VIROLOGY

182, 177-185

(1991)

Simian lmmunodeficiency Virus (SIVmac) Exhibits Complex for fat, rev, and env mRNA

Splicing

RONALD E. UNGER,’ MICHAEL W. STOUT, AND PAUL A. LUCIW School of Medicine,

Department

of Medical Pathology,

University

of California,

Davis, California

956 16

Received October 29, 1990; accepted January 22, 199 1 The simian immunodeficiency virus (SW) is a T-lymphotropic lentivirus associated with a fatal AIDS-like disease in rhesus macaques. SIV has a complex genome encoding virion structural proteins, transactivators, and accessory genes. From lymphoid cells chronically infected with a biologically active molecular clone of SIV, SlVmacl Al 1, the polymerase chain reaction technique has been used to selectively amplify transcripts for viral transactivators and the envelope gene. Three species of mRNA encoding only rev, and three mRNA encoding both rev and fat were identified by nucleotide sequence analysis. They differed in the splice acceptor sites utilized upstream of the first coding exon, in the presence or the absence of noncoding exons between the major splice donor at the LTR and the splice acceptor at the first coding exons, and in the splicing pattern between the coding exons. Alternate splice acceptors were utilized between the coding exons of tat and rev, but the altered tat proteins did not differ in their ability to transactivate the SIV-LTR. The splicing for env mRNA is more complex than previously reported. Both singly and multiply spliced o 1991 Academic transcripts exist for env mRNA, and the same splice acceptor site is utilized by both revand env mRNA. Press.

Inc.

INTRODUCTION

tion of gene expression (Cullen and Greene, 1989; Kim et al., 1989). Early in infection, most of the viral mRNA consists of small, multiply spliced mRNA which encode the regulatory proteins, whereas late in the life cycle unspliced mRNA encoding gag and pal, and singly spliced mRNA encoding env and the multiply spliced mRNA accumulate. This regulation is mediated by the tat and rev gene products (Cullen and Greene, 1989; Haseltine, 1988; Kim et al., 1989). The tat gene product stimulates viral gene expression through its action on the long terminal repeat (LTR) and causes the accumulation of high levels of multiply spliced mRNA early in infection. As the rev protein increases, it acts through a c&-acting element located within the env gene (the rev-responsive element, RRE) and facilitates the transport of these unspliced and singly spliced RRE-containing mRNA from the nucleus (Chang and Sharp, 1990; Daefler et al., 1990; Dillon et al., 1990; Emerman et al., 1989; Felber et al., 1990; Hammarskjold et al., 1989; Heaphy et a/., 1990; Malim et al., 1989). This increases the ratio of unspliced to spliced mRNA in the cytoplasm late in infection and thus, results in increased production of viral structural proteins. Functions of the other regulatory proteins are not well understood. Recent studies indicate that the pattern of mRNA splicing for individual regulatory genes in HIV-1 (Arrigo et a/., 1990; Guatelli et a/., 1990; Robert-Guroff et al., 1990; Schwartz et a/., 1990) and SlVmac (Colombini et a/., 1989; Viglianti et a/., 1990) is complex. Numerous

Simian immunodeficiency virus from rhesus macaques (SIVmac) produces an immunodeficiency disease in susceptible animals that is similar to that caused by human immunodeficiency virus type 1 (HIVl), the etiologic agent of acquired immunodeficiency syndrome (AIDS) in humans (for reviews, see Gardner and Luciw (1989) and Desrosiers (1989)). Immunosuppression is a result of the depletion of CD4 positive T-helper/inducer cells, essential regulatory cells of the immune system (Rosenberg and Fauci, 1989). The host becomes susceptible to secondary infections which prove to be fatal (Ho et al., 1987). Molecular analysis of the genomes of HIV-l, HIV-2, and SIV revealed that these primate lentiviruses exhibit strong sequence and structural conservation (Chakrabarti et a/., 1987; Franchini and Bosch, 1989; Hirsch et al., 1987; Kornfeld et al., 1987). In addition to the gag, pal, and env, genes which encode structural proteins, these viruses have at least six other genes, some of which have known regulatory functions: tat, rev, nef, vpr, vif, and vpx (HIV-2 and SIV) or vpu (HIV-l). Recently, a seventh potential regulatory gene tev, has been identified in HIV-l (Benko et a/., 1990). The primary full-length viral RNA transcript is processed into mRNA by multiple splicing events and by a mechanism which appears to involve temporal regula’ To whom requests for reprints should be addressed. 177

0042.6822/91

$3.00

CopyrIght 0 1991 by Academic Press, Inc. All rights of reproduction I” any form resewed.

178

UNGER, STOUT, AND LUCIW

multiply spliced transcripts for tat, rev, and nef have been identified. It is not known whether all transcripts are equally translated or whether a single protein is translated from mRNA that may encode sequences for more than one protein. We have examined the splicing patterns of mRNAs encoding the regulatory proteins tat and rev and the structural protein, env. Patterns of splicing of mRNAfor tat and rev in a biologically active molecular clone of SIV, SIVmacl Al 1, indicate some differences from splicing patterns previously described for SIV (Colombini et a/., 1989; Viglianti and Mullins, 1988; Viglianti et al., 1990). In addition, splicing for env mRNA is more complex than previously reported.

