Article pubs.acs.org/JAFC

Simultaneous Detection of RNA and DNA Targets Based on Multiplex Isothermal Amplification David Dobnik,*,†,§ Dany Morisset,†,‡,§ Rok Lenarčič,† and Maja Ravnikar† †

Department of Biotechnology and Systems Biology, National Institute of Biology, Večna pot 11, Ljubljana 1000, Slovenia S Supporting Information *

ABSTRACT: The detection of pathogenic microorganisms present in food, feed, plant, and other samples is important for providing safe food as well as for preventing the spread of microbes. The genome of pathogens is made of DNA or RNA, therefore a multiplex diagnostics tool would ideally be able to amplify and detect both RNA and DNA targets in parallel. With this goal we have developed an isothermal nucleic acid sequence based amplification [NASBA] implemented microarray analysis (NAIMA) procedure, suitable for the simultaneous multiplex amplification of RNA and DNA targets, coupled with the detection on ArrayTubes. The method is demonstrated to be very sensitive and specific for the detection of two economically important quarantine plant pathogens of potato, the potato spindle tuber viroid (RNA target) and Ralstonia solanacearum (DNA target). Because of its isothermal amplification and simple detection equipment, the method is also applicable for on-site analyses. NAIMA can be used in any domain where there is the need to detect RNA and DNA targets simultaneously. KEYWORDS: NAIMA, isothermal, multiplex amplification, array hybridization, PSTVd, Ralstonia solanacearum

■

Protection Organization (The Netherlands) (Supporting Information Table S1). Total RNA (which included viroid RNA) was extracted from infected fresh leaves or tuber tissue (200 mg per isolation) or from lyophilized infected plant material (20 mg per isolation) using RNeasy Plant Mini kits (QIAGEN, Valencia, CA) as previously described.10 The bacterial strains (Supporting Information Table S2) were grown on YPGA agar plates and incubated at 28 °C for two days. A single colony of each bacterial strain was then resuspended in 10 mM phosphate-buffered saline (PBS, pH 7.2) at a final concentration of 108 cells/mL, according to turbidity measurements (DEN-1B McFarland densitometer, Biosan, Riga, Latvia). The bacterial suspensions were incubated at 95 °C for 30 min in a thermal block to lyse the cells and to release the DNA, followed by serial decimal dilutions in distilled water (108−10 cells/mL). DNA for specificity tests was purified from the lysate using DNeasy plant mini kit (QIAGEN, Valencia, CA) as described by the manufacturer and using 200 μL of lysate as the starting material. The DNA dilutions were stored at −20 °C until analysis, but no longer than one month to reduce the possibility of DNA degradation. Samples for multiplex amplification were prepared by mixing total RNA extracted from plant tissues with DNA extracted from bacteria. Design of NAIMA Primers and Microarray Probes. Primer Design. The oligonucleotide primers used in the NAIMA procedure were designed based on published DNA and RNA sequences of the target and nontarget (but related or control) pathogens, using the Beacon Designer software (Premier Biosoft International Inc., Palo Alto, CA), and their secondary structure was analyzed using the DINAMelt Server (http://frontend.bioinfo.rpi.edu/applications/ hybrid/).11 The R. solanacearum amplicon was designed on the 16S rRNA gene sequence, and the PSTVd amplicon was designed on the most highly conserved part of the sequence (as previously described12), both being the regions targeted by the singleplex (RT-)qPCR methods used in official PSTVd and R. solanacearum

INTRODUCTION The key challenge when screening for a large panel of targets (e.g., for plant pathogens) is the simultaneous amplification and detection of different types of target nucleic acids, as RNA and DNA, in a multiplex fashion. Protocols available for simultaneous amplification and detection of RNA and DNA targets usually consist of two-step procedures, where reverse transcription is followed by PCR amplification.1−3 Previously, we developed a method called NAIMA (nucleic acid sequence based amplification [NASBA] implemented microarray analysis),4 which is appropriate for multiplex detection of DNA targets. This was designed based on the NASBA method, which mimics retroviral replication and is suitable for RNA amplification.5 As the performances of multiplex amplification of DNA targets are comparable to singleplex quantitative realtime PCR (qPCR) reactions,4,6 we took a step forward and developed a new three-step NAIMA procedure that is suitable for simultaneous multiplex amplification and detection of both RNA and DNA targets. The three NAIMA steps include: template synthesis, NASBA amplification, and detection on ArrayTubes, with custom-designed probes. As a proof of principle, we focus here on two important plant pathogens, the potato spindle tuber viroid (PSTVd) and Ralstonia solanacearum. Both of these pathogens can infect a variety of plant species, including the economically important potato and tomato;7,8 therefore, special quarantine measures (e.g., at import points, with storage, on plantations) need to be taken to limit their spread.9 Hence, a simple method that allows the detection of both of these pathogens would present a significant improvement in their control.

