T ..... T l( D A G V I S G L N V M R I ] N E P T A A A l A Y G

564

58

84

110

136

u

"k

TTG GAC AAA C.T . .T • .G K L D W

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

AAG GCT ACT AGT GCA GGG GAG AAG AAC GTG CTT ATA TTC GAT CTT GGT GGT GGT ACT TTT GAT GTA TCC .... A . .C . . . ,TT . . T . . . . . . . . . . . . . . C ..C ..T ................. A ........ C o .T I( A T S A G E K N V L ] F D L G G G T F D V S *

t

*

V

*

*

*

*

*

*

*

*

*

/t

W

*

*

~t

*

lk

ik

*

*

le

*

t

*

*

*

Ik

*

*

*

W

/it

*

*

N

ATG GTG AAC CAT TTT GTC CAC GAA TTC AAG AGA AAG CAC AAG AAG GAT ATC ACT GGT ~ C CCA APdk GCT CTA • .G . . . . A . .T . . . . . . . . T ..G . . . . . T ..A .,G ,., A .... A ................. T • .T- . . G . . A • , G R M V N H F V H E F K R K H ~ K D ! T G N P R A L * * * Q * * * * * N * * * * * *

AGA AGA .,G • .G R

R

TTA AGG ACA GCT TGT GAG AGG GCT AAG AGA ACT CTC TCT TCC ACT GCT CAA ACA ACA ATT GAA ATT GAT TCC ..G .A ..T • .A ........... A ..... G ,.A ..T ..A ........... G ..C ..C ..... G ,.C ..C ..T L R T A C E R A K R T L S S T A O T T l E ] D S *

CTG TAT ..°

L

*

*

*

•

•

*

t

*

•

*

*

*

*

*

*

~2 214

720 240

*

N~C AGA °o.

188

*

CTC CTC ACT ATT GAA GAG GGT ATC TTT GAG GTG AAG GCA ACA GCA GGA GAC ACT CAC CTT GGA GGT GAG GAT TTT GAT ..A ..... A .... G • .A .................... T .,T . .T ..... T ..... T ......... ..... C ..... C T I E E G I F E V K A T A G D T H L G G L L E D F D qb

162

*

GAG GGA GTT GAT TTC TAT TCT ACC ATT ACC CGT GCC AGA TTC ~ G GAG TTG ~ C ATG ~ T ....... TA.. ..... T ,.C ,,C ..... C ,.A ..... T ..... T - . , A- o , . -C,1- . . . . . . . . . . . Y E G V D F Y S T i T R A R F E E L N M D * * * ]

*

*

*

798 266

876

292

*

CTC TTC AGG ~ G G .,T ...... L F R K

954 318

Fig. 1. Nucleotide sequence of the tomato hsc-1 and hsc-2 genes and the predicted amino acid sequences of their polypeptides. Noncoding regions are printed in lower-case letters. The putative initiation and termination codons of the open reading frame encoding hsc-1 are underlined. • denotes identical bases in hsc-I and hsc-2, and * denotes identical residues in hsc-1 and hsc-2. - denotes the deletion of an amino acid at that position. Underlined sequences are referred to the text. This sequence completes preliminary data referred to by Nover et al. [14].

477 TGT ATG GAA CCA GTT GAG AAA TGT TTA AGG CAT GCC AAG ATG GAC AAG AGC ACC GTT CAT GAT GTT GTT CTT GTC GGT 1032 . . . . . . . . . . . . . . . . . . . . G . . . . . G . . . . . . . . . . . . . . . . . . . . . . . . . . A ........... C ... T.G ..T ...

C *

N *

E *

P *

V *

E

*

K *

C

*

L

*

R

*

0 *

A *

K *

14 *

D *

K *

S *

T *

V *

H

*

D *

V *

V *

L

*

V *

G

*

GGA TCC ACT AGA ATT CCC AAG GTG CAG CAG GTT GCC ATG ACG AAC TTC TTC AAC GGC AAG GAA CTC TGC AAG AGC ATC

..C G *

........... S T * *

R *

C ..A l P * *

..A g *

..T V *

..A Q *

..A Q *

"'" V

CTT T . . A N L L

CA. G. . . . . . . . . . . . . T N F F Q D * *

N *

G ..... G K * *

G ............... E L C K * * * *

S *

I *

344

1110 1107 370 369

AAC CCA CAT GAG GCT GTT GCC TAT GGT GCT GCA GTG CAA GCT GCC ATT CTC AGT GGA GAA GGT AAT GAG AAG GTC CAA 1188 ..... T .............. T ...... . ................ A . . . T.G . . . . . C ..G .............. G . . G 1185 N P D E A V A Y G A A V Q A A I L S G E G N E K V Q 396 * * * * * * * * * * * * * * * * * * * * * * * * * * 395 GAC TTG CTG CTT TTG GAC GTG ACA CCA CTT TCT CTT GGG TTA GAA ACG GCA GGT GGT GTG ATG ACT GTC TTG ATT CCA 1266 ... C.T T .... G ..... T ..T ..C ..T ..... C ..... T C.G . . G . . A . . T . . . . . . . . C ........ G ........ C 1263 D L L L L D V T P L S L G L E T A G G V N T V L I P 422 * * * * * * * * * * * * * * * * * * * * * * * * * * 421 AGG AAC ACC ACA ATT CCT ACC AAG AAA GAG CAG GTA TTT TCC ACT TAC TCT GAT AAC ~ CCC GGA GTA TTG ATT CAG 1344 ..A ..... G ..T ..C ..A ........ G ........ C ..C ..A ..C ........ C ..... G ..T ..T ..G ........ A 1341 R N T T I P T K g E Q V F S T Y S 0 N Q P G V L l q 448 *