MATERIALS AND METHODS Cells and virus HUT-78 cells were transfected with a biologically active molecular clone (SIVmacl Al 1) (Marthas et a/., 1989) of SIVmac. After an initial period of 2 to 3 weeks in which extensive cytopathology was noted, a chronically infected culture with little cytopathology was established. High levels of virion-associated RT activity were maintained in these cultures (data not shown). lmmunofluorescence assays with a monoclonal antibody against SIV p27 gag revealed that 80 to 90% of the cells were positive for SIV antigen. All cell cultures were maintained in RPMI basal medium supplemented with 10% fetal calf serum, 2 mM glutamine, penicillin (100 U/ml), and streptomycin (100 pg/ml) and passaged twice weekly.

burg, MD). After 2 hr at 42”, samples were heated to 95” for 10 min and then used directly for PCR.

PCR amplification PCR was carried out in a DNA thermal cycler (Perkin-Elmer Cetus, Emeryville, CA). 30 cycles of amplification were performed on aliquots (generally 5-l 0 ~1) of the single-stranded reaction products in 50 ~1 of the following reaction mixture: 10 mM Tris-HCI (pH 8.3), 50 mnll KCI, 1.5 mM MgCI,, O.Olq/o gelatin, 200 PM each dATP, dGTP, dCTP, and TTP, 40 pmol of each primer, and 1 U Taq polymerase (Perkin-Elmer Cetus, Emeryville, CA). Each cycle consisted of 1 min denaturation at 94”, 1 min primer annealing at 55”, and I-min extension at 72”. To facilitate subcloning fragments after PCR amplification, primers were designed with unique restriction enzyme sites on the ends which were not present in genomic viral DNA. The sequence and positions of the primers in the SIVmacl Al 1 genome were based on the numbering system for the published sequence of SIVmacl42 (Chakrabarti et a/., 1987): SIV84, 5’-GCGAATTCCTGGTCAACTCGGTA-3’ (nt 719 to 740); SIV106, 5’-GGCTCGAGTCAAGCCTGAGGACTTCTC-3’ (nt 9051 to 9069); SlV108, 5’TACCCCGGTTCAGTCGCTCTGCGGAGAGG-3’ (nt 516 to 533); and SIV58, 5’-CCCAAGCATCAAAGCTTTCTGTAAC-3’ (nt 6815 to 6839). The primer pair SIV84/SIV106 was used for amplification of rev and tat mRNAs, and the primer pair SIV108/SIV58 was used to amplify mRNA specific for env.

Analysis and cloning of amplified products RNA isolation and preparation of cDNA RNA was purified (5 months post-transfection) from 10’ cells using the method of Chomczynski and Sacchi (1987). After ethanol precipitation, the amount and quality of RNA was assessed by the absorbance at 260 and 280 nm, by appearance on a formaldehyde-agarose gel, and by amplification of a small amount of the resuspended RNA pellet by PCR (lnnis et al., 1990). Substantial amounts of DNA were found to be present; therefore, cell RNA preparations were treated with RNase-free DNase and RNasin (Promega, Madison, WI) for 10 min at 37”, after which RNA was again purified as described above. This method was found to remove all contaminating DNA as detectable by PCR. Single-stranded cDNA was synthesized in 100-~1 reaction mixtures containing the following: 10 mMTris-HCI (pH 8.3) 50 mM KCI, 1.5 mM MgCI,, 0.01% gelatin, 200 pNl each dATP, dGTP, dCTP, and lTP, 500 pmol random primer (Pharmacia), 100 U RNasin (Promega, Madison, WI), 5 pg RNA, and 1000 U of reverse transcriptase (Bethesda Research Laboratories, Gaithers-

Amplified products were initially examined by analyzing a small aliquot of the PCR reaction mixture on 1.5% agarose gels and visualization of DNA bands by uv illumination after treatment with ethidium bromide. In addition, Southern hybridization with a different tat-, rev-, and env-specific oligonucleotide probes confirmed that the bands represented SIV sequences (data not shown). Amplified fragments were eluted from agarose gels (Geneclean, BIO 101, La Jolla, CA). After elution from glass beads, amplified fragments were digested with appropriate restriction enzymes, repurified as above and cloned into pGEM3 vector (Promega, Madison, WI). After ligation of target fragments to vector DNA with T4 DNA ligase (Bethesda Research Laboratories, Gaithersburg, MD) for 12-l 6 hr at 15”, the mixture was transformed into competent HBl 01 cells and placed on agar containing 100 pg/ml ampicillin. The resulting clones were analyzed by restriction enzyme digestion, and the DNA sequence was determined by the dideoxynucleotide method of Sanger et al. (1977), using double-stranded supercoiled plasmid DNA and

SIMIAN

Sequenase land, OH).

IMMUNODEFICIENCY

(United States Biochemical

VIRUS AND COMPLEX

Corp., Cleve-

Plasmid constructions The wild-type HIV-1 LTRKAT plasmid (pHIV LTR/ CAT) has been described previously (Peterlin et al., 1986). The HIV-1 TAT gene (Peterlin eta/., 1986) under the transcriptional control of the simian virus 40 early promotor (pSVTAT) was cloned into pUC12 (Barry et a/., 1990). The cDNA clones for rev or tat and rev were subcloned into p22A2 (Barry et a/., 1990), which contains the simian virus 40 early promotor and poly(A) site. DNA transfections

