Article pubs.acs.org/ac
Signal-On Dual-Potential Electrochemiluminescence Based on Luminol−Gold Bifunctional Nanoparticles for Telomerase Detection Huai-Rong Zhang, Mei-Sheng Wu, Jing-Juan Xu,* and Hong-Yuan Chen State Key Laboratory of Analytical Chemistry for Life Science, School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210093, China ABSTRACT: Here, we report a novel type of signal-on dualpotential electrochemiluminescence (ECL) approach for telomerase detection based on bifunctionalized luminol−gold nanoparticles (L−Au NPs). In this approach, CdS nanocrystals (NCs) were first coated on glassy carbon electrode, and then thiol-modified telomerase primer was attached on CdS NCs via Cd−S bond. In the presence of telomerase and dNTPs, the primer could be extended. Telomerase primer would hybridize with its complementary DNA, and the extended part would hybridize with the capture DNA which was tagged with L−Au NPs. In the presence of coreactant H2O2, the L−Au NPs could not only enhance the ECL intensity of CdS NCs at −1.25 V (vs SCE) induced by the surface plasmon resonance (SPR) of Au NPs but also produce a new ECL signal at +0.45 V (vs SCE) that resulted from luminol in L−Au NPs. Both signals at two potentials increased with the increase of telomerase concentration. This method could be used to detect the telomerase from 100 to 9000 HL-60 cells and investigate the apoptosis of tumor cells. The ratio of the two signal increments (ΔECLLuminol/ ΔECLCdS NCs), which showed a high consistency value for different numbers of cells, could be used to verify the reliability of tests. This dual-potential ECL strategy showed great promise in avoiding false positive or negative results in bioanalysis.
T
to generate interest in bioassays.13 Previous studies showed that electrodes modified with metal nanoparticles (NPs) such as Au or Pt could enhance the ECL emission of luminol by 2−3 orders compared to the original bare electrodes.14,15 Cui and co-workers have developed a novel ECL immunosensor using luminol-functionalized Au NPs as both labels and ECL reagents for biomolecular detection.16,17 The enhancement of ECL is caused by the increase of the active electrode area as well as the catalytic effect of metal NPs on luminol oxidation. ECL biosensors based on semiconductor nanocrystals (NCs) have been paid more attention in recent years.18 Mechanistic studies of semiconductor nanocrystals (NCs) are the foundation of the application, and a number of studies have been done in the ECL mechanism.19−21 Due to the unique electronic and optical properties, together with the different preparation methods available with controlled sizes and shapes, semiconductor NCs provide tunable emission wavelength and excellent quantum yield for ECL devices. Considerable works have been done in ECL resonance energy transfer (RET) because it is easier for NCs emitters to find a suitable pair of donor−acceptor than traditional ECL emitters. Xu and coworkers first demonstrated that the ECL from manganesedoped CdS NCs could be quenched by proximal Au NPs, whereby enhanced at relatively long distance because of
elomeres are critical elements of eukaryotic chromosomes which protect the termini of linear chromosomes from fusion and degradation.1,2 Telomeres are shortened during the cell life cycle, and the cell may die if telomeres get too short. Telomerase is an enzyme which can elongate telomere ends and is thought to be responsible for the continuous and uncontrolled growth of cancer cells.3 Recent studies have revealed that an elevated amount of telomerase can be observed in various malignant or cancerous cells.4 Therefore, the telomerase activity could be considered as an important biomarker for early diagnosis, prognosis, and understanding the pathogenesis of disease. So far, several analytical approaches have been developed for telomerase activity analysis, including enzyme immunoassay, fluorescent assay, and electrochemical assay.5−10 However, most of them either time-consuming or require the use of harmful radioactive and expensive fluorescent substances. More importantly, these approaches are single signal detection which may cause false-positive or false-negative results, especially in complex biological matrix, such as cell and blood. Therefore, a dual-signal approach requiring simple instrumentation yet providing high sensitivity for monitoring telomerase activity is expected. Electrochemiluminescence (ECL), as a highly sensitive technique and has attracted considerable attention in pharmaceutical analysis, clinical diagnosis, environment and food analysis, and immunoassay as well as DNA detection.11,12 There are lots of ECL-active species that have been studied. For example, luminol is a classic organic ECL species that continues © 2014 American Chemical Society
Received: December 5, 2013 Accepted: March 19, 2014 Published: March 19, 2014 3834
dx.doi.org/10.1021/ac403960g | Anal. Chem. 2014, 86, 3834−3840
Analytical Chemistry
Article
Table 1. DNA Sequence Used in This Work name
sequences (5′ to 3′)
telomerase primer complementary DNA capture DNA
5′-SH−(CH2)6−TTTTTTAATCCGTCGAGCAGAGTT GGCACAAACATGCACCTCAAAAAA 5′-SH−(CH2)6−TAACCCTAACCC
(TCEP), and luminol were purchased from Sigma-Aldrich (St. Louis, MO) and used without further purification. A 0.1 M Tris−HCl buffer was employed for preparation of ECL detection solutions. Tris−HCl buffer (0.1 M) containing 0.1 M NaCl and 5 mM MgCl2 (pH 7.4) was employed for preparation of DNA stock solutions. A 0.1 M PBS (pH 7.4) buffer containing K2HPO4 and KH2PO4 was used to wash cancer cells. All other reagents were of analytical grade and used as received. All the water used in the work was RNase-free. Preparation of Telomerase Primer Modified CdS NCs on GCE. CdS NCs and CdS NCs modified GCEs were prepared according to our previous work.35 Briefly, Cd(NO3)2· 4H2O (0.1683 g) was dissolved in 30 mL of ultrapure water and heated to 70 °C under stirring; then, the mixture was injected into a freshly prepared solution of Na2S (0.5960 g) in 30 mL of ultrapure water. Instantly, orange-yellow solution was obtained. The solution was held at 70 °C for 3 h with continuous refluxing and stirring. The final reaction precipitates were centrifuged and washed thoroughly with absolute ethanol and ultrapure water two times. Then, the obtained precipitate was redispersed into water for centrifugation to collect the upper yellow solution of CdS NCs. The average size of synthesized CdS NCs was about 5 nm. After that, 10 μL of CdS solution was drop-cast on the pretreated GCE (GCE, 3 mm diameter) and then air-dried at room temperature to get the CdS film modified GCE electrode. The modified GCE electrode was stored in Tris−HCl buffer (pH 7.4) for further modification. The solution of 1 × 10−5 M (100 μL) telomerase primer was pretreated by 2 μL of TCEP, and then the CdS NCs modified GCE was immersed in the telomerase primer (10 μL) solution for 24 h at 4 °C in order to ensure the fastness of the Cd−S bond. The obtained electrode was rinsed with 0.1 M Tris−HCl buffer to remove the unspecified telomerase primer. Preparation of L−Au NPs and Capture DNA−L−Au NPs. All glasses used in the synthesis were immersed in freshly prepared aqua regia (HNO3/HCl = 1:3) for 12 h, then washed with ultrapure water and dried before use. To prepare L−Au NPs, 4 mL of ice-cold 0.01 M luminol solution and 0.6 mL of ice-cold 0.1 M NaBH4 were added to 20 mL of aqueous solution containing 2.5 × 10−4 M HAuCl4 under stirring and kept stirring in an ice bath for 10 min. The solution immediately turned to deep purple-red color, indicating the formation of Au NPs. Then, the solution was kept stirring at room temperature for another 6 h to prepare colloid L−Au NPs. An amount of 100 μL of 1 × 10−4 M of capture DNA was pretreated by 4 μL of TCEP for 1 h, and then 1 mL of the asprepared colloid L−Au NPs was added into it. The mixed solution was stirred at room temperature for 6 h and then kept for 24 h at 4 °C in order to ensure the fastness of the Au−S bond. Cell Culture and Telomerase Extract Preparation. HL60 cells were cultured in DMEM medium supplemented with 10% fetal calf serum, and the cells were maintained at 37 °C in a humidified atmosphere (95% air and 5% CO2). Cells were collected in the exponential phase of growth and washed twice with ice-cold sterile PBS; then 105 cells were resuspended in
plasmon coupling, providing that the ECL spectrum of NCs overlapped with the absorption profile of Au NPs. Exploring such ECL energy transfer platform for DNA analysis allowed ultrasensitive DNA detection. Since this research, NCs-based ECL energy transfer assays for DNA detection,22−24 cytosensing,25,26 aptamer,27−30 and immunoassay31,32 have been further explored. However, most of the ECL approaches in the previous studies are single signal response, which means that there is a single ECL signal for one kind of target. This kind of assay could be affected by the environment easily and could not exclude the error signals caused by other interferences, especially in complex biological matrix, such as cell and blood. Inspired by the dual-wavelength fluorescence ratiometric method which could reduce the influence from the environmental change, recently we first provided an ECL ratiometric sensing approach.14 In this primary research, due to the natural large absorption cross section and catalytic ability of Pt NPs, ECL quenching of CdS NCs and ECL enhancement of luminol could be induced in one potential scan, resulting in a novel dual-potential ECL ratiometric sensing approach for the mp53 oncogene detection. However, in that work the target analyte needs to be functionalized with ECL reagent before use, which is not conductive to detect real samples. Here we designed a novel signal-on dual-potential ECL detection approach to detect telomerase activity from cancer cells. Telomerase primer was attached on CdS NCs which could be extended in the presence of telomerase and dNTPs. The extended part was then hybridized with luminol−gold nanoparticles (L−Au NPs) labeled capture DNA, resulting in an enhanced ECL intensity of CdS NCs at −1.25 V (vs SCE) by surface plasmon resonance (SPR) and a new ECL signal at +0.45 V (vs SCE) from luminol. This signal-on dual-potential detection approach could detect the activity of telomerase extracted from HL-60 cells in the range of 100−9000. Unlike the ECL ratiometric sensing approach,14,33,34 in which the ratio of ECL intensities at two excitation potentials could be used to sensitively detect the concentration of target DNA, in this work the ratio of ECL increments of both CdS NCs and luminol showed a constant value and could be used to judge the reliability of the detection results and avoid the false positive or negative, providing a great promise in clinical diagnosis.