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

4/t7

GTG TTT GAA GGT GAG AGA CGA GCA AGA ACC AGA GAC AAC AAT CTG TTG GGT AAA TTT GAG CTC TCT GTT ATT CCC CCT 1422 .... A ............. --- A.... G ..... G ........ C T . . C.T . . C . . . . . . . . . . . T ..C .G...C ..T ... 1416 V F E G E R R A R T R D N N L L G K F E L S V I P P 474 * Y * * * * T * * * * * * * * * * * * * * G * * * 472 GCT CCT AGG GTT GTG CCT CAG ATC ACG GTC TGT TTC GAC ATT GAT GCA AAT GGT ATC TTG AAT GTC TCT GCT GAG GAC 1500 ..C ..C .... GA .TT . . . . . A ..... A ..G ..C .............. G ....... C...A ................. T 1494 A P R V V P Q I T V C F D ] D A N G ! L N V S A E D 500 * * * G * * * * * * * * * * * * * * T * * * * * * * 498 AAG ACT ACT GGA CAG AAG AAC AAG ATC ACA ATT ACC AAT GAC AAG GGT AGG TTG TCA AAG GAA GAA ATT GAG AAG ATG 1578 ..... C ..C ................. A ..C ..C ..T ........... C . . A C.C . . . . . . . . G ..G ............ 1572 K T T G Q K N K [ T ! T N D K G R L S K E E ] E K M 526 *

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

W

*

*

524

GTC CAG GAA GCT GAA AAG TAC AAG GCA GAA GAT GAA GAA CT'C AAG /tAG AAG GTG GAG GCT AAA AAT TCA TTG GAG AAC 1656 • .T ........ A ,.G ..A ..... A T.T ..G ..... G . . G .A . . . . . . . . . . . . T ..... A . . G . . . G.T . . . . . . . . . 1650 V Q E A E K Y K A E D E E L K K K V E A K N S L E N 552 * * * * * * * * S * * * * H * * * * * * * * A * * * 550 TAC GCT TAT AAC ATG AGA AAC ACA GTG AAG CAT GAG AAA ATT GGT TCT AAG CTT AGC TCG GAC GAC AAG AAA AAG ATT ..... G ..C ..T ..... G ...... A.A . . . . . . . . . . . G .... CA . . C . . A . . G TC. G.T . . T . . . . G..CT ...... Y A Y N 14 R N T V K D E K I G S K L S S D D K K K ! * * * * * * * * [ * * * * * A * * * * A * * R T * *

17"54 1728 578 576

GAG GAT GCC GTC CAT CAG GCA ATT TCA TGG CTT GAG AGC AAC CAG CTT GCA GAA GTT GAT GAG TTT GAG GAC AAG ATG 1812 ..A . . . . . T A,T ..G ..A ..C ..C CAG . . . . . . . . T G,T . . . . . . . . C ..T ..G .C. ..A . . . . . . . . . . . . . . . . . . 1806 E D A V D Q A l S W L E S N Q L A E V D E F E D K M 604 * * * I E * * * Q * * D G * * * * * A E * * * * * * 602 /tAG GAG CTC GAG GGC ATC T G T A A T CCC ATC ATT GCAAAG ATG TAC CAG GGT GCT GGT GGT GAC GCA GGT GTT CCT ATG 1890 ........ A . . . A . T C.T . . C . . C . . T . . . . . . . . . . . A ........ A ..A ..A ......... - ........... . . . 1884 g E L E G l C N P I I A g N Y Q G A G G D A G V P N 630 * * * * S L * * * * * * * * * * * * * * * * 624 CAT CAT GAT GCT CCA CCA TCT GGT GGT AGC AGT GCA GGA CCT AAG ATT GAG GAG GTT GAT T A A g c g g t t g a t a a a g a t a c t a ..... C ..A .G...T G.T C . . A . . . . . G.T G . . . . T ..T ................. G ..C ... gtttgtggttcctatattg D D D A P P S G G S S A G P K I E E V D *

*

E

G

*

A

P

S

*

G

G

*

*

*

*

*

*

*

*

*

1972 1954 650 6~

gttggtttcattttcattagtatagtttagtagattactttgaattggctcttgtttcaagtttggtgttgtaatttcttactgatgtttttaaatagcgata ttttttattagatacctgtcatttttgtctcagagaactctatgaatatctttttctttcttcaatgaaatacaatgttatatgttg•agt

2075 2045

ctgagtgc

2083

Fig. 1 (continued).

