Downloaded from http://veterinaryrecord.bmj.com/ on April 26, 2015 - Published by group.bmj.com

Paper

Paper Serotypes and antimicrobial resistance patterns of the recent Korean Actinobacillus pleuropneumoniae isolates A. N. Yoo, S. B. Cha, M.-K. Shin, H. K. Won, E. H. Kim, H. W. Choi, H. S. Yoo In Korea, the addition of antibiotics to feed was banned in July 2011; since then, reports of outbreaks of porcine pleuropneumonia have increased. Therefore, knowledge of the characteristics of clinical isolates emerging in recent years is needed. This study analysed the serotype and antimicrobial susceptibility of 102 Actinobacillus pleuropneumoniae isolates from pigs with pleuropneumonia in Korea from 2006 to 2010. Serotype 5 was the most frequently isolated but the incidence of serotype 1 significantly increased in 2010. The susceptibility to florfenicol decreased considerably from 2006 to 2010, as did that of a minor percentage of isolates to ampicillin and amoxicillin. Of 11 tetracycline resistance genes, tet (B) was predominant (62 per cent), followed by tet (H) and tet (O). The florfenicol resistance (flo R) gene (34 per cent) and β-lactam antibiotic resistance (blaROB-1) gene (15 per cent) were also detected. The expression levels of the tetracycline repressor gene and resistance gene were not significantly correlated with the minimum inhibitory concentration values of tetracycline-resistant strains. Interspecies transferability of the resistance genes (flo R, tet (B)/blaROB-1) was observed with frequencies of 5.7×10−3 and 3.5×10−2, respectively. In analysing DNA patterns using pulsed field gel electrophoresis, there was a slight positive correlation with serotypes but not with isolated location and year. This study acknowledges the emergence of new serotype and antimicrobial resistance of A pleuropneumoniae based on the current situation in Korea. This knowledge may be useful in controlling the disease caused by A pleuropneumoniae.

Introduction

Actinobacillus pleuropneumoniae is a causative agent of porcine pleuropneumonia, a respiratory disease in pigs of all ages that may result in sudden death often detected in the postmortem inspection at slaughter, or in severe symptoms characterised by fibrinous pleuritis and haemorrhagic and fibrinous pneumonia with necrotic lung lesions (Bosse and others 2002, Chiers and others 2010). Some animals exposed to the organism may remain in a state of chronic infection as asymptomatic carriers transmitting the disease to the healthy pigs (Rycroft and Garside 2000). A pleuropneumoniae can be divided into 15 serotypes on the basis of the antigenic properties of capsular polysaccharides and the cell wall lipopolysaccharides; each serotype has different virulence factors, causing a variety of clinical signs (Blackall and others 2002, Chiers and others 2010). Infection with A pleuropneumoniae is a cause of great ­economic losses worldwide due to high mortality, reduction of Veterinary Record (2013) A. N. Yoo, DVM, MS, S. B. Cha, DVM, PhD, M. K. Shin, DVM, PhD, H. K. Won, DVM, MS, PhD, H. S. Yoo, DVM, MS, PhD, Department of Infectious Diseases, College of Veterinary Medicine and Brain Korea 21 Program for Veterinary Science, Seoul National University, Seoul 151-742, Korea

doi: 10.1136/vr.101863 H. K. Won, DVM, MS, E. H. Kim, PhD, H. W. Choi, DVM, MS, PhD, ChoongAng Vaccine Laboratory Co. Ltd., Daejeon 305-348, Korea; E-mail for correspondence: [email protected] Provenance: not commissioned; externally peer reviewed Accepted January 8, 2014