and CAT assays

Plasmids were transfected into HUT-78 cells by the electroporation method previously described (Barry et a/., 1989). Briefly, exponentially growing cells were washed once with PBS and resuspended at a density of 1 X 10’ cells/ml in RPM1 medium with 10 mM dextran and 0.1 mM dithiothreitol without FCS. Electroporation was carried out on 0.4 ml of this suspension in a 0.4~cm cuvette at 960 ELFcapacitance and 200 V. Five micrograms pLTR/CAT plus 5 pug test plasmid were used per transfection. After transfection, cells were resuspended in 4 ml regular growth medium and incubated for 40 to 48 hr at 37” in a tissue culture incubator until harvested. The DEAE-dextran method for transfection was used for GCT cells as previously described (Barry et a/., 1990). The CAT assay for all transfections was based on the procedure of Nordeen et a/. (1987) as modified by Barry et a/. (1990). RESULTS PCR amplification

of rev, tat, and env mRNAs

RNA from HUT-78 cells chronically infected with the biologically active molecular clone SIVmacl Al 1 was reverse transcribed with random primers. To amplify the cDNA, we chose a pair of PCR primers, SIV84 and SlVlO6, that were designed to detect cDNAs from rev and tat transcripts (Figs. 1A and 1B). Primer SIV84 began just 3’ to an intron previously shown to be within the SIV LTR (Colombini et al., 1989). SIV106 was a primer located at the 3’ end of the second coding exon of rev. For amplification of envcDNA, the 5’ primer was at the cap site and the 3’ primer was 240 bp 3’ to the start site for the env gene at a point where there were no overlapping genes in other frames (Fig. 1 B). Amplified cDNAs were then analyzed by gel electrophoresis and Southern blotting. Four distinct amplified bands for primer pair SIV 84/106 were observed between 600 and 900 bp and three bands were noted for SIV108/58 between 650 and 800 bp (data not shown).

SPLICING

FOR mRNA

Cloning and sequencing

179

cDNAs for tat and rev

To confirm that the amplified DNA bands were unique cDNA species representing messages for tat, rev, and env, the SIV84/106 PCR reaction mixture was digested with EcoRl and HindIll and the SIV 108/58 was digested with Smal and HindIll. The products of each digestion were cloned into the appropriate pGEM3 vector. After transformation of host bacteria and analysis of plasmids by restriction digestion, the rev and tat clones were found to be comprised of four size groups: 600, 700, 750, and 900 bp. To distinguish between cDNAs which might be the same size but encode different sequences, additional restriction analysis was performed (data not shown). Both the 700and 900-bp rev and tat bands contained clones of two different sequences (data not shown). Three unique sizes were found for env clones: 650,725, and 800 bp. The PCR-amplified cDNAs were sequenced by a double-stranded DNA sequencing method as described under Materials and Methods. Three unique clones which encoded only the rev reading frames were identified (Fig. 1C). One cDNA represented a doubly spliced mRNA (pREV25R), and the other two clones contained either of two non-coding exons upstream of the initiation codon for rev (Fig. 1C and also Fig. 2A). The latter clones thus contain three splices. The more upstream of these exons (nt 52 13-5285) was within the SlVmac POL gene approximately 50 bp 5’ of the initiation site of vif, and the more downstream exon (nt 5696-5772) was within vif approximately 50 bp 5’ to the initiation site of vpx. The splice acceptor site for all three was 15 nucleotides upstream of the start codon (AUG) for rev (Fig. 1C and also Fig. 2B). Three different mRNA clones, pREV55R, -33R, and -42R, were isolated, which encoded both the tat and rev reading frames (Fig. 1C). The splice acceptor site 5’ to the reading frames was 2 nt upstream of the AUG codon (nt 6303) for tat in all three clones (Fig. 1C and also Fig. 2B). One clone, pREV55R, was doubly spliced and the other two clones, pREV33R and pREV42R, were triply spliced, each containing one of the upstream exons described above for the rev-only mRNA transcripts. The presence of the upstream exon at nt 5213 to 5283 had a direct effect on down-stream splicing between the first and second exons of the reading frames. When this upstream sequence was present, there was a 3-nt shift in the splice acceptor site in the second exon of the rev and the rev and tat clones (pREV45R and pREV42R, respectively). This shift resulted in the deletion of one amino acid and a change in another amino acid at that site in the predicted sequences for rev and tat proteins (Fig. 2D).

180

UNGER, STOUT, AND

A.

9069

719 I

B.

PCR primers

{

S:/I:i

d SIV 106

=

-

I

516

c.

Clone

3 of mWA

pREV25R

64

pREV89R

5

I

SIV 50

6826

I I

I I

(28/44)

‘11

pREV45R

9

5285

6301

pREV55R

7

REV

695 bp

REV

688

REV

6616

1

(4/44)

619 bp

I

(2/44)

5213

Proteis

I

bp

8813

~32bp REV/TAT

(3/44) 8813

pREV33R

7

a

(3/44)

916bp REV/TAT 6816

pREV42R

E

9 (4/44)

901bp REV/TAT

516

6514

I

pENVlR

37

6626

I

(4/12) 516

pENV8R

18

(3/12)

pENV4R

45

(5/12)

575

I 794 bp

ENV

650bp

ENV

719

'(

m

ENV 3

722bp

FIG. 1. Schematic representation of SIVmacl Al 1 cDNA clones isolated by PCR amplification. (A) Genome organization of the open reading frames of SIVmac. Nucleotide positions were based on the sequence of SlVmac142 (Chakrabarti et a/., 1987). Positions at the 5’ end of genes are at the initiation codons, those at the 3’ end of rat and rev are at the stop codons. (B) Location of oligonucleotide primer pairs used for PCR amplification of fat and rev(SIV84/SIV106) and for env(SIV108/SIV58) transcripts. (C)Structure and sizes of cDNA clones forrev, revand tat, and env mRNA. The nucleotide positions of splice donor and acceptor sites are shown. The percentage of mRNA is the ratio of the number of clones of a particular mRNA isolated to the total number of clones screened. Since all rar and rev mRNA were amplified with the same PCR primer pair (as were all env mRNA), and since every transcript should be amplified with equal frequency by the PCR reaction, the number of clones of each mRNA reflects the relative abundance of that particular mRNA within the cell. PCR amplification, cloning, and sequencing were carried out as described under Materials and Methods.