■
EXPERIMENTAL SECTION
The deoxynucleotide solution mixture (dNTPs) was purchased from TaKaRa Bio Inc. (Da lian, China ). 3-[(3Cholamidopropyl)dimethylammonio]-1-propanesulfonic acid (CHAPS), phenylmethylsulfonyl fluoride (PMSF), ethylene glycol bis(aminoethyl ether)-N,N,N,N tetraacetic acid (EGTA), glycerol, and Tween 20 were purchased from Biosharp Biotechnology. Oligonucleotides of telomerase primer, complementary DNA, and capture DNA were purchased from Sangon Biotech Co. Ltd. (Shanghai, China), and the sequences are listed in Table 1. Epigallocatechin-3-gallate (EGCG), bovine serum albumin (BSA), tri(2-carboxyethyl)phosphine hydrochloride 3835
dx.doi.org/10.1021/ac403960g | Anal. Chem. 2014, 86, 3834−3840
Analytical Chemistry
Article
NPs is about 5 ± 1 nm which was similar with Au NPs. Figure 1B shows the results of energy-dispersive X-ray (EDX) analysis. The presence of C (26 eV), N (50 eV), O (94 eV), and Au (970 eV) elements verified the existence of luminol molecules in L−Au NPs. An obvious N peak can be observed in L−Au NPs while it cannot be observed in Au NPs (inset of Figure 1B). Besides, a significant increase in the EDX peak of C element in L−Au NPs was clearly detected. Both of them were ascribed to luminol molecules in L−Au NPs. These results were further confirmed by UV−vis spectra of Au NPs and L−Au NPs. As shown in Figure 1C, compared with the spectrum of Au NPs (curve a), L−Au NPs (curve c) exhibited a new absorption band at 250−400 nm which was attributed to luminol molecule (curve b). Earlier studies have demonstrated that the ECL intensity of luminol could be enhanced on a Au NPs self-assembled electrode compared with that on a bare Au electrode by virtue of its large surface area and superior catalysis effect.15,36 Here, Au NPs were also served as carriers for luminol molecules to introduce a large amount of ECL emitter on the electrode surface and as catalysts to catalyze the oxidation of luminol. To obtain an optimal ECL emitter, we optimized the volume of luminol in preparation of L−Au NPs. All of the L−Au NPs (curves a−d) displayed an obvious ECL signal at 0.45 V in the presence of H2O2 due to the production of reactive oxygen species (ROSs) which accelerated the formation of excited state. The corresponding ECL processes are shown as follows:37
200 μL of ice-cold CHAPS lysis buffer (10 mM Tris−HCl, pH 7.5, 1 mM MgCl2, 1 mM EGTA, 0.1 mM PMSF, 5 mM mercaptoethanol, 0.5% CHAPS, 10% glycerol). The lysate was incubated for 30 min on ice and centrifuged for 20 min at 14 000 rpm in 4 °C to pellet insoluble material. Then the cleaned lysate was carefully transferred to a 1.5 mL EP tube. The lysate was used immediately for telomerase assay or frozen at −80 °C. For apoptosis assay, HL-60 cells were treated with different concentrations of EGCG and cultured in 12-well plates for 48 h, and then dyed with acridine orange (AO) and ethidium bromide (EB) to show the activity of cancer cells. The telomerase was extracted from EGCG-treated HL-60 cells at the same way. Telomerase Extension Reaction and ECL Detection of Telomerase Activity. The telomerase primer modified glassy carbon electrode was immersed into 100 μL of telomerase reaction solution which contained 5 μL of telomerase extracts and 95 μL of telomerase reaction buffer (20 mM Tris−HCl buffer, pH 8.3, 1.5 mM MgCl2, 0.63 mM KCl, 0.05% Tween 20, 1 mM EGTA, 0.1 mM dNTPs) at 37 °C for 1 h. For control experiments, telomerase extracts were pretreated at 95 °C for 20 min. Then the electrode was incubated with complementary DNA and capture DNA−L−Au NPs sequentially. After that, the electrode was washed thoroughly with 0.1 M Tris−HCl buffer and immersed in 0.1 M Tris−HCl buffer (5.0 mL; pH 7.4) containing 16 mM H2O2 solution for ECL detection. The voltage of the photomultiplier tube (PMT) was set at 500 V, and the potential range was set from 0.6 to −1.3 V.
■
RESULTS AND DISCUSSION Response Mechanism of the Dual-Potential ECL Aptasensor. Scheme 1 shows the principle of the dualScheme 1. Schematic Representation of Dual-Potential ECL for Telomerase Detection System
Besides, it should be noted that the ECL intensity was enhanced with the increase of luminol volume added in the synthesis process, resulting from the large number of luminol molecules labeled on Au NPs (Figure 1D). However, the TEM image in the inset of Figure 1D demonstrates that the diameters of L−Au NPs synthesized with high luminol volume (5 mL) were nonuniform. Therefore, L−Au NPs synthesized with 4 mL of luminol solution were chosen for the further experiments. Then we investigated the ECL performance of another ECL emitter, namely, CdS NCs. The ECL−potential curve of CdS NCs modified GCE is shown in Figure 2A (curve a). It displays an ECL peak at −1.25 V (SCE). The cathodic ECL was produced upon concomitant reduction of CdS NCs and H2O2, CdS NCs were reduced to nanocrystal species (CdS−•) by charge injection upon the potential scan with an initial negative direction, while the coreactant H2O2 was reduced to the strong oxidant ·OH; after that, CdS NCs were reacted with ·OH or H2O2 to emit light in the aqueous solution. The corresponding ECL processes are as follows:38
potential ECL aptasensor protocol. CdS NCs were used as one of the ECL emitters which generated a weak ECL signal in the presence of coreactant H2O2 at negative potential. Then thiolmodified telomerase primer was attached on the CdS NCs surface. After the extension of primer with telomerase and dNTPs, telomerase primer was hybridized with its complementary DNA and the extended part was hybridized with the capture DNA−L−Au NPs. Due to the SPR and the superior catalytic effect of Au NPs, it not only enhanced the ECL intensity of CdS NCs but also produced a new ECL signal at positive potential. Figure 1A and inset show the transmission electron microscopy (TEM) images of the as-prepared L−Au NPs and Au NPs. We can see that the average particle size of L−Au
CdS NCs + ne− → nCdS•− 3836
(5)
dx.doi.org/10.1021/ac403960g | Anal. Chem. 2014, 86, 3834−3840
Analytical Chemistry
Article
Figure 1. (A) TEM image of L−Au NPs. Inset is the TEM image of Au NPs. (B) The EDX of L−Au NPs. Inset: the EDX of Au NPs. (C) The UV− vis absorption spectra of (a) Au NPs, (b) luminol, (c) L−Au NPs. Inset: the magnified UV−vis spectra. (D) Cyclic ECL curves of L−Au NPs modified GCEs. L−Au NPs were synthesized with different volumes of luminol: (a) 2, (b) 3, (c) 4, and (d) 5 mL. Inset is the TEM image of L−Au NPs which were synthesized with 5 mL of luminol solution. The detection was performed in 0.1 M Tris−HCl buffer (pH 7.4) containing 16 mM H2O2. Scan rate: 100 mV/s. Scan range: 0−0.6 V.