feed conversion rate and retarded growth rate among affected livestock. Thus, it is essential that an appropriate therapy be applied as accurately and quickly as possible (Rosendal and Mitchell 1983). Despite much research and many studies seeking vaccines to control the disease, vaccines offering complete protection against A pleuropneumoniae have not been developed yet (Ramjeet and others 2008). Current vaccines can reduce morbidity and mortality but do not provide cross-immune response for various serotypes and do not prevent the disease at the initial infection stage and the development of the carrier state (Ramjeet and others 2008). To compensate for the weaknesses of the vaccine, antimicrobial therapy is needed to control the disease at the initial stage of infection and to prevent its spread. Unfortunately, the indiscriminate and excessive use of antibiotic agents has resulted in an increase in antimicrobial resistance in a large number of animal and human bacterial pathogens. In Korea, copious amounts of various antibiotic agents have been used as food supplements up to 2011, as veterinary medicine prescriptions and for self-treatment by farmers to prevent the outbreak of diseases in the swine industry. According to the recorded data provided by the Korea Animal Health Products Association (KAHPA), the use of antibiotics as feed supplements (840,191 kg of active substance) from 2009 to 2011 was almost equivalent to their use as medicine (851,249 kg of active substance) in therapy performed by veterinary practitioners. Among many kinds of antibiotics, tetracycline was the most frequently used in Korea. Concern about this situation has led to a reduction in the use of antibiotics, primarily through the banning of antibiotics as a component in feed since July 2011; since then, reports of outbreaks of porcine pleuropneumonia have increased. Based on the current state of A pleuropneumoniae infection, it is clear that further knowledge of the antimicrobial susceptibility of clinical isolates in recent years is needed. In this study, the distribution of antibiotic resistance of A pleuropneumoniae isolated from pigs with pleuropneumonia in Korea was evaluated by performing the disk diffusion test and the microdilution test, and detecting the resistance gene. The intraspecies and interspecies transferability of resistance was investigated using bacterial conjugation. Moreover, the digested DNA patterns were compared using pulsed field gel electrophoresis (PFGE) to analyse correlations with serotypes, the resistance gene, origins and timespan. To satisfy our questions about which factor determines the minimum inhibitory concentration (MIC) value, the expression levels of the tetracycline repressor gene and resistance gene were investigated.

Materials and methods

Bacterial strains and serotyping

One hundred and two clinical isolates of A pleuropneumoniae were aseptically collected over a period of five years (from 2006 to 2010) from specimens of pigs showing symptoms of pulmonary diseases in Korea. A pleuropneumoniae was isolated and identified based on general bacterial isolation and identification methods, and cultured on chocolate agar (Hanil Comed Co., Seongnam, Korea) at 37°C for 24 hours with 5 per cent CO2. Once identification was complete, bacterial ­serotyping was performed as described previously (Rafiee and Blackall 2000, Clinical and Laboratory Standards Institute (CLSI) 2008). March 1, 2014 | Veterinary Record

Downloaded from http://veterinaryrecord.bmj.com/ on April 26, 2015 - Published by group.bmj.com

Paper Antimicrobial susceptibility testing

Antimicrobial resistances of A pleuropneumoniae were investigated by disk diffusion test and microdilution test conducted following the CLSI guidelines for in vitro antimicrobial susceptibility tests. To give precise information on the antimicrobial susceptibility of A pleuropneumoniae, both methods of testing were used. A pleuropneumoniae ATCC 27090 was used for quality control of the tests. In accordance with CLSI guidelines (CLSI 2008), Mueller–Hinton (MH) chocolate agar (BD Biosciences, Franklin Lakes, NJ, USA) was used for the disk diffusion test and Veterinary Fastidious Medium (Cation-Adjusted MuellerHinton (CAMH) broth with 2 per cent lysed horse blood, 2 per cent supplement C and 5 per cent yeast extract) was used for the microdilution test. Sixteen kinds of antibiotics disc (Oxoid, Basingstoke, Hants, UK) were used in disk diffusion tests: ampicillin (10 µg/disc), penicillin (10 µg/disc), amoxicillin (10 µg/disc), amoxicillin/clavulanic acid (30 µ/ disc), gentamicin (10 µg/disc), neomycin (30 µg/disc), kanamycin (30 µg/disc), lincomycin (2 µg/disc), tetracycline (30 µg/disc), nalidixic acid (30 µg/disc), enrofloxacin (5 µg/disc), cephalothin (30 µg/disc), ceftiofur (30 µg/disc), florfenicol (30 µg/disc), erythromycin (15 µg/ disc) and sulfamethoxazole/trimethoprim (23.75 µg/1.25 µg/disc). Tetracycline, florfenicol and β-lactam antibiotics (penicillin, ampicillin, cefoxitin and cefotaxim) were used in the microdilution test.