Cloning and sequencing of cDNA for env Sequence analysis for the env clones revealed three different multiply spliced transcripts for env mRNA (Fig.

1C). All three have the same splice acceptor site 15 nt upstream of the initiation site of rev (also in the rev clones above) and contain the first exon of rev(Fig. 2C). The env clones differ in their upstream splicing pat-

SIMIAN

IMMUNODEFICIENCY

VIRUS AND COMPLEX

terns. The singly spliced clone (pENV1 R) did not contain the intron within the LTR previously reported by others (Colombini et al., 1989). pENV8R was identical to pENV1 R, except for the fact that it contains the intron within the LTR. The third clone, pENV4R, was unique in that it was multiply spliced and contained a noncoding exon (nt 52 13-5285) upstream of the major splice acceptor for the reading frame identical to those observed in the rev and tat clones and also contained the intron within the LTR. Functional

tests of SIV cDNA clones

The six rev and tat clones were subcloned into SV40 vectors and transfected into HUT-78 cells and GCT cells together with SIVl Al 1 LTR/CAT to determine their ability to transactivate (Table 1). The three spliced forms of tat did not differ significantly in their ability to transactivate the SIVl Al 1 LTR. Deletion of one amino acid, or the presence or the absence of the noncoding exons, did not significantly alter the ability of the expressed tat protein to transactivate. As expected, the three rev-only clones did not transactivate the SIV LTR. We have not assessed whether the six potential rev clones differ in their activities. DISCUSSION The PCR technique has been found to be extremely useful for the study of gene expression in viral and cellular systems. Even though the PCR technique may result in the formation of recombinant DNA molecules when plasmid DNA is used as a substrate (Meyerhans et a/., 1990) several recent studies have established the validity of this technique for the analysis of alternatively spliced mRNA. Felber et al. (1990) have used PCR to obtain DNA clones of spliced viral mRNA transcripts in HIV-l -infected cells and have confirmed the presence of the respective mRNA transcripts in HIV-1 infected cells by Sl nuclease protection assays and by the identification of the mRNA protein products. We have used the PCR technique to identify multiply spliced mRNA species for rev, tat, and env produced by a biologically active molecular clone of SIV, SIVmaclAl1 (Marthas et a/., 1989). The mRNA were cloned from HUT-78 cells chronically infected with SlVmacl Al 1 by reverse transcription of total RNA and by selective amplification using the PCR technique (Innis et al., 1990). A single oligonucleotide primer pair was used to amplify tat and rev transcripts. The primer pair was located at points that should have resulted in the amplification of all tat- and rev-containing transcripts. A primer pair for env transcript amplification was chosen so that only env transcripts were amplified: the 3’ primer was within the env gene at a position where there were no overlapping reading frames. The

SPLICING

FOR mRNA

181

rev, tat, and env transcripts were identified by cloning the amplified mRNA into pGEM3, by hybridization to specific oligonucleotide probes, by restriction mapping, and by their nucleotide sequence. These analyses demonstrated that mRNA splicing for tat and rev is complex and that env mRNA exist as multiply spliced transcripts. Three mRNAs with both tat- and rev-coding sequences were identified encoding a tat protein of either 130 or 129 amino acids and a rev protein of either 107 or 106 amino acids depending on the splice acceptor utilized in the second coding exon (see below). These mRNA were present in nearly equal frequencies. The nucleotide sequence for pREV33R was identical to that of a cDNA clone (Pl 1) previously described in SlVmac (Colombini et a/., 1989) although a different splice acceptor was utilized between the two coding exons. In addition, the initiation site for rev in our clones was 150 bases 3’ to that described for Pl 1 but agrees with the sites observed by others for SIV (Viglianti et al., 1990). Clone pREV45R has not been previously described for SIV. This mRNA contains a noncoding exon at nt 5213 to 5285, similar to what has been seen in HIV-1 mRNA for tat and rev (Schwartz et a/., 1990). However, a mRNA was described by Viglianti et a/., (1990) for SIVmacBK28 which contained both of the upstream noncoding sequences. Such an mRNA was not identified in this analysis of SlVmacl Al 1. However, it should be noted that these clones (Viglianti et al., 1990) were generated with a PCR primer within the first exon of tat, not with a primer at the end of the tat- or rev-coding exons, and that the splicing pattern between the two coding exons of tat and rev is unknown (see below). Three rev-only mRNAs were found (Fig. 1) that were identical to the rev and tat containing mRNA except that the major splice acceptor for the first coding exon was 15 nt 5’ to the initiation codon for rev instead of 5’ to the first coding exon of tat. The coding exons for rev encode proteins of either 107 or 106 amino acids depending on the splice acceptor utilized between the two coding exons. Our data agrees with Viglianti et a/. (1990) who find that the mRNA without the noncoding exon (pREV25R) is the major transcript in chronically infected HUT-78 cells. Colombini eta/. (1989) have sequenced a cDNA clone similar to pREV89R except that the more 3’ splice acceptor was utilized (Fig. 3) between the coding exons for rev (similar to that seen in pREV45R). Viglianti et al. (1990) did not find rev-only mRNA with the 5’ noncoding exon seen in pREV89R. They did, however, find a rev-only mRNA with a noncoding exon similar to pREV45R, although in their clone the splice acceptor between the coding exons was 3 nt 5’to that seen in pREV45R, the same as that seen in pREV25R and pREV89R. Similar rev-only mRNA with and without the noncoding exons up-

182

UNGER, STOUT, AND LUCIW

A.