Figure 2. (A) Cyclic ECL curves of the electrode modified with process a in Scheme 1a and further modified with process b in Scheme 1b with telomerase extracted from 9000 HL-60 cells; (c) cyclic ECL curves of L−Au NPs modified electrode. Scan direction: 0 V → 0.6 V → −1.3 V → 0 V. Scan rate: 100 mV/s. Inset: the ECL spectra of CdS NCs. (B) The dependence of ECL intensity of CdS NCs on H2O2 concentration. The detection was performed in 0.1 M Tris−HCl buffer (pH 7.4). Scan rate: 100 mV/s. Scan range: −1.3 to 0 V. (C) ECL signal−time curves of CdS NCs. (D) ECL signal−time curve of L−Au NPs (lower one) on CdS NCs (higher one) interface after treating with telomerase extracted from 9000 HL-60 cells. The detection was performed in 0.1 M Tris−HCl buffer (pH 7.4) containing 16 mM H2O2. Scan direction: 0 V → 0.6 V → −1.3 V → 0 V. Scan rate: 100 mV/s. Scan range: −1.3 to 0.6 V.
H 2O2 + 2e− → ·OH + OH−
2CdS•− + 2·OH → 2CdS* + H 2O2
(6)
3837
(7)
dx.doi.org/10.1021/ac403960g | Anal. Chem. 2014, 86, 3834−3840
Analytical Chemistry
Article
Figure 3. (A) ECL signal−time curves at the dual-potential ECL sensing interface with telomerase extracted from different numbers of HL-60 cells: 0, 100, 1000, 3000, 5000, 7000, and 9000 from a to g, respectively. The first signal was induced by luminol, and the second was induced by CdS NCs. (B) Dependence of ΔECL intensity of CdS NCs (a) and luminol (b) on the number of HL-60 cells. Inset: linear relationship between ΔECL intensity of CdS NCs (a) or luminol (b) and the number of HL-60 cells. All the detection was performed in 0.1 M Tris−HCl buffer (pH 7.4) containing 16 mM H2O2. Scan rate: 100 mV/s. Scan range: −1.3 to 0.6 V.
Figure 4. (A) Relationship between ΔECLLuminol/ΔECLCdS NCs and telomerase extracted from different numbers of HL-60 cells: 30, 60, 100, 1000, 3000, 5000, 7000, 9000, 11 000, and 13 000. Inset: the relationship between ΔECLLuminol/ΔECLCdS NCs and telomerase extracted from 0, 10, 30, 70, 90, 150, and 200 mg/L EGCG-treated HL-60 cells. (B) ECL signal changes of CdS NCs and luminol after treating with telomerase extracted from 9000 HL-60 cells, heated telomerase from 9000 HL-60 cells, and without telomerase.
CdS* → CdS NCs + hv
(8)
2CdS•− + H 2O2 → 2CdS* + 2OH−
(9)
Au NPs complexes with the extended part of telomerase primer, Au NPs and the CdS NCs were separated by at least 36 complementary base pairs (0.34 nm per base pair). As can be seen in Figure 2A, the ECL intensity of CdS NCs (curve b, −1.25 V) was more than 4-fold higher than that before hybridization (curve a). This was attributed to the excitation of Au NPs SPR by the ECL emitting which can create strong local electric fields that in turn modulate the ECL response of the CdS NCs. Beside, a new ECL peak at 0.45 V could be observed due to the oxidation of luminol on the electrode surface, confirming the validation of the approach for telomerase detection. Both of these ECL signals were proved to be stable and strong enough (Figure 2D). Detection of Telomerase Activity in HL-60 Cells. The contents of telomerase in the cell lysate samples were subsequently detected by the proposed approach to validate the sensitivity of this strategy. Cell extracts were serially diluted with lysis buffer before reacting with TS primers. Figure 3A is the ECL signal−time curves which show the relationship between the ECL intensity and the number of cells from 0 to 9000. As shown in Figure 3B, the ΔECL intensity of luminol and CdS NCs were both increased with the increase of cell numbers in the range from 30 to 13 000. From the inset of
or
CdS* → CdS NCs + hv
(10)
The ECL intensity of CdS NCs increased with the increasing concentration of H2O2 and then reached an approximate plateau above 16 mM (Figure 2B). Thus, the following experiments were performed in 0.1 M Tris−HCl buffer (pH 7.4) containing 16 mM H2O2. In addition, ECL measurements of the CdS NCs upon continuous cyclic scans showed constant signals with an excellent stability (Figure 2C). Previous studies have been reported that Au NPs could enhance the ECL signal of CdS NCs.23 This enhancement was influenced by spectra overlap and separation distance between them. The inset in Figure 2A illustrates that the ECL spectrum of CdS NCs overlapped well with the SPR absorption of Au NPs (inset in Figure 1C, curve c). Besides, the distance between CdS NCs and Au NPs was effectively controlled by the length of complementary DNA. After the hybridization of complementary DNA with telomerase primer on the CdS NCs/GCE surface and the hybridization of capture DNA−L− 3838
dx.doi.org/10.1021/ac403960g | Anal. Chem. 2014, 86, 3834−3840
Analytical Chemistry
Article
Figure 5. Fluorescence images of 0 (A), 10 (B), 30 (C), 70 (D), 90 (E), 150 (F), and 200 (G) mg/L EGCG-treated HL-60 cells after staining with AO/EB. (H) ECL signal−time curves at the dual-potential ECL sensing interface with heated telomerase (a) and with telomerase from 200, 150, 90, 70, 30, 10, 0 mg/L EGCG-treated HL-60 cells from b to g, respectively. The number of HL-60 cells was 5000. All of the detection was performed in 0.1 M Tris−HCl buffer (pH 7.4) containing 16 mM H2O2. Scan rate: 100 mV/s. Scan range: −1.3 to 0.6 V.
Figure 3B, it can be observed that both ΔECL intensities of CdS NCs (curve a, R = 0.982) and luminol (curve b, R = 0.985) were linearly proportional to the HL-60 cell numbers in the range of 100−9000 with a detection limit of 83 and 62 cells at the S/N ratio of 3, respectively. Therefore, the sensitivity of the assay was comparable sensitive with those of reported approaches.39,40 To assess the accuracy of this strategy, the ratio of the two signal increments (ΔECLLuminol/ΔECLCdS NCs) was plotted versus cell numbers, and the results are displayed in Figure 4A. The ratio maintained a constant value of ca. 0.62 when the cell numbers were from 100 to 9000. However, further addition of cells led to an increase of the ratio because of the increasing concentration of telomerase used for primer extension. It increased the length of extended primers which enabled the hybridization of multilayer capture DNA on the electrode surface and enlarged the distance between L−Au NPs and CdS NCs/GCE. As we all know, the emission of CdS NCs was sensitively enhanced by the surface plasmon absorption of Au NPs in a distance-dependent manner.30 Hence, the increment of CdS NCs ECL intensity decreased significantly (Figure 3B, curve a). On the other hand, the increment of luminol ECL also increased slowly due to the increasing distance between multilayer L−Au NPs and GCE (Figure 3B, curve b). Besides, the ratio was also higher than 0.62 when cell numbers were lower than 100. This result may caused by the false-positive signal in sensing low concentration of target. Although the sensitivity of the assay was less sensitive than those of recently reported studies,41,42 the designed dual-potential ECL aptasensor can effectively reduce the false-positive signal and improve the accuracy. Figure 4B shows a set of control experiments that were performed in the presence of telomerase, heated telomerase, and in the absence of telomerase. Both of the ECL signals of luminol and CdS NCs were slightly increased in the presence of heated telomerase and in the absence of telomerase, while it exhibited an obvious increment with telomerase, indicating an excellent specificity and efficiency of this approach. Monitoring Telomerase Expression on Cancer Cells in Response to EGCG. The high sensitivity and accuracy of this
biosensor allowed us to further assess the dynamic alteration of telomerase in response to drugs. Epigallocatechin-3-gallate (EGCG), which has been reported to induce the apoptosis of cancer cell lines, can reduce the telomerase activity in cancer cells.43,44 Figure 5 shows fluorescence images of HL-60 cells after treating with different EGCG concentrations for 48 h and then staining with AO/EB (living cells, green; dead cells, red). HL-60 cells exhibited an obvious abnormal morphology after incubating with high concentration of EGCG. Moreover, the color of the culture media (inset of Figure 5) changed to purple due to the decreasing number of living cells, which also confirmed the apoptosis of cancer cell. The corresponding changes in ECL signal are shown in Figure 5H. It could be seen that the ECL signals of CdS NCs and luminol were reduced with the increasing concentration of EGCG from 0 to 200 mg/ L, indicating the decreased activity of telomerase. For comparison, ΔECLLuminol/ΔECLCdS NCs was plotted versus EGCG concentration, and the results are shown in the inset of Figure 4A. The ratio was the same for EGCG-treated HL-60 cells and HL-60 cells when the amount of EGCG was lower than 90 mg/L. These results suggested the reliability of this platform for early diagnosis and prognosis prediction.