PCR for the detection of antibiotic resistance genes

A loop of bacterial culture was resuspended in 50 µl of distilled water and boiled at 100°C for 10 minutes and then stored at 4°C for five minutes. The suspension was spun down for 15 seconds, and supernatant was used as template DNA. Eleven different oligonucleotide

primer sets were used for detection of the tetracycline-resistant gene and other sets were used to find the florfenicol and β-lactam antibiotics resistance gene (Table 1). Each PCR mix of 20 µl contained 2 µl of i-Taq 10X PCR buffer, 0.015 mM of each dNTPs, 50 pmole of each primer, 1 µl of template DNA and 2.5 units of i-Taq DNA polymerase (iNtRON Biotechnology, Seoul, Korea). After initial denaturation at 94°C for five minutes, PCR cycling consisted of 35 cycles of denaturation at 94°C for 30 seconds, annealing at 54–55°C for 30 seconds and extension at 72°C for 30 seconds. Final extension was performed at 72°C for 10 minutes. The PCR products were separated by electrophoresis in 1.5 per cent agarose gel and visualised under a UV transilluminator after staining with ethidium bromide. Amplified PCR products of expected sizes were subjected to direct sequencing by an automatic sequence and dye-termination sequencing system (Macrogen Co., Seoul, Korea). A BLAST search for homogeneous sequences was conducted in the GenBank database at the National Center for Biotechnology Information website (www.ncbi.nlm.nih. gov/BLAST).

Real-time PCR assay

To investigate the amount of tetracycline-repressor (tet R) gene and tetracycline resistance [tet (B), tet (H), and tet (O)] gene mRNA under the condition of tetracycline in the medium, real-time PCR was performed. Prior to real-time PCR, the band of products was confirmed from the conventional PCR method. To test the tetracycline resistance gene mRNA, the RNA was extracted from bacteria-inoculated trypticase soy broth (TSB; Difco Laboratories Inc, Detroit, MI, USA), including 0.01 per cent β-nicotinamide adenine dinucleotide (NAD,

TABLE 1: Oligonucleotides used in this study Gene

Name

5′→3′ sequence

Reference

tet (A)

tetA-L tetA-R

GGCGGTCTTCTTCATCATGC CGGCAGGCAGAGCAAGTAGA

Lanz and others (2003)

tet (B)

tetB-L tetB-R

CATTAATAGGCGCATCGCTG TGAAGGTCATCGATAGCAGG

Lanz and others (2003)

tet (C)

tetC-L tetC-R

GCCGGAAGCGAGAAGAATCA GCTGTAGGCATAGGCTTGGT

Lanz and others (2003)

tet (D)

tetD-L tetD-R

ACACTGCTGGACGCGATG TCCGCACTCTGCTGTGTC

Matter and others (2007)

tet (E)

tetE-L tetE-R

GTGATGATGGCACTGGTCAT CTCTGCTGTACATCGCTCTT

Guardabassi and others (2000)

tet (G)

tetG-L tetG-R

TGATCGTGGGTCTTGACG TGCGAATGGTCTGCGTAG

Matter and others (2007)

tet (H)

tetH-L tetH-R

TTATACTGCTGATCACCG CATCCCAATAAGCGACGC

Matter and others (2007)

tet (K)

tetK-F tetK-R

TTATGGTGGTTGTAGCTAGAAA AAAGGGTTAGAAACTCTTGAAA

Koo and Woo (2011)

tet (L)

tetL-F tetL-R

GAACGTCTCATTACCTGATATTGC CAAACCCTGCTACTGTTCCAA

Koo and Woo (2011)

tet (M)

tetM-F tetM-R

GTRAYGAACTTTACCGAATC ATCGYAGAAGCGGRTCAC

Koo and Woo (2011)

tet (O)

tetO-F tetO-R

AACTTAGGCATTCTGGCTCAC TCCCACTGTTCCATATCGTCA

Koo and Woo (2011)

flo R

floF floR

GCGATATTCATTACTTTGGC TAGGATGAAGGTGAGGAATG

Faldynova and others (2003)

blaROB-1

rob-1F rob-1R

TGTTGCAATCGCTGCC TTATCGTACACTTTCCA

San Millan and others (2007)

tet R

tet R-F tet R-R

AACCCGTAAACTCGCCCAGAAGC TAAGGCGTCGAGCAAAGCCCG

This study

tet (B)

tet B_RT_F tet B_RT_R

CGCGTGAAGTGGTTCGGTTGG AGAAGGGGCAATGCGGTGAGA

This study

tet (H)

tet H_RT_F tet H_RT_R

GGCGCGGCACTCGACTATCT TACGGCACCTGTTGCGCCTG

This study

tet (O)

tet O_RT_F tet O_RT_R

TGCGAGCAGGGGCTGTATGGA GCAGCCGAAAGTCTGCGGGG

This study

16S rRNA

16S RNA_F 16S RNA_R

CGCTGGCGGCAGGCTTAACA GTCCGCCACTCGTCGGCAAA

This study

PBP3-S

PBP3S-S PBP3S-R PBP3BLN-S PBP3BLN-R

GATACTACGTCCTTTAAATTAAG GCAGTAAATGCCACATACTTA TTCAAGTAACCGTGGTGTGAC GCAGTAAATGCCACATATTTC

Hasegawa and others (2003)