SD-5285

5213-SA ~aaggcagagatcaactgtggaagggacccggtgagctattgtggaaaggggaaggagcagtcatcttaaag~

~~-5112

5696-SA ~gggagaagtgagaagggccatcaggagagaacaactgctgtcttgctgcaggttcccgagagctcataagtacca~

B.

6301-SA ~catggagacacccttgagggagcaggagaactcattagaatcctccagcgggcactcttcatgcacttc

TAT--M

E

T

P

LREQENS

S

LESSSGHS

C

T

S

agaggcggctgcatccactccagaattggccaacctgggggaagaaatcctctctcagctataccgccct E

AAA

S

LSQLYRP

TPELANLGEEI

ctagaagcatgctataacacatgctattgtaaaaagtgttgctaccattgccagttttgttttcttaaaa LEACYNTCYCKKCCY

HCQFCFLKK

6514 REV and ENV SA

aag~cttagggatatgttatgagcagtcacgaaagagaagaagaactccgaaaaaggctaaggctaatac RRRTPKKAKANT SHEREEELRKRLRLIH

GLGICYEQSRK REV--M SD-6598

S 8813-SA

atcttctgcatcaaaca~~agacccatatccaacaggacc=ggcactgccaaccagagaaggcaaagaag SSASNNRP L L H

Q

T

E

ISNRTRHCQP IDPYPTGPGTANQRRQRR

KAK

K

8913

gagacggtgcagaaggcggtggcaacagctcctggccttggcagatag~atatattcatttcctgatccg E

T V Q KAVATAPGLGR RRCRRRWQQLLALADRIYSFPDP

*--TAT

ccaactgatacgcctcttgacttggctattcagcaactggagaaccttgctatcgagagtataccagatc P

T

D

T

P

NLAIES

LDLAIQQLE

I

P D 9069

P

ctccaaccaatactccagaggctctctgcga=cctacgaaggattcgagaagtcct=aggctt~actc P

C.

T

N

T

P

E

A

L

C

D

P

T

KD

S

R

S

P

Q

A

*--REV

6514 ENV-SA

aagbcttagggatatgttatgagcagtcacgaaagagaagaagaactccgaaaaaggctaaggctaatac 6606

atcttctgcatcaaacaagtaagt~tgggatgtcttgggaatcagctgcttatcgccatcttg~ttttaag ENV--M

G

C

SD-6598

D.

L

G

N

Q

L

L

I

A

I

L

L

L

s

8813-SA

tcttctgcatcaaacaiitagacccatatccaacaggaccagg TAT--S REV--L

SASNNRPI L H Q

T

I

SD-6598

D

P

Y

S N R T R P T G P G

8816-SA

tcttctgcatcaaacaA***icccatatccaacaggaccagg TAT--S REV--L

SASNK*PI LHQTN*PYP

S

N T

R T R G P G

FIG. 2. Nucleotide sequences and amino acid sequences for tat, rev, and env mRNA from SlVmacl Al 1, The splice donor (SD) and splice acceptor (SA) sites were determined by nucleotide sequence analysis and comparison to the proviral sequence. (A) Sequence of noncoding

SIMIAN

IMMUNODEFICIENCY

VIRUS AND COMPLEX

stream of the initiation codon of rev have been described for HIV-1 (Schwartz et a/., 1990). They differ from SIV in not having the alternate splice acceptors between the coding exons of rev and in having two alternate splice acceptors 5’to the initiation site for rev. There appears to be a direct correlation between the presence of the noncoding exon at nt 52 13 to 5285 (pREV45R and pREV42R) and the splice acceptor utilized between the coding exons SlVmacl Al 1. When this noncoding exon was present in the mRNA, then the alternate splice acceptor site 3 nt 3’ to the “normal” splice acceptor site in the second coding exon was utilized for both tat and rev. This splice acceptor was within the same reading frame and resulted in a tat and rev protein change by deletion of one amino acid and in a change in one other at the splice site (Fig. 2D). No significant differences were seen, however, in the degree of tat protein transactivation of the SIV-LTR by the three different tat clones in transient expression assays (Table 1). We have not assessed whether rev protein function is altered by this change in splicing. Others (Colombini et a/., 1989; Viglianti and Mullins, 1988; Viglianti et al., 1990) have described alternate splice acceptor sites for tat and rev mRNA in SIV similar to the above and also another site 15 nt more 3’ than the normal splice acceptor site, although they did not find the correlation between the presence of the noncoding exon and the effects on splicing between the coding exons. Viglianti et al. (1990) have suggested that the noncoding exons may represent promiscuous splicing events resulting from inefficiency in viral splicing. However, the presence of a particular noncoding exon in SlVmacl Al 1, whether it is due to inefficiency in viral splicing or not, appears to directly affect splicing on c&-acting sequences as demonstrated in at least two different mRNAs. In a comparison of mRNA from SIVmacl Al 1, SIVmacBK28 (Viglianti et al., 1990) and HIV-1 (Robert-Guroff et al., 1990; Schwartz et a/., 1990), splicing 5’to the coding exons (the presence or the absence of noncoding exons) for tat and rev and rev-only transcripts in SIVmacl Al 1 more closely resembled what has been seen for HIV-l (Schwartz eta/., 1990). However, splicing at the first coding exons and between the coding exons for both SlVmac clones is conserved. Viglianti et al. (1990) did not find rev-only mRNA with the 5’ noncoding exon at nt 5696-5772 or tat and rev mRNA with the 5’ noncoding exon at nt 5213 to 5285 in SIVmacBK28. These differences may be due to the age of the chronically infected culture used for RNA isolation. Viglianti et a/. (1990) isolated RNA from cells 31 days postinfection whereas our RNA