■
CONCLUSIONS
In this paper, a dual-potential ECL method for sensitive detection of human telomerase extracted from HL-60 cells was proposed by employing L−Au NPs and telomerase elongation reaction. Results demonstrated that the ECL signal change was consistent with the alternation of active telomerase in HL-60 cells. In this study, ΔECLLuminol/ΔECLCdS NCs was used to judge the accuracy of telomerase detection in order to effectively reduce the false-positive signal and improve the accuracy. With the use of this dual-potential system, HL-60 cells could be specifically detected at a concentration down to 100 cells. Furthermore, this strategy was successfully applied to investigate the apoptosis of HL-60 cells after treating with EGCG. This method is promising for detecting target analytes in a complicated environment. 3839
dx.doi.org/10.1021/ac403960g | Anal. Chem. 2014, 86, 3834−3840
Analytical Chemistry
■
Article
(33) Takeuchi, M.; Nagaoka, Y.; Yamada, T.; Takakura, H.; Ozawa, T. Anal. Chem. 2010, 82, 9306. (34) Branchini, B. R.; Rosenberg, J. C.; Ablamsky, D. M.; Taylor, K. P.; Southworth, T. L.; Linder, S. J. Anal. Biochem. 2011, 414, 239. (35) Shan, Y.; Xu, J.-J.; Chen, H.-Y. Chem. Commun. 2009, 8, 905. (36) Chai, Y.; Tian, D.; Wang, W.; Cui, H. Chem. Commun. 2010, 46, 7560. (37) Chu, H.-H.; Guo, W.-Y.; Di, J.-W.; Wu, W.; Tu, Y.-F. Electroanalysis 2009, 21, 1630. (38) Deng, L.; Shan, Y.; Xu, J.-J.; Chen, H.-Y. Nanoscale 2012, 4, 831. (39) Pavlov, V.; Xiao, Y.; Gill, R.; Dishon, A.; Kotler, M.; Willner, I. Anal. Chem. 2004, 76, 2152. (40) Xiao, Y.; Pavlov, V.; Niazov, T.; Dishon, A.; Kotler, M.; Willner, I. J. Am. Chem. Soc. 2004, 126, 7430. (41) Zhou, X.-M.; Da, X.; Zhu, D.-B.; Li, J. Anal. Chem. 2009, 81, 255. (42) Wu, L.; Wang, J.-S.; Feng, L.-Y.; Ren, J.-S.; Wei, W.-L.; Qu, X.G. Adv. Mater. 2012, 24, 2447. (43) Sen, T.; Chatterjee, A. Eur. J. Nutr. 2011, 50, 465. (44) Punathil, T.; Tollefsbol, T.-O.; Katiyar, S.-K. Biochem. Biophys. Res. Commun. 2008, 375, 162.
AUTHOR INFORMATION
Corresponding Author
*E-mail: [email protected]. Phone and Fax: +86-25-83597294. Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS This work was supported by the 973 Program (2012CB932600, 2013CB933800), the National Natural Science Foundation (Nos. 21025522, 21135003, and 21327902), and the National Natural Science Funds for Creative Research Groups (21121091) of China.
■
REFERENCES
(1) Blackburn, E. H.; Greider, C. W.; Szostak, J. W. Nat. Med. 2006, 12, 1133. (2) Ju, Z.; Rudolph, K. L. Eur. J. Cancer 2006, 42, 1197. (3) Chan, S. W.-L.; Blackburn, E. H. Oncogene 2002, 21, 553. (4) Zendehrokh, N.; Dejmek, A. Mod. Pathol. 2005, 18, 189. (5) Lança, V.; Zee, R. Y. L.; Rivera, A.; Romero, J. R. Clin. Chem. Lab. Med. 2009, 47, 870. (6) McGruder, B.-M.; Atha, D.-H.; Wang, W.; Huppi, K.; Wei, W.-Q.; Abnet, C.-C.; Qiao, Y.-L.; Dawsey, S.-M.; Taylor, P.-R.; Jakupciak, J.-P. Cancer Lett. 2006, 244, 91. (7) Pech, M. F.; Artandi, S. E. EMBO J. 2011, 30, 986. (8) Reed, J.; Gunaratnam, M.; Beltran, M.; Reszka, A. P.; Vilar, R.; Neidle, S. Anal. Biochem. 2008, 380, 99. (9) Savoysky, E.; Akamatsu, K.; Tsuchiya, M.; Yamazaki, T. Nucleic Acids Res. 1996, 24, 1175. (10) Liu, J.; Lu, C.-Y.; Zhou, H.; Xu, J.-J.; Wang, Z.-H.; Chen, H.-Y. Chem. Commun. 2013, 49, 6602. (11) Richter, M. M. Structure 2004, 104, 3003. (12) Miao, W. Chem. Rev. 2008, 108, 2506. (13) Ma, G.; Zhou, J.; Tian, C.; Jiang, D.; Fang, D.; Chen, H. Anal. Chem. 2013, 85, 3912. (14) Zhang, H.-R.; Xu, J.-J.; Chen, H.-Y. Anal. Chem. 2013, 85, 5321. (15) Cui, H.; Wang, W.; Duan, C.-F.; Dong, Y.-P.; Guo, J.-Z. Chem.Eur. J. 2007, 13, 6975. (16) Tian, D.-Y.; Duan, C.-F.; Wang, W.; Cui, H. Biosens. Bioelectron. 2010, 25, 2290. (17) Fang, L.; Cui, H. Biosens. Bioelectron. 2013, 39, 261. (18) Huang, H.; Li, J.; Zhu, J.-J. Anal. Methods 2011, 3, 33. (19) Cheng, L.; Liu, X.; Lei, J.; Ju, H. Anal. Chem. 2010, 82, 3359. (20) Wang, Y.; Lu, J.; Tang, L.; Chang, H.; Li, J. Anal. Chem. 2009, 81, 9710. (21) Zheng, L.; Chi, Y.; Dong, Y.; Lin, J.; Wang, B. J. Am. Chem. Soc. 2009, 131, 4564. (22) Zhou, H.; Zhang, Y.-Y.; Liu, J.; Xu, J.-J.; Chen, H.-Y. J. Phys. Chem. C 2012, 116, 17773. (23) Zhou, H.; Zhang, Y.-Y.; Liu, J.; Xu, J.-J.; Chen, H.-Y. Chem. Commun. 2013, 49, 2246. (24) Zhou, H.; Liu, J.; Xu, J.-J.; Chen, H.-Y. Chem. Commun. 2011, 47, 8358. (25) Wu, M.-S.; Shi, H.-W.; Xu, J.-J.; Chen, H.-Y. Chem. Commun. 2011, 47, 7752. (26) Wu, M.-S.; Shi, H.-W.; He, L.-J.; Xu, J.-J.; Chen, H.-Y. Anal. Chem. 2012, 84, 4207. (27) Zhang, H.-R.; Xia, X.-H.; Xu, J.-J.; Chen, H.-Y. Electrochem. Commum. 2012, 25, 112. (28) Wang, J.; Shan, Y.; Zhao, W.-W.; Xu, J.-J.; Chen, H.-Y. Anal. Chem. 2011, 83, 4004. (29) Tian, C.-Y.; Xu, J.-J.; Chen, H.-Y. Chem. Commun. 2012, 48, 8234. (30) Shan, Y.; Xu, J.-J.; Chen, H.-Y. Nanoscale 2011, 3, 2916. (31) Tian, C.-Y.; Zhao, W.-W.; Wang, J.; Xu, J.-J.; Chen, H.-Y. Analyst 2012, 137, 3070. (32) Shan, Y.; Xu, J.-J.; Chen, H.-Y. Chem. Commun. 2010, 46, 5079. 3840
dx.doi.org/10.1021/ac403960g | Anal. Chem. 2014, 86, 3834−3840
Signal-On Dual-Potential Electrochemiluminescence Based on Luminol−Gold Bifunctional Nanoparticles for Telomerase Detection Huai-Rong Zhang, Mei-Sheng Wu, Jing-Juan Xu,* and Hong-Yuan Chen State Key Laboratory of Analytical Chemistry for Life Science, School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210093, China ABSTRACT: Here, we report a novel type of signal-on dualpotential electrochemiluminescence (ECL) approach for telomerase detection based on bifunctionalized luminol−gold nanoparticles (L−Au NPs). In this approach, CdS nanocrystals (NCs) were first coated on glassy carbon electrode, and then thiol-modified telomerase primer was attached on CdS NCs via Cd−S bond. In the presence of telomerase and dNTPs, the primer could be extended. Telomerase primer would hybridize with its complementary DNA, and the extended part would hybridize with the capture DNA which was tagged with L−Au NPs. In the presence of coreactant H2O2, the L−Au NPs could not only enhance the ECL intensity of CdS NCs at −1.25 V (vs SCE) induced by the surface plasmon resonance (SPR) of Au NPs but also produce a new ECL signal at +0.45 V (vs SCE) that resulted from luminol in L−Au NPs. Both signals at two potentials increased with the increase of telomerase concentration. This method could be used to detect the telomerase from 100 to 9000 HL-60 cells and investigate the apoptosis of tumor cells. The ratio of the two signal increments (ΔECLLuminol/ ΔECLCdS NCs), which showed a high consistency value for different numbers of cells, could be used to verify the reliability of tests. This dual-potential ECL strategy showed great promise in avoiding false positive or negative results in bioanalysis.