478 tomato, petunia and maize, the sequence A E A X L G X T X X N A V V T V at positions 135 to 150 is a possible ATP binding site [2, 3]. The ATP binding domain of the bovine heat-shock cognate protein has been characterized by X-ray crystallography [9]. In human [19] and Drosophila [15] cells, fluorescent tagged antibodies have detected hsp 70's in the nucleus and nucleolus following heat shock. The human hsp 70 domain ( F K R K H K K D I S Q N K R A V R R ) is sufficient to target a pyruvate kinase reporter gene to the nucleus [10]. The tomato hsc70 proteins contain a related sequence at position 252-269. A highly conserved sequence which overlaps this sequence has been reported to bind to calmodulin

[181. Heat-shock proteins diverge significantly towards their carboxyl termini; however, both have the sequence A G P K I E E V D as do the proteins of maize and petunia (Fig. 1). Sequence EEVD is conserved in all the hsp's. Hsc-1 has been used as a probe for in situ hybridizations to examine the expression of this gene family in the absence of heat stress. Expression of hsc 70 was detected in secretory tissues and organs with zones of rapidly dividing and differentiating cells [ 8]. We are preparing monospecific antibodies to the carboxyl terminal domains of hsc-1 and hsc-2 to examine their subcellular location and tissue specificity. These studies will be reported elsewhere.

Acknowledgements This is Journal Article No. 11244 from Missouri Agriculture Experiment station. Support from Monsanto, USDA grant No. CSRS88-372613899 and the University of Missouri Food for the 21 st Century Program is gratefully acknowledged. We thank Kim Sachs (Monsanto) for the gift of the cDNA library.

References 1. Beckmann RP, Mizzen LA, Welch WJ: Interaction of hsps with newly synthesized proteins: implications for protein folding and assembly. Science 248:850-853 (1990). 2. Brenner S: The molecular evolution of genes and proteins: a tale of two serines. Nature 334:528-530 (1988). 3. Cegielska A, Georgopoulos C: Functional domains of the Escherichia eoli dnaK heat shock protein as revealed by mutational analysis. J Biol Chem 264:21122-21130 (1989). 4. Chappell TG, Welch WJ, Schlossman DM, Palter KB, Schlesinger MJ, Rothman JE: Uncoating ATPase is a member of the 70 kilodalton family of stress proteins. Cell 45:3-13 (1986). 5. Craig EA: The heat shock response. CRC Crit Rev Biochem 18: 239-280 (1985). 6. Craig EA, Ingolia TD, Manseau LJ: Expression of Drosophila heat-shock cognate genes during heat-shock and development. Dev Biol 99:418-426 (1983). 7. Deshaies RJ, Koch BD, Werner-Washburne M, Craig EA, Shekman R: A subfamily of stress proteins facilitates translation of secretory and mitochondrial precursor polypeptides. Nature 322:800-805 (1988). 8. Duck N, McCormick S, Winter J: Hsp70 cognate expression in vegetative and reproductive organs of Lycopersicon esculentum. Proc Natl Acad Sci USA 86:3674-3678 (1989). 9. Flaherty KM, DeLuca-Flaherty C, McKay DB: Threedimensional structure of the ATPase fragment of a 70k heatshock cognate protein. Nature 346:623-628 (1990). 10. Hunt C, Morimoto RI: Conserved features of eukaryotic hsp 70 genes revealed by comparison with the nucleotide sequence of human hsp70. Proc Natl Acad Sci USA 82:6455-6459 (1985). 11. Kozak M: Compilation and analysis of sequences upstream from the translational start site in eukaryotic mRNAs. Nucleic Acids Res 12:857-872 (1984). 12. Lindquist S, Craig EA: The heat-shock proteins. Annu Rev Genet 22:631-677 (1988). 13. Mononen I, Karjalainen E: Structural comparison of protein sequences around potential N-glycosylation sites. Biochim Biophys Acta 788:364-367 (1984). 14. Nover L, Neumann D, ScharfK-D: Heat Shock and Other Stress Response Systems of Plants, pp 2-63. Springer-Verlag, New York (1990). 15. Palter KB, Watanaba M, Stinson L, Mahowald AP, Craig EA: Expression and localization of Drosophila melanogaster hsp70 cognate proteins. Mol Cell Biol 6:1187-1203 (1986). 16. Pelham HRB: Speculation on the functions of the major heat shock and glucose-regulated proteins. Cell 46:959-961 (1986). 17. Rochester DE, Winter JA, Shah DM: The structure and expression of maize genes encoding the major heat shock protein, hsp 70. EMBO J 5:451-458 (1986). 18. Stevenson MA, Calderwood SK: Members of the 70 kDa heat shock protein family contain a highly conserved calmodulinbinding domain. Mol Cell Biol 10:1234-1238 (1990). 19. Welch WJ, Feramisco JR: Nuclear and nucleolar localization of the 72 kDa heat shock protein in heat-shocked mammalian cells. J Biol Chem 259:4501-4513 (1984). 20. Winter J, Wright R, Duck N, Gasser C, Fraley R, Shah D: The inhibition of petunia hsp70 mRNA processing during CdCI2 stress. Mol Gen Genet 211:315-319 (1988).