SPLICING

FOR mRNA

183

was from 5 months postinfection. We have observed differences in ethidium bromide staining of agarose gels of PCR-amplified cDNA from RNA isolated from acutely infected cultures (7 days postinfection, data not shown). We found three different singly and multiply spliced mRNAs for env mRNA. The mRNA for env used the same major splice acceptor site as rev, 15 nt upstream from the initiation codon for rev. Thus the transcripts encoding env contain the first exon of rev. We found mRNA for env that either did or did not contain the intron within the LTR previously described for tat and rev mRNA (Colombini eta/., 1989). In addition, we have demonstrated env mRNA with a noncoding exon upstream of the major splice acceptor site for the coding exon identical to those seen for rev and tat mRNAs. These transcripts appear to be present in chronically infected cells in equal frequencies. It is not known what influence the noncoding region has on envexpression. This is the first report of multiple splicing events for env mRNA. Only singly spliced mRNA for env have been described in HIV-1 (Arrigo et al., 1990). Since we were interested in downstream splicing events, we selected a 5’ PCR primer for amplification of tat and rev mRNA that was 3’to an intron located within the LTR region described for SlVmac mRNA by Colombini et al. (1989) to avoid having to sort through clones which might exist with and without this intron. Both spliced and unspliced LTR mRNA for env with approximately equal frequency were found in SIVmacl Al 1 by using a 5’ primer at the CAP site; this result suggests that transcripts exist in both spliced and unspliced LTR forms. Thus, one may predict at least 12 different mRNAs encoding rev and 6 encoding tat for SIVmaclA1 1. In support of this possibility, ethidium bromide-stained agarose gels from PCR amplifications with primers SIV108 and SIV106 (amplification from the CAP site to the 3’ end of rev) showed eight bands instead of the four noted with SIV84/106 (data not shown). Viglianti et a/. (1990) found identical mRNA for tat and rev that differed only by splicing of the intron in the LTR. This splicing event seems to be unique to SIV and has not been found to occur in HIV-1 (RobertGuroff et a/., 1990; Schwartz et a/., 1990). All the tat, rev, and env mRNA used the same major subgenomic splice donor at the 5’ LTR (nt 998). In addition, nearly all splice donor and splice acceptor sites in SlVmacl Al 1 (Fig. 3A) were conserved in the different SIV mRNA splice sites previously described (Colombini et al., 1989; Viglianti and Mullins, 1988; Viglianti et a/., 1990). The splice acceptor for rev/env in SIVmacl Al 1

exons 5’to the coding exons for tat, rev, and env genes. (B) Sequences for the coding exons for fat and rev mRNA. (C) Seauence for the 5’end of env mRNA including-the splice acceptor site. (D) Sequence between the codrng exons for tar and rev mRNA comparing ammo acid sequence when the alternate splrce acceptor site is utilized. An asterisk (*) indicates deletton of a nucleotide or an amino acid.

184

UNGER, STOUT, AND LUCIW

TABLE 1 TRANSACTIVATIONOF THE SIVmacl Al 1 LTR BY tat AND rev CLONES Cell type GCT

HUT-78 Transfected LTR/CAT LTRICAT LTR/CAT LTR/CAT LTR/CAT LTR/CAT LTR/CAT LTR/CAT

plasmida

+ + + + + + + +

Relative activityC

cpm*

pSP73 pSV25R-9 pSV89R-7 pSV45R-6 pSV55R-9 pSV33R-8 pSV42R-6 HIVTAT

5.7 3.7 3.4 6.3 1.8 1.8 1.3 1.3

x x x x x x x x

1 0.6 0.5 1.1 31 32 23 23

lo4 lo4 lo4 lo4 lo6 lo6 lo6 lo6

Relative activity

wm 8.4 2.2 2.6 3.0 7.4 1.0 6.3 5.8

X x X x x x X X

lo3 lo4 lo4 lo4 lo5 106 lo5 lo5

1 3 3 4 88 129 75 70

B Transfections into HUT-78 and GCT cells were performed in parallel with the indicated plasmids as described under Materials and Methods. * CAT enzymatic activities of transfected cell extracts are given in counts per minute (cpm). Values represent the average of two transfections. Variation was less than 15%. c Relative activity represents the relative levels of stimulation in CAT activity by the various clones compared to transfection with SIV LTR/CAT alone (arbitrarily set at 1).

differed from that described for SIVmacBK28; it was shifted by a single base pair (Fig. 3B). It is not known whether this shift results in a different reading frame for

A.