T
to generate interest in bioassays.13 Previous studies showed that electrodes modified with metal nanoparticles (NPs) such as Au or Pt could enhance the ECL emission of luminol by 2−3 orders compared to the original bare electrodes.14,15 Cui and co-workers have developed a novel ECL immunosensor using luminol-functionalized Au NPs as both labels and ECL reagents for biomolecular detection.16,17 The enhancement of ECL is caused by the increase of the active electrode area as well as the catalytic effect of metal NPs on luminol oxidation. ECL biosensors based on semiconductor nanocrystals (NCs) have been paid more attention in recent years.18 Mechanistic studies of semiconductor nanocrystals (NCs) are the foundation of the application, and a number of studies have been done in the ECL mechanism.19−21 Due to the unique electronic and optical properties, together with the different preparation methods available with controlled sizes and shapes, semiconductor NCs provide tunable emission wavelength and excellent quantum yield for ECL devices. Considerable works have been done in ECL resonance energy transfer (RET) because it is easier for NCs emitters to find a suitable pair of donor−acceptor than traditional ECL emitters. Xu and coworkers first demonstrated that the ECL from manganesedoped CdS NCs could be quenched by proximal Au NPs, whereby enhanced at relatively long distance because of
elomeres are critical elements of eukaryotic chromosomes which protect the termini of linear chromosomes from fusion and degradation.1,2 Telomeres are shortened during the cell life cycle, and the cell may die if telomeres get too short. Telomerase is an enzyme which can elongate telomere ends and is thought to be responsible for the continuous and uncontrolled growth of cancer cells.3 Recent studies have revealed that an elevated amount of telomerase can be observed in various malignant or cancerous cells.4 Therefore, the telomerase activity could be considered as an important biomarker for early diagnosis, prognosis, and understanding the pathogenesis of disease. So far, several analytical approaches have been developed for telomerase activity analysis, including enzyme immunoassay, fluorescent assay, and electrochemical assay.5−10 However, most of them either time-consuming or require the use of harmful radioactive and expensive fluorescent substances. More importantly, these approaches are single signal detection which may cause false-positive or false-negative results, especially in complex biological matrix, such as cell and blood. Therefore, a dual-signal approach requiring simple instrumentation yet providing high sensitivity for monitoring telomerase activity is expected. Electrochemiluminescence (ECL), as a highly sensitive technique and has attracted considerable attention in pharmaceutical analysis, clinical diagnosis, environment and food analysis, and immunoassay as well as DNA detection.11,12 There are lots of ECL-active species that have been studied. For example, luminol is a classic organic ECL species that continues © 2014 American Chemical Society
Received: December 5, 2013 Accepted: March 19, 2014 Published: March 19, 2014 3834
dx.doi.org/10.1021/ac403960g | Anal. Chem. 2014, 86, 3834−3840
Analytical Chemistry
Article
Table 1. DNA Sequence Used in This Work name
sequences (5′ to 3′)
telomerase primer complementary DNA capture DNA
5′-SH−(CH2)6−TTTTTTAATCCGTCGAGCAGAGTT GGCACAAACATGCACCTCAAAAAA 5′-SH−(CH2)6−TAACCCTAACCC
(TCEP), and luminol were purchased from Sigma-Aldrich (St. Louis, MO) and used without further purification. A 0.1 M Tris−HCl buffer was employed for preparation of ECL detection solutions. Tris−HCl buffer (0.1 M) containing 0.1 M NaCl and 5 mM MgCl2 (pH 7.4) was employed for preparation of DNA stock solutions. A 0.1 M PBS (pH 7.4) buffer containing K2HPO4 and KH2PO4 was used to wash cancer cells. All other reagents were of analytical grade and used as received. All the water used in the work was RNase-free. Preparation of Telomerase Primer Modified CdS NCs on GCE. CdS NCs and CdS NCs modified GCEs were prepared according to our previous work.35 Briefly, Cd(NO3)2· 4H2O (0.1683 g) was dissolved in 30 mL of ultrapure water and heated to 70 °C under stirring; then, the mixture was injected into a freshly prepared solution of Na2S (0.5960 g) in 30 mL of ultrapure water. Instantly, orange-yellow solution was obtained. The solution was held at 70 °C for 3 h with continuous refluxing and stirring. The final reaction precipitates were centrifuged and washed thoroughly with absolute ethanol and ultrapure water two times. Then, the obtained precipitate was redispersed into water for centrifugation to collect the upper yellow solution of CdS NCs. The average size of synthesized CdS NCs was about 5 nm. After that, 10 μL of CdS solution was drop-cast on the pretreated GCE (GCE, 3 mm diameter) and then air-dried at room temperature to get the CdS film modified GCE electrode. The modified GCE electrode was stored in Tris−HCl buffer (pH 7.4) for further modification. The solution of 1 × 10−5 M (100 μL) telomerase primer was pretreated by 2 μL of TCEP, and then the CdS NCs modified GCE was immersed in the telomerase primer (10 μL) solution for 24 h at 4 °C in order to ensure the fastness of the Cd−S bond. The obtained electrode was rinsed with 0.1 M Tris−HCl buffer to remove the unspecified telomerase primer. Preparation of L−Au NPs and Capture DNA−L−Au NPs. All glasses used in the synthesis were immersed in freshly prepared aqua regia (HNO3/HCl = 1:3) for 12 h, then washed with ultrapure water and dried before use. To prepare L−Au NPs, 4 mL of ice-cold 0.01 M luminol solution and 0.6 mL of ice-cold 0.1 M NaBH4 were added to 20 mL of aqueous solution containing 2.5 × 10−4 M HAuCl4 under stirring and kept stirring in an ice bath for 10 min. The solution immediately turned to deep purple-red color, indicating the formation of Au NPs. Then, the solution was kept stirring at room temperature for another 6 h to prepare colloid L−Au NPs. An amount of 100 μL of 1 × 10−4 M of capture DNA was pretreated by 4 μL of TCEP for 1 h, and then 1 mL of the asprepared colloid L−Au NPs was added into it. The mixed solution was stirred at room temperature for 6 h and then kept for 24 h at 4 °C in order to ensure the fastness of the Au−S bond. Cell Culture and Telomerase Extract Preparation. HL60 cells were cultured in DMEM medium supplemented with 10% fetal calf serum, and the cells were maintained at 37 °C in a humidified atmosphere (95% air and 5% CO2). Cells were collected in the exponential phase of growth and washed twice with ice-cold sterile PBS; then 105 cells were resuspended in
plasmon coupling, providing that the ECL spectrum of NCs overlapped with the absorption profile of Au NPs. Exploring such ECL energy transfer platform for DNA analysis allowed ultrasensitive DNA detection. Since this research, NCs-based ECL energy transfer assays for DNA detection,22−24 cytosensing,25,26 aptamer,27−30 and immunoassay31,32 have been further explored. However, most of the ECL approaches in the previous studies are single signal response, which means that there is a single ECL signal for one kind of target. This kind of assay could be affected by the environment easily and could not exclude the error signals caused by other interferences, especially in complex biological matrix, such as cell and blood. Inspired by the dual-wavelength fluorescence ratiometric method which could reduce the influence from the environmental change, recently we first provided an ECL ratiometric sensing approach.14 In this primary research, due to the natural large absorption cross section and catalytic ability of Pt NPs, ECL quenching of CdS NCs and ECL enhancement of luminol could be induced in one potential scan, resulting in a novel dual-potential ECL ratiometric sensing approach for the mp53 oncogene detection. However, in that work the target analyte needs to be functionalized with ECL reagent before use, which is not conductive to detect real samples. Here we designed a novel signal-on dual-potential ECL detection approach to detect telomerase activity from cancer cells. Telomerase primer was attached on CdS NCs which could be extended in the presence of telomerase and dNTPs. The extended part was then hybridized with luminol−gold nanoparticles (L−Au NPs) labeled capture DNA, resulting in an enhanced ECL intensity of CdS NCs at −1.25 V (vs SCE) by surface plasmon resonance (SPR) and a new ECL signal at +0.45 V (vs SCE) from luminol. This signal-on dual-potential detection approach could detect the activity of telomerase extracted from HL-60 cells in the range of 100−9000. Unlike the ECL ratiometric sensing approach,14,33,34 in which the ratio of ECL intensities at two excitation potentials could be used to sensitively detect the concentration of target DNA, in this work the ratio of ECL increments of both CdS NCs and luminol showed a constant value and could be used to judge the reliability of the detection results and avoid the false positive or negative, providing a great promise in clinical diagnosis.