PBP3-BLN

Veterinary Record | March 1, 2014

Hasegawa and others (2003)

Downloaded from http://veterinaryrecord.bmj.com/ on April 26, 2015 - Published by group.bmj.com

Paper Inc) with 0.01 per cent NAD including florfenicol (4 µg/ml) and tetracycline (4 µg/ml)/ampicillin (4 µg/ml). Transfer frequency was calculated as the number of transconjugants per recipient.

TABLE 2: D ​ istribution of serotypes according to year No. of strains Serotype APP 1 APP 2 APP 4 APP 5 APP 7 APP 8 Unidentified

2006

2007

2008

2009

2010

Total

1 3

2 3

4 1

1 3 2 11 1

15

15

1

1

12 4 2 13 2 1

16 15 4 58 4 1 4

2

2

Sigma-Aldrich, St Louis, MO, USA) and 4 µg/ml of tetracycline using RNeasy Mini Kit (Qiagen, Hilden, Germany). The RNA extracts were converted into first-strand cDNA using the QuantiTect Reverse Transcription Kit (Qiagen) according to the manufacturer’s instructions. The synthesised cDNA was stored at −20°C until further use. Quantitative real-time PCR was conducted using a RotorGene Q Detection System. The conditions consisted of holding at 95°C for five minutes, 35 cycles of step 1 at 95°C for 10 seconds and step 2 at 60°C for 45 seconds, and melting at 72–95°C. The 16S rRNA of A pleuropneumoniae was used as a housekeeping gene. The oligonucleotide sets for tet R, tet (B), tet (H), tet (O) and 16S rRNA of A pleuropneumoniae are described in Table 1. Following real-time PCR, the result was analysed by Rotor-Gene Q series software (Qiagen).

Bacterial conjugation

To investigate the transferability of tetracycline, florfenicol and β-lactam antibiotic resistance genes between intraspecies and interspecies, A pleuropneumoniae DCA 1630 which had florfenicol resistance gene (flo RR), DCA 2018 which had tetracycline resistance gene and β-lactam antibiotic resistance gene (tet (B)R / blaROB-1R) and Escherichia coli 612 which lacked a resistance gene (flo RS, tet (B)S/blaROB-1S) were prepared. E coli 612 is one of the isolates from porcine lung in Seoul National University. Broth cultures for conjugation were mixed as previously described (Kang and others 2005). Briefly, broth cultures of A pleuropneumoniae DCA 1630 and E coli 612, or DCA 2018 and E coli 612 with the same ratio were mixed and incubated without shaking at 37°C for 20 hours in TSB with 0.01 per cent NAD. After mating, the cultures were spread onto MacConkey agar, including florfenicol (4 µg/ml) or tetracycline (4 µg/ml)/ampicillin (4 µg/ml). The transconjugants which could grow in this media that would be E coli 612 with florfenicol or tetracycline/ampicillin resistance genes were picked after 20 hours and were used for detection of the resistance gene. For transferability of the resistance gene between intraspecies, broth cultures of A pleuropneumoniae DCA 1630 and DCA 2018 were used and the mix cultures were spread onto trypticase soy agar (TSA, Difco Laboratories

Pulsed field gel electrophoresis

To make a plug including bacterial DNA, organisms were grown overnight on chocolate agar at 37°C and suspended in 3 mL of cell suspension buffer [20 mM tris-HCl (pH 8), 20 mM NaCl, 50 mM EDTA and distilled water] to a turbidity of 4 McFarland. Each 2 ml bacterial suspension was spun down at 12 000 rpm for one minute, and the concentrated cells which were mixed with 200 µl plug agarose were poured into the moulds. After being washed with wash buffer [20 mM tris-HCl (pH 8), 50 mM EDTA and distilled water] and then digested with proteinase K solution overnight at 55°C, each genomic DNA was digested with AscI (New England Bio Labs Inc., Beverly, MA, USA) and ApaI (Takara Bio Inc., Otsu, Japan) for 18 hours. The enzymes best suited for this test through preliminary experiments and previous reports showing distinctive DNA patterns, 6–12 fragments ranging from 11 kb 50 1217 kb in A pleuropneumoniae strains (Chevallier and others 1998). These were separated on 1 per cent SeaKem Gold agarose (Lonza, Rockland, ME, USA) using CHEF MAPPER (Bio-Rad, Hercules, FL, USA). Electrophoresis conditions were 6 V/cm for 20 hours with an increasing pulse time of 8–40 seconds. Lambda ladder PFG marker (New England Bio Labs Inc) was used as a standard line, and the patterns of digested DNA were analysed using Gel Compar II (Kang and others 2005).