SPLICE

575 998 5285 5772 6598

SPLICE

719 5213 5696 6301 6514 8813 8816

DONORS

CAG/GTAGAG CAG/GTAAGT AAG/GTAGGA CAG/GTACCA CAA/GTAAGT C AAG/GT;AGT

LTR intro" Major subgenomic Non-coding exe" Non-coding exe" tat/rev cO"Se"S"S sequence

ACCEPTORS

CCATCTCTCCTAG/TCG TCATTACAG/AGA CCCTTGCTTTACAG/CGG CATATCTATAATAG/ACA TTTTCTTWGG/GCT CTCTTATTTCCAG/TAG CTCTTATTTCCAGTAG/ACC

LTR intro" Non-coding exon Non-coding exe" tat rev/env second exe" tat/rev alternate second exe" tat/rev

T C tc) nNTAG/G

6514 6488

TTTTCTTAAAAAAGG/GCT TGTTTTCTTAMAAG/GGA

SIVmaclAll SIVmacBK28 1990) al.,

(this study) (Viglianti et

FIG. 3. Nucleotide sequences of the splice sites of the rev, fat, and env mRNA in SlVmacl Al 1, (A) The cDNA clones for the various mRNA were sequenced as described under Materials and Methods, and splice donor and splice acceptor sites were determined by comparison to the nucleotide sequence of the proviral clone. Consensus sequences for splice donor and splice acceptor sites were as described by Mount (1982). (B) Comparison of nucleotide sequences for nonconserved splice acceptor sites for rev/env mRNA in SIVmaclAl1 and SIVmacBK28.

SIVmacBK28. However, our nucleotide sequence and the translated amino acid sequence are nearly identical with that shown by Colombini et al. (1989) for their cDNA clone. It is obvious that mRNA splicing for tat, rev, and env is complex. Although there is a high degree of relatedness between mRNA splicing of SIVmacl Al 1 and SIVmacBK28 (Viglianti et al., 1990), some major differences are seen. This is also true for different clones of HIV-1 (Arrigo eT a/., 1990; Guatelli et a/., 1990; RobertGuroff et al., 1990; Schwartz et a/., 1990). These differences could be due to cells used for infection, time of harvest, or different nucleotide sequence of specific virus strains. Side-by-side comparisons of different clones under identical conditions will help to clarify the cause of these differences. The effects of mRNA splicing patterns on protein expression, on virus replication and regulation, and on pathogenesis remain to be resolved. The availability of pathogenic and nonpathogenie molecular clones for SIV make the SIV system a useful model for relating molecular aspects of viral replication to pathogenesis in the infected host. ACKNOWLEDGMENTS We thank P. Barry for helpful discussions and critical reading of the manuscript. We are grateful to K. Shaw for synthesis of oligonucleotides, and to E. Pratt-Lowe and T. Mulvaney for transfection and CAT assays. The research in this report was supported by HL43609 from the National Heart, Lung, and Blood Institute (NHLBI). R.E.U. was supported by a postdoctoral training grant (HL07013) from NHLBI to Dr. Carrol Cross (Division of Pulmonary Medicine, UCD Medical Center). P.A.L. was a recipient of an Investigator Award from the Universitywide Task Force on AIDS from the State of California.

SIMIAN

IMMUNODEFICIENCY

VIRUS AND COMPLEX

REFERENCES ARRIGO, S. J., WEITSMAN, S., ZACK, J. A., and CHEN, I. S. Y. (1990). Characterization and expression of novel singly spliced RNA species of human immunodeficiency virus type 1.1. Viral. 64, 4585 4588. BARRY, P., PRA’IT-LOWE, E., and LUCIW. P. A. (1989). Electroporation of T-cell and macrophage cell lines. “Bulletin 1349.” Bio-Rad Laboratories, Richmond, CA. BARRY, P. A., PRAY-LOWE, E., PETERLIN. B. M., and LUCIW, P. A. (1990). Cytomegalovirus activates transcription directed by the long terminal repeat of human immunodeficiency virus type 1. J. Viral. 64, 2932-2940. BENKO, D. M.. SCHWARTZ, S., PAVLAKIS, G. N.. and FELBER, B. K. (1990). A novel human immunodeficiency virus type 1 protein, tev, shares sequences with tat, env, and rev proteins. J. Viral. 64, 250552518. CHAKRABARTI, L., GUYADER, M., ALIZON, M., DANIEL, M. D., DESROSIERS.R. C., TIOLLAIS, P., and SONIGO, P. (1987). Sequence of simian immunodeficiency virus from macaque and its relationship to other human and simian retroviruses. Nature 328, 543-547. CHANG, D. D.. and SHARP, P. A. (1990). Messenger RNA transport and HIV rev regulation. Science 249, 614-615. CHOMCZYNSKI, P., and SACCHI, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate+phenol-chloroform extraction. Anal. Biochem. 162, 156-159. COLOMBINI, S., ARYA, S. K., REITZ, M. S., JAGODZINSKI.L., BEAVER, B., and WONG, S. F. (1989). Structure of stmian immunodeficiency virus regulatory genes. Proc. Nat/. Acad. Sci. USA 86,4813-4817. CULLEN, B. R., and GREENE,W. C. (1989). Regulatory pathways govermng HIV-l replication. Cell 58, 423-426. DAEFLER,S., KLOTMAN. M. E., and WONG, S. F. (1990). Trans-activatIng rev protein of the human immunodeficiency virus 1 interacts directly and specifically with its target RNA. Proc. Nat/. Acad. Sci. USA 87,4571-4575. DILLON, P. J., NELBOCK, P., PERKINS, A., and ROSEN, C. A. (1990). Function of the human immunodeficiency virus types 1 and 2 Rev proteins is dependent on their ability to interact with a structured region present in env gene mRNA. J. Viral. 64, 4428-4437. EMERMAN, M., VAZEUX, R., and PEDEN, K. (1989). The rev gene product of the human immunodeficlency virus affects envelope-specific RNA localization. Ce// 57, 1155-l 165. FELBER,B. K., DRYSDALE,C. M., and PAVLAKIS,G. N. (1990). Feedback regulation of human immunodeficiency virus type 1 expression by the Rev protein. J. Viral. 64, 3734-3741. FRANCHINI, G., and BOSCH, M. L. (1989). Genetic relatedness of the human immunodeficlency viruses type 1 and 2 (HIV-l, HIV-2) and the slmlan immunodeficlency virus (SIV). Ann. N. Y. Acad. Sci. 554, 81-87. GUATELLI,J. C., GINGERAS,T. R., and RICHMAN, D. D. (1990). Alternattve splice acceptor utilization during human immunodeficiency virus type 1 infection of cultured cells. /. Viral. 64, 4093-4098. HAMMARSKJOLD,M. L., HEIMER, J., HAMMARSKJOLD, B., SANGWAN, I., ALBERT, L., and REKOSH. D. (1989). Regulation of human immunodeficiency virus env expression by the rev gene product. /. l/ire/. 63, 1959-l 966. HASELTINE,W. A. (1988). ln “The Control of Human Retrovirus Gene Expression” (B. R. Franza Jr., B. R. Cullen, and F. Wong-Staal, Ed.). Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. HEAPHY, S., DINGWALL, C., ERNBERG, I., GAIT, M. J., GREEN, S. M.,