■
EXPERIMENTAL SECTION
The deoxynucleotide solution mixture (dNTPs) was purchased from TaKaRa Bio Inc. (Da lian, China ). 3-[(3Cholamidopropyl)dimethylammonio]-1-propanesulfonic acid (CHAPS), phenylmethylsulfonyl fluoride (PMSF), ethylene glycol bis(aminoethyl ether)-N,N,N,N tetraacetic acid (EGTA), glycerol, and Tween 20 were purchased from Biosharp Biotechnology. Oligonucleotides of telomerase primer, complementary DNA, and capture DNA were purchased from Sangon Biotech Co. Ltd. (Shanghai, China), and the sequences are listed in Table 1. Epigallocatechin-3-gallate (EGCG), bovine serum albumin (BSA), tri(2-carboxyethyl)phosphine hydrochloride 3835
dx.doi.org/10.1021/ac403960g | Anal. Chem. 2014, 86, 3834−3840
Analytical Chemistry
Article
NPs is about 5 ± 1 nm which was similar with Au NPs. Figure 1B shows the results of energy-dispersive X-ray (EDX) analysis. The presence of C (26 eV), N (50 eV), O (94 eV), and Au (970 eV) elements verified the existence of luminol molecules in L−Au NPs. An obvious N peak can be observed in L−Au NPs while it cannot be observed in Au NPs (inset of Figure 1B). Besides, a significant increase in the EDX peak of C element in L−Au NPs was clearly detected. Both of them were ascribed to luminol molecules in L−Au NPs. These results were further confirmed by UV−vis spectra of Au NPs and L−Au NPs. As shown in Figure 1C, compared with the spectrum of Au NPs (curve a), L−Au NPs (curve c) exhibited a new absorption band at 250−400 nm which was attributed to luminol molecule (curve b). Earlier studies have demonstrated that the ECL intensity of luminol could be enhanced on a Au NPs self-assembled electrode compared with that on a bare Au electrode by virtue of its large surface area and superior catalysis effect.15,36 Here, Au NPs were also served as carriers for luminol molecules to introduce a large amount of ECL emitter on the electrode surface and as catalysts to catalyze the oxidation of luminol. To obtain an optimal ECL emitter, we optimized the volume of luminol in preparation of L−Au NPs. All of the L−Au NPs (curves a−d) displayed an obvious ECL signal at 0.45 V in the presence of H2O2 due to the production of reactive oxygen species (ROSs) which accelerated the formation of excited state. The corresponding ECL processes are shown as follows:37
200 μL of ice-cold CHAPS lysis buffer (10 mM Tris−HCl, pH 7.5, 1 mM MgCl2, 1 mM EGTA, 0.1 mM PMSF, 5 mM mercaptoethanol, 0.5% CHAPS, 10% glycerol). The lysate was incubated for 30 min on ice and centrifuged for 20 min at 14 000 rpm in 4 °C to pellet insoluble material. Then the cleaned lysate was carefully transferred to a 1.5 mL EP tube. The lysate was used immediately for telomerase assay or frozen at −80 °C. For apoptosis assay, HL-60 cells were treated with different concentrations of EGCG and cultured in 12-well plates for 48 h, and then dyed with acridine orange (AO) and ethidium bromide (EB) to show the activity of cancer cells. The telomerase was extracted from EGCG-treated HL-60 cells at the same way. Telomerase Extension Reaction and ECL Detection of Telomerase Activity. The telomerase primer modified glassy carbon electrode was immersed into 100 μL of telomerase reaction solution which contained 5 μL of telomerase extracts and 95 μL of telomerase reaction buffer (20 mM Tris−HCl buffer, pH 8.3, 1.5 mM MgCl2, 0.63 mM KCl, 0.05% Tween 20, 1 mM EGTA, 0.1 mM dNTPs) at 37 °C for 1 h. For control experiments, telomerase extracts were pretreated at 95 °C for 20 min. Then the electrode was incubated with complementary DNA and capture DNA−L−Au NPs sequentially. After that, the electrode was washed thoroughly with 0.1 M Tris−HCl buffer and immersed in 0.1 M Tris−HCl buffer (5.0 mL; pH 7.4) containing 16 mM H2O2 solution for ECL detection. The voltage of the photomultiplier tube (PMT) was set at 500 V, and the potential range was set from 0.6 to −1.3 V.
■
RESULTS AND DISCUSSION Response Mechanism of the Dual-Potential ECL Aptasensor. Scheme 1 shows the principle of the dualScheme 1. Schematic Representation of Dual-Potential ECL for Telomerase Detection System
Besides, it should be noted that the ECL intensity was enhanced with the increase of luminol volume added in the synthesis process, resulting from the large number of luminol molecules labeled on Au NPs (Figure 1D). However, the TEM image in the inset of Figure 1D demonstrates that the diameters of L−Au NPs synthesized with high luminol volume (5 mL) were nonuniform. Therefore, L−Au NPs synthesized with 4 mL of luminol solution were chosen for the further experiments. Then we investigated the ECL performance of another ECL emitter, namely, CdS NCs. The ECL−potential curve of CdS NCs modified GCE is shown in Figure 2A (curve a). It displays an ECL peak at −1.25 V (SCE). The cathodic ECL was produced upon concomitant reduction of CdS NCs and H2O2, CdS NCs were reduced to nanocrystal species (CdS−•) by charge injection upon the potential scan with an initial negative direction, while the coreactant H2O2 was reduced to the strong oxidant ·OH; after that, CdS NCs were reacted with ·OH or H2O2 to emit light in the aqueous solution. The corresponding ECL processes are as follows:38
potential ECL aptasensor protocol. CdS NCs were used as one of the ECL emitters which generated a weak ECL signal in the presence of coreactant H2O2 at negative potential. Then thiolmodified telomerase primer was attached on the CdS NCs surface. After the extension of primer with telomerase and dNTPs, telomerase primer was hybridized with its complementary DNA and the extended part was hybridized with the capture DNA−L−Au NPs. Due to the SPR and the superior catalytic effect of Au NPs, it not only enhanced the ECL intensity of CdS NCs but also produced a new ECL signal at positive potential. Figure 1A and inset show the transmission electron microscopy (TEM) images of the as-prepared L−Au NPs and Au NPs. We can see that the average particle size of L−Au
CdS NCs + ne− → nCdS•− 3836
(5)
dx.doi.org/10.1021/ac403960g | Anal. Chem. 2014, 86, 3834−3840
Analytical Chemistry
Article
Figure 1. (A) TEM image of L−Au NPs. Inset is the TEM image of Au NPs. (B) The EDX of L−Au NPs. Inset: the EDX of Au NPs. (C) The UV− vis absorption spectra of (a) Au NPs, (b) luminol, (c) L−Au NPs. Inset: the magnified UV−vis spectra. (D) Cyclic ECL curves of L−Au NPs modified GCEs. L−Au NPs were synthesized with different volumes of luminol: (a) 2, (b) 3, (c) 4, and (d) 5 mL. Inset is the TEM image of L−Au NPs which were synthesized with 5 mL of luminol solution. The detection was performed in 0.1 M Tris−HCl buffer (pH 7.4) containing 16 mM H2O2. Scan rate: 100 mV/s. Scan range: 0−0.6 V.