Results

Serotyping and antimicrobial resistance profile

Among the total of 102 A pleuropneumoniae isolates, 58 strains (56.9 per cent) belonged to serotype 5 predominantly, followed by serotype 1 (15.7 per cent), 2 (14.7 per cent), 4 (3.9 per cent), 7 (3.9 per cent), 8 (1 per cent) and 4 strains (3.9 per cent) were defined as unidentified. The distribution of serotype according to year was shown (Table 2). Strains susceptible to antibiotics did not grow in the range of susceptibility criteria, whereas strains resistant to antibiotics did. All of the tested A pleuropneumoniae isolates were perfectly susceptible to amoxicillin/clavulanic acid, cephalothin and ceftiofur, while the isolates were resistant to lincomycin and erythromycin (Table 3). Only a few strains showed efficiency to neomycin and kanamycin and half of all isolates were susceptible to gentamicin. The susceptibility to florfenicol decreased considerably by year from 2006 to 2010, as did that of a minor percentage of ampicillin and amoxicillin. The susceptibility to florfenicol, which in 2006 had been over 94 per cent, was significantly decreased to just over 50 per cent in 2010. In the case of ampicillin and amoxicillin, they were active against over 88 per cent of A pleuropneumoniae isolates in 2007, while only 65 per cent showed the susceptibility in 2010.

TABLE 3: Results of antimicrobial susceptibility test* and the resistance rates of 102 strains of Actinobacillus pleuropneumoniae against 16 antimicrobial agents Antimicrobial agents Ampicillin (10 µg/ml) Penicillin (10 µg/ml) Amoxicillin (10 µg/ml) Amoxicillin/clavulanic acid (30 µg/ml) Gentamicin (10 µg/ml) Neomycin (30 µg/ml) Kanamycin (30 µg/ml) Lincomycin (2 µg/ml) Tetracyline (30 µg/ml) Nalidixic acid (30 µg/ml) Enrofloxacin (5 µg/ml) Cephalothin (30 µg/ml) Ceftiofur (30 µg/ml) Florfenicol (30 µg/ml) Erythromycin (15 µg/ml) Sulfamethoxazole/ trimethoprim (25 µg/ml)

Susceptible isolates (n) 80 21 77 102 58 27 7 0 20 48 97 102 102 67 0 91

Intermediate isolates (n)

Resistant isolates (n)

Resistance rate (%)

15 34 19 0 19 39 32 102 19 49 0 0 0 32 93 7

21.57 79.41 24.51 0 43.14 73.53 93.13 100 80.39 52.96 4.9 0 0 34.31 100 10.78

7 47 6 0 25 36 63 0 63 5 5 0 0 3 9 4

*Antimicrobial susceptibility test was performed by disk diffusion test and CLSI regulated criteria CLSI, Clinical and Laboratory Standards Institute

March 1, 2014 | Veterinary Record

Downloaded from http://veterinaryrecord.bmj.com/ on April 26, 2015 - Published by group.bmj.com

Paper TABLE 4: Number of resistant antimicrobial agents and resistant isolates by year No. of resistant isolates No. of resistant antimicrobial agents 2 3 4 5 6 7 8 9 10 11 Total

2006

2007

2008

2009

2010

Total (%)

3 6 2 3 2

3 8 2

2 4 6 4 3

3 7 2 3 2 1

2 6 6 3 2 1 3 1 1 1 26

13 (12.8) 31 (30.4) 18 (17.6) 13 (12.7) 11 (10.8) 4 (3.9) 7 (6.9) 3 (2.9) 1 (1) 1 (1) 102 (100)