SPLICING

FOR mRNA

185

KARN, J., LOWE, A. D., SINGH, M., and SKINNER,M. A. (1990). HIV-1 regulator of virion expression (Rev) protein binds to an RNA stemloop structure located within the Rev response element region. Cell 60, 685-693. HIRSCH, V., RIEDEL. N., and MULLINS, J. I. (1987). The genome organization of STLV-3 is similar to that of the AIDS virus except for a truncated transmembrane protein. Cell 49, 307-3 19. Ho, D. D., POMERANTZ,R. J., and KAPLAN,J. C. (1987). Pathogenesis of infection with human immunodeficiency virus. N. Engl. J. Med. 317,278-286. INNIS, M. A., GELFAND, D. H., SNINSKY,1. J., and WHITE. T. J. (1990). “PCR Protocols. A Guide to Methods and Applications.” Academic Press, San Diego, CA. KIM, S. Y., BYRN, R., GROOPMAN, J., and BALTIMORE, D. (1989). Temporal aspects of DNA and RNA synthesis during human immunodeficiency virus infection: Evidence for differential gene expression. 1. Viral. 63, 3708-3713. KORNFELD, H., RIEDEL, N., VIGLIANTI, G. A., HIRSCH, V., and MULLINS, 1. I, (1987). Cloning of HTLV-4 and its relation to simian and human immunodeficiency viruses. Nature 326, 61 O-61 3. MALIM, M. H., HAUBER, J., LE, S. Y., MAIZEL, J. V., and CULLEN, B. R. (1989). The HIV-1 rev trans.activator acts through a structured target sequence to activate nuclear export of unspliced viral mRNA. Nature 338, 254-257. MARTHAS, M. L., BANAPOUR. B., SUTJIPTO,S., SIEGEL, M. E., MARX, P. A., GARDNER, M. B., PEDERSEN,N. C., and LUCIW. P. A. (1989). Rhesus macaques Inoculated with molecularly cloned simian immunodeficlency virus. /. Med. Primatol. 18, 31 l-3 19. MEYERHANS,A., VARTANIAN. J.-P., and WAIN-HOBSON. S. (1990). DNA recombination during PCR. Nucleic Acids Res. 18, 1687-l 69 1. MOUNT, S. M. (1982). A catalogue of splice junction sequences. Nucleic Acids Res. 10, 459-472. NORDEEN, S. K., GREEN, P. P. I., and FOWLKES,D. M. (1987). A rapid, sensitive, and inexpensive assay for chloramphenicol acetyltransferase. DNA 6, 173-l 78. PETERLIN,B. M., LUCIW, P. A., BARR, P. I., and WALKER, M. D. (1986). Elevated levels of mRNA can account for the transactivation of human lmmunodeficiency virus. Proc. Nat/. Acad. Sci. USA 83, 9734-9738. ROBERT-GUROFF,M., POPOVIC, M., GARTNER,S., MARKHAM, P.. GALLO, R. C., and REITZ. M. S. (1990). Structure and expression of tat-, rev-, and nef-specific transcripts of human immunodeficiency virus type 1 in infected lymphocytes and macrophagesd Viral. 64, 3391-3398. ROSENBERG,Z. F.. and FAUCI, A. S. (1989). The immunopathogenesis of HIV infectton. Adv. Immunol. 47, 377-431. SANGER, F., MIKLEN, S., and COULSON, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Nat/. Acad. Sci. USA 74, 5463-5467. SCHWARTZ,S., FELBER,B. K., BENKO, D. M., FENYO, E. M.. and PAVLAKIS, G. N. (1990). Cloning and functional analysis of multiply spliced mRNA species of human immunodeficiency virus type 1. /. Virol. 64, 2519-2529. VIGLIANTI, G. A., and MULLINS, J. I. (1988). Functional comparison of transactivatlon by simian immunodeficiency virus from rhesus macaques and human immunodeficiency virus type 1. J. Viral. 62, 4523-4532. VIGLIANTI, G. A., SHARMA, P. L., and MULLINS, J. I. (1990). Simian immunodeficiency virus displays complex patterns of RNA splicing. J. Viral. 64, 4207-4216.