Figure 2. (A) Cyclic ECL curves of the electrode modified with process a in Scheme 1a and further modified with process b in Scheme 1b with telomerase extracted from 9000 HL-60 cells; (c) cyclic ECL curves of L−Au NPs modified electrode. Scan direction: 0 V → 0.6 V → −1.3 V → 0 V. Scan rate: 100 mV/s. Inset: the ECL spectra of CdS NCs. (B) The dependence of ECL intensity of CdS NCs on H2O2 concentration. The detection was performed in 0.1 M Tris−HCl buffer (pH 7.4). Scan rate: 100 mV/s. Scan range: −1.3 to 0 V. (C) ECL signal−time curves of CdS NCs. (D) ECL signal−time curve of L−Au NPs (lower one) on CdS NCs (higher one) interface after treating with telomerase extracted from 9000 HL-60 cells. The detection was performed in 0.1 M Tris−HCl buffer (pH 7.4) containing 16 mM H2O2. Scan direction: 0 V → 0.6 V → −1.3 V → 0 V. Scan rate: 100 mV/s. Scan range: −1.3 to 0.6 V.
H 2O2 + 2e− → ·OH + OH−
2CdS•− + 2·OH → 2CdS* + H 2O2
(6)
3837
(7)
dx.doi.org/10.1021/ac403960g | Anal. Chem. 2014, 86, 3834−3840
Analytical Chemistry
Article
Figure 3. (A) ECL signal−time curves at the dual-potential ECL sensing interface with telomerase extracted from different numbers of HL-60 cells: 0, 100, 1000, 3000, 5000, 7000, and 9000 from a to g, respectively. The first signal was induced by luminol, and the second was induced by CdS NCs. (B) Dependence of ΔECL intensity of CdS NCs (a) and luminol (b) on the number of HL-60 cells. Inset: linear relationship between ΔECL intensity of CdS NCs (a) or luminol (b) and the number of HL-60 cells. All the detection was performed in 0.1 M Tris−HCl buffer (pH 7.4) containing 16 mM H2O2. Scan rate: 100 mV/s. Scan range: −1.3 to 0.6 V.
Figure 4. (A) Relationship between ΔECLLuminol/ΔECLCdS NCs and telomerase extracted from different numbers of HL-60 cells: 30, 60, 100, 1000, 3000, 5000, 7000, 9000, 11 000, and 13 000. Inset: the relationship between ΔECLLuminol/ΔECLCdS NCs and telomerase extracted from 0, 10, 30, 70, 90, 150, and 200 mg/L EGCG-treated HL-60 cells. (B) ECL signal changes of CdS NCs and luminol after treating with telomerase extracted from 9000 HL-60 cells, heated telomerase from 9000 HL-60 cells, and without telomerase.
CdS* → CdS NCs + hv
(8)
2CdS•− + H 2O2 → 2CdS* + 2OH−
(9)
Au NPs complexes with the extended part of telomerase primer, Au NPs and the CdS NCs were separated by at least 36 complementary base pairs (0.34 nm per base pair). As can be seen in Figure 2A, the ECL intensity of CdS NCs (curve b, −1.25 V) was more than 4-fold higher than that before hybridization (curve a). This was attributed to the excitation of Au NPs SPR by the ECL emitting which can create strong local electric fields that in turn modulate the ECL response of the CdS NCs. Beside, a new ECL peak at 0.45 V could be observed due to the oxidation of luminol on the electrode surface, confirming the validation of the approach for telomerase detection. Both of these ECL signals were proved to be stable and strong enough (Figure 2D). Detection of Telomerase Activity in HL-60 Cells. The contents of telomerase in the cell lysate samples were subsequently detected by the proposed approach to validate the sensitivity of this strategy. Cell extracts were serially diluted with lysis buffer before reacting with TS primers. Figure 3A is the ECL signal−time curves which show the relationship between the ECL intensity and the number of cells from 0 to 9000. As shown in Figure 3B, the ΔECL intensity of luminol and CdS NCs were both increased with the increase of cell numbers in the range from 30 to 13 000. From the inset of
or
CdS* → CdS NCs + hv
(10)
The ECL intensity of CdS NCs increased with the increasing concentration of H2O2 and then reached an approximate plateau above 16 mM (Figure 2B). Thus, the following experiments were performed in 0.1 M Tris−HCl buffer (pH 7.4) containing 16 mM H2O2. In addition, ECL measurements of the CdS NCs upon continuous cyclic scans showed constant signals with an excellent stability (Figure 2C). Previous studies have been reported that Au NPs could enhance the ECL signal of CdS NCs.23 This enhancement was influenced by spectra overlap and separation distance between them. The inset in Figure 2A illustrates that the ECL spectrum of CdS NCs overlapped well with the SPR absorption of Au NPs (inset in Figure 1C, curve c). Besides, the distance between CdS NCs and Au NPs was effectively controlled by the length of complementary DNA. After the hybridization of complementary DNA with telomerase primer on the CdS NCs/GCE surface and the hybridization of capture DNA−L− 3838
dx.doi.org/10.1021/ac403960g | Anal. Chem. 2014, 86, 3834−3840
Analytical Chemistry
Article
Figure 5. Fluorescence images of 0 (A), 10 (B), 30 (C), 70 (D), 90 (E), 150 (F), and 200 (G) mg/L EGCG-treated HL-60 cells after staining with AO/EB. (H) ECL signal−time curves at the dual-potential ECL sensing interface with heated telomerase (a) and with telomerase from 200, 150, 90, 70, 30, 10, 0 mg/L EGCG-treated HL-60 cells from b to g, respectively. The number of HL-60 cells was 5000. All of the detection was performed in 0.1 M Tris−HCl buffer (pH 7.4) containing 16 mM H2O2. Scan rate: 100 mV/s. Scan range: −1.3 to 0.6 V.
Figure 3B, it can be observed that both ΔECL intensities of CdS NCs (curve a, R = 0.982) and luminol (curve b, R = 0.985) were linearly proportional to the HL-60 cell numbers in the range of 100−9000 with a detection limit of 83 and 62 cells at the S/N ratio of 3, respectively. Therefore, the sensitivity of the assay was comparable sensitive with those of reported approaches.39,40 To assess the accuracy of this strategy, the ratio of the two signal increments (ΔECLLuminol/ΔECLCdS NCs) was plotted versus cell numbers, and the results are displayed in Figure 4A. The ratio maintained a constant value of ca. 0.62 when the cell numbers were from 100 to 9000. However, further addition of cells led to an increase of the ratio because of the increasing concentration of telomerase used for primer extension. It increased the length of extended primers which enabled the hybridization of multilayer capture DNA on the electrode surface and enlarged the distance between L−Au NPs and CdS NCs/GCE. As we all know, the emission of CdS NCs was sensitively enhanced by the surface plasmon absorption of Au NPs in a distance-dependent manner.30 Hence, the increment of CdS NCs ECL intensity decreased significantly (Figure 3B, curve a). On the other hand, the increment of luminol ECL also increased slowly due to the increasing distance between multilayer L−Au NPs and GCE (Figure 3B, curve b). Besides, the ratio was also higher than 0.62 when cell numbers were lower than 100. This result may caused by the false-positive signal in sensing low concentration of target. Although the sensitivity of the assay was less sensitive than those of recently reported studies,41,42 the designed dual-potential ECL aptasensor can effectively reduce the false-positive signal and improve the accuracy. Figure 4B shows a set of control experiments that were performed in the presence of telomerase, heated telomerase, and in the absence of telomerase. Both of the ECL signals of luminol and CdS NCs were slightly increased in the presence of heated telomerase and in the absence of telomerase, while it exhibited an obvious increment with telomerase, indicating an excellent specificity and efficiency of this approach. Monitoring Telomerase Expression on Cancer Cells in Response to EGCG. The high sensitivity and accuracy of this
biosensor allowed us to further assess the dynamic alteration of telomerase in response to drugs. Epigallocatechin-3-gallate (EGCG), which has been reported to induce the apoptosis of cancer cell lines, can reduce the telomerase activity in cancer cells.43,44 Figure 5 shows fluorescence images of HL-60 cells after treating with different EGCG concentrations for 48 h and then staining with AO/EB (living cells, green; dead cells, red). HL-60 cells exhibited an obvious abnormal morphology after incubating with high concentration of EGCG. Moreover, the color of the culture media (inset of Figure 5) changed to purple due to the decreasing number of living cells, which also confirmed the apoptosis of cancer cell. The corresponding changes in ECL signal are shown in Figure 5H. It could be seen that the ECL signals of CdS NCs and luminol were reduced with the increasing concentration of EGCG from 0 to 200 mg/ L, indicating the decreased activity of telomerase. For comparison, ΔECLLuminol/ΔECLCdS NCs was plotted versus EGCG concentration, and the results are shown in the inset of Figure 4A. The ratio was the same for EGCG-treated HL-60 cells and HL-60 cells when the amount of EGCG was lower than 90 mg/L. These results suggested the reliability of this platform for early diagnosis and prognosis prediction.