3

19

2 2

1

17

2

20

Analysis of the number of resistant strains and the number of resistant antibiotic agents showed that both had increased up to 2010, and more than half of the A pleuropneumoniae isolates showed resistance to more than three antibiotics. Moreover, multidrug-resistant strains with resistance against more than two antibiotics had been increasing year by year, and a strain resistant to 11 antimicrobial drugs out of 16 antibiotic agents was discovered in the cultures of 2010 (Table 4). As a result of PCR, 79 strains (77 per cent) out of all the isolates harboured tet (B), tet (H) or tet (O) among 11 tetracycline resistance genes. tet (B) was predominant (n=63), followed by tet (H) (n=12) and tet (O) (n=8) and four strains had two kinds of tetracycline resistance genes. Three of them had tet (B) and tet (O) genes, and the other had tet (H) and tet (O) genes. Strains defined as susceptible against tetracycline (n=19) by disk diffusion test tested negative for all tetracycline resistance genes, while all the strains with intermediate susceptibility (n=64) to tetracycline appeared to have the resistance genes. The florfenicol resistance (flo R) gene was detected in 35 strains (34 per cent) in accordance with the disk diffusion test and β-lactam antibiotic resistance gene (blaROB-1) was detected in 15 strains (15 per cent) of all isolates. Interestingly, neither blaROB-1 nor blaTEM-1 could be detected in some strains with ampicillin-resistant phenotype. The distribution of MIC values for the A pleuropneumoniae isolates having tetracycline resistance genes, florfenicol resistance genes or β-lactam antibiotic resistance gene are shown in Table 5. All tetracycline-resistant strains displayed MIC values over the level of breakpoints (8 µg/ml) in accordance with CLSI guidelines. In the case of florfenicol-resistant strains, the MIC of one strain was shown under the breakpoint (8 µg/ml), but the other strains were spread between 8 and 32 µg/ml. The MICs of ampicillin-resistant strains were between 8 and 512 µg/ml and all strains in this experiment showed susceptibility to second and third generation cephalosporins (cefoxitin and cefotaxim, respectively), and to the amoxicillin/clavulanic acid.

20

ance genes were evaluated under the condition of tetracycline and the average expression levels of tet (B), (H) and (O) genes to MIC values were compared. The amount of tet R was not in accordance with the activity of resistance, but the expression levels of the tetracycline resistance genes of tet (B) and (O) slightly correlated with MIC values; however, this was not the case for the tet (H) gene.

Transfer of resistance gene

Florfenicol resistance and tetracycline/β-lactam antibiotics resistance were transformed from A pleuropneumoniae to E coli with 5.7×10−3 and 3.5×10−2, respectively. The transconjugants, E coli, harbouring antibiotic resistance genes derived from A pleuropneumoniae were observed on MacConkey agar including antibiotics. Gene transfer was confirmed by detecting the flo R and tet (B)/blaROB-1 genes in transconjugants (Fig 2). However, transfer of resistance genes within species was not observed.

Pulsed field gel electrophoresis

To compare the digested chromosome patterns of tetracycline-resistant strains, the relative position of each DNA fragment was determined from double restriction digests. Cleaving with AscI and ApaI caused six to 16 segments to appear on the gel, and the bands were analysed based on their serotypes, tet gene, isolated location and year (Fig 3). A high degree of similarity was observed among serotypes regardless of differences in isolated origin and year. With time, new combinations of serotype and tet gene appeared.

Discussion

In this study, the distribution of serotype and antimicrobial susceptibility to 16 antibiotic agents of A pleuropneumoniae isolates collected from pigs suspected of infection in Korea between 2006 and 2010 was investigated and the genotypes related to resistance were surveyed. Distribution of serotypes of A pleuropneumoniae varies by region and with time. Serotypes 9 and 2 were the most prevalent in the Czech Republic (Kucerova and others 2011), and serotypes 2 and 4 were dominant in Spain (Gutierrez-Martin and others 2006). In Korea, changes in serotype appeared over the course of the years studied. While it

Relatedness of MIC values to resistance gene expression and biofilm formation

The relative concentration of tet R gene with its MIC values is shown in Fig 1. In the same way, the expression levels of tetracycline resist-

TABLE 5: Distribution of MIC values* and their antimicrobial resistance gene MIC (mg/L) Antibiotics

Resistance genes

Serotypes and antimicrobial resistance patterns of the recent Korean Actinobacillus pleuropneumoniae isolates.

Serotypes and antimicrobial resistance patterns of the recent Korean Actinobacillus pleuropneumoniae isolates. - PDF Download Free
2MB Sizes 0 Downloads 2 Views