■
CONCLUSIONS
In this paper, a dual-potential ECL method for sensitive detection of human telomerase extracted from HL-60 cells was proposed by employing L−Au NPs and telomerase elongation reaction. Results demonstrated that the ECL signal change was consistent with the alternation of active telomerase in HL-60 cells. In this study, ΔECLLuminol/ΔECLCdS NCs was used to judge the accuracy of telomerase detection in order to effectively reduce the false-positive signal and improve the accuracy. With the use of this dual-potential system, HL-60 cells could be specifically detected at a concentration down to 100 cells. Furthermore, this strategy was successfully applied to investigate the apoptosis of HL-60 cells after treating with EGCG. This method is promising for detecting target analytes in a complicated environment. 3839
dx.doi.org/10.1021/ac403960g | Anal. Chem. 2014, 86, 3834−3840
Analytical Chemistry
■
Article
(33) Takeuchi, M.; Nagaoka, Y.; Yamada, T.; Takakura, H.; Ozawa, T. Anal. Chem. 2010, 82, 9306. (34) Branchini, B. R.; Rosenberg, J. C.; Ablamsky, D. M.; Taylor, K. P.; Southworth, T. L.; Linder, S. J. Anal. Biochem. 2011, 414, 239. (35) Shan, Y.; Xu, J.-J.; Chen, H.-Y. Chem. Commun. 2009, 8, 905. (36) Chai, Y.; Tian, D.; Wang, W.; Cui, H. Chem. Commun. 2010, 46, 7560. (37) Chu, H.-H.; Guo, W.-Y.; Di, J.-W.; Wu, W.; Tu, Y.-F. Electroanalysis 2009, 21, 1630. (38) Deng, L.; Shan, Y.; Xu, J.-J.; Chen, H.-Y. Nanoscale 2012, 4, 831. (39) Pavlov, V.; Xiao, Y.; Gill, R.; Dishon, A.; Kotler, M.; Willner, I. Anal. Chem. 2004, 76, 2152. (40) Xiao, Y.; Pavlov, V.; Niazov, T.; Dishon, A.; Kotler, M.; Willner, I. J. Am. Chem. Soc. 2004, 126, 7430. (41) Zhou, X.-M.; Da, X.; Zhu, D.-B.; Li, J. Anal. Chem. 2009, 81, 255. (42) Wu, L.; Wang, J.-S.; Feng, L.-Y.; Ren, J.-S.; Wei, W.-L.; Qu, X.G. Adv. Mater. 2012, 24, 2447. (43) Sen, T.; Chatterjee, A. Eur. J. Nutr. 2011, 50, 465. (44) Punathil, T.; Tollefsbol, T.-O.; Katiyar, S.-K. Biochem. Biophys. Res. Commun. 2008, 375, 162.
AUTHOR INFORMATION
Corresponding Author
*E-mail: [email protected]. Phone and Fax: +86-25-83597294. Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS This work was supported by the 973 Program (2012CB932600, 2013CB933800), the National Natural Science Foundation (Nos. 21025522, 21135003, and 21327902), and the National Natural Science Funds for Creative Research Groups (21121091) of China.
■
REFERENCES
(1) Blackburn, E. H.; Greider, C. W.; Szostak, J. W. Nat. Med. 2006, 12, 1133. (2) Ju, Z.; Rudolph, K. L. Eur. J. Cancer 2006, 42, 1197. (3) Chan, S. W.-L.; Blackburn, E. H. Oncogene 2002, 21, 553. (4) Zendehrokh, N.; Dejmek, A. Mod. Pathol. 2005, 18, 189. (5) Lança, V.; Zee, R. Y. L.; Rivera, A.; Romero, J. R. Clin. Chem. Lab. Med. 2009, 47, 870. (6) McGruder, B.-M.; Atha, D.-H.; Wang, W.; Huppi, K.; Wei, W.-Q.; Abnet, C.-C.; Qiao, Y.-L.; Dawsey, S.-M.; Taylor, P.-R.; Jakupciak, J.-P. Cancer Lett. 2006, 244, 91. (7) Pech, M. F.; Artandi, S. E. EMBO J. 2011, 30, 986. (8) Reed, J.; Gunaratnam, M.; Beltran, M.; Reszka, A. P.; Vilar, R.; Neidle, S. Anal. Biochem. 2008, 380, 99. (9) Savoysky, E.; Akamatsu, K.; Tsuchiya, M.; Yamazaki, T. Nucleic Acids Res. 1996, 24, 1175. (10) Liu, J.; Lu, C.-Y.; Zhou, H.; Xu, J.-J.; Wang, Z.-H.; Chen, H.-Y. Chem. Commun. 2013, 49, 6602. (11) Richter, M. M. Structure 2004, 104, 3003. (12) Miao, W. Chem. Rev. 2008, 108, 2506. (13) Ma, G.; Zhou, J.; Tian, C.; Jiang, D.; Fang, D.; Chen, H. Anal. Chem. 2013, 85, 3912. (14) Zhang, H.-R.; Xu, J.-J.; Chen, H.-Y. Anal. Chem. 2013, 85, 5321. (15) Cui, H.; Wang, W.; Duan, C.-F.; Dong, Y.-P.; Guo, J.-Z. Chem.Eur. J. 2007, 13, 6975. (16) Tian, D.-Y.; Duan, C.-F.; Wang, W.; Cui, H. Biosens. Bioelectron. 2010, 25, 2290. (17) Fang, L.; Cui, H. Biosens. Bioelectron. 2013, 39, 261. (18) Huang, H.; Li, J.; Zhu, J.-J. Anal. Methods 2011, 3, 33. (19) Cheng, L.; Liu, X.; Lei, J.; Ju, H. Anal. Chem. 2010, 82, 3359. (20) Wang, Y.; Lu, J.; Tang, L.; Chang, H.; Li, J. Anal. Chem. 2009, 81, 9710. (21) Zheng, L.; Chi, Y.; Dong, Y.; Lin, J.; Wang, B. J. Am. Chem. Soc. 2009, 131, 4564. (22) Zhou, H.; Zhang, Y.-Y.; Liu, J.; Xu, J.-J.; Chen, H.-Y. J. Phys. Chem. C 2012, 116, 17773. (23) Zhou, H.; Zhang, Y.-Y.; Liu, J.; Xu, J.-J.; Chen, H.-Y. Chem. Commun. 2013, 49, 2246. (24) Zhou, H.; Liu, J.; Xu, J.-J.; Chen, H.-Y. Chem. Commun. 2011, 47, 8358. (25) Wu, M.-S.; Shi, H.-W.; Xu, J.-J.; Chen, H.-Y. Chem. Commun. 2011, 47, 7752. (26) Wu, M.-S.; Shi, H.-W.; He, L.-J.; Xu, J.-J.; Chen, H.-Y. Anal. Chem. 2012, 84, 4207. (27) Zhang, H.-R.; Xia, X.-H.; Xu, J.-J.; Chen, H.-Y. Electrochem. Commum. 2012, 25, 112. (28) Wang, J.; Shan, Y.; Zhao, W.-W.; Xu, J.-J.; Chen, H.-Y. Anal. Chem. 2011, 83, 4004. (29) Tian, C.-Y.; Xu, J.-J.; Chen, H.-Y. Chem. Commun. 2012, 48, 8234. (30) Shan, Y.; Xu, J.-J.; Chen, H.-Y. Nanoscale 2011, 3, 2916. (31) Tian, C.-Y.; Zhao, W.-W.; Wang, J.; Xu, J.-J.; Chen, H.-Y. Analyst 2012, 137, 3070. (32) Shan, Y.; Xu, J.-J.; Chen, H.-Y. Chem. Commun. 2010, 46, 5079. 3840
dx.doi.org/10.1021/ac403960g | Anal. Chem. 2014, 86, 3834−3840