■

MATERIALS AND METHODS

Received: Revised: Accepted: Published:

Test Material (Viroids and Bacteria). Starting materials for isolations of viroids were obtained from a collection at the Food and Environment Research Agency (UK) and from the National Plant © 2014 American Chemical Society

2989

January 14, 2014 March 12, 2014 March 13, 2014 March 13, 2014 dx.doi.org/10.1021/jf5002149 | J. Agric. Food Chem. 2014, 62, 2989−2996

Journal of Agricultural and Food Chemistry

Article

Table 1. Primers and Probes Used in the NAIMA, qPCR and Microarrays primers used for NAIMA target

orientation

name

PSTVd

antisense sense

T7-NAIMA-pstvda SP6-NAIMA-pstvdb

T7- TGCGGTTCCAAGGGCTAAAC SP6-CTGTCGCTTCGGCTACTACC

this study

R. solanacearum

antisense sense

T7-NAIMA-Rsa SP6-NAIMA-Rsb

T7- GGCCTTGCGGTCCCCCACT SP6- TGGCGGCATGCCTTACACA

this study 14

T7-universalc SP6-universald

AATTCTAATACGACTCACTATAGGGAGATCCAATAGAATCACATCGCTTACAAGGCAAT CATACGATTTAGGTGACACTATAGAA capture probes present on the microarray

4

T7-sequence SP6-sequence target

sequence (5′−3′)

name

sequence (5′−3′)

PSTVd

PSTVd-NAIMA-1 PSTVd-NAIMA-2 PSTVd-NAIMA-3

R. solanacearum

Rs-NAIMA-16S/1 Rs-NAIMA-16S/2 Rs-NAIMA-16S/3

target

CTTCTATCTTACTTGCTTCGGGGCGAGGGT TCTTACTTGCTTCGGGGCGAGGGTGTTTAG TACTTGCTTCGGGGCGAGGGTGTTTAGC GTGAGTAATACATCGGAACGTGCCCTGTAGTG CTTACACATGCAAGTCGAACGGCAGCGG GGTAGCTTGCTACCTGCCGGCGAGT primers used for TaqMan qPCR

refs

refs this study

this study

orientation

name

sequence (5′−3′)

refs

PSTVd

antisense sense probe

Rv_Taq_viroid Fw_Taq_viroid Probe_Taq_viroid

CGGTTCCAAGGGCTAAACAC CTGTCGCTTCGGCTACTACC FAM-AACAACTGAAGCTCCCGAGAACCGC-TAMRA

this study

R. solanacearum

antisense sense probe

RS-II-R RS-I-F RS-P

GGCACGTTCCGATGTATTACTCA GCATGCCTTACACATGCAAGTC FAM- AGCTTGCTACCTGCCGGCGAGTG-TAMRA

13

a

All antisense primers used in NASBA contain the T7-cap sequence that is designed so that the T7 segment is bound to the 5′-end in addition to the given sequence. bAll sense primers used in NASBA contain the SP6 sequence that is designed so that the SP6 is bound to the 5′-end in addition to the given sequence. cThe T7-cap extension primer is composed of the T7-RNA polymerase promoter sequence (5′-end) and an abiotic cap sequence (3′-end, in italic) dThe SP6-extension primer differs from the SP6 sequence used in sense primers in that it lacks the first four nucleotides (in bold) contained in the latter sequence. diagnostics at the National Institute of Biology.10,13 All of the primers were submitted to BLAST against different databases (only R. solanacearum, all Ralstonia without R. solanacearum, no Ralstonia, PSTVds, all viroids, plant) to obtain the selection of the most specific and selective primers. The primers for the multiplex template synthesis reaction were designed by addition of universal tail sequences to the target-specific sequences, as previously reported.4 The primers designed for the NAIMA procedure are listed in Table 1. For R. solanacearum, the primers were highly similar (one additional nucleotide was inserted at the 3′ region of the antisense primer) to those previously described.14 The universal primers for the second step of amplification are the same as previously reported.4 The primers were synthesized and HPLC-purified by MWG Biotech AG (Eurofins MWG, Ebersberg, Germany). The experimental specificity of the primers and probes was assessed on samples of different species (Table 2, Table 4). Design of Microarray Probes. The ArrayTube platform consists of a custom microprobe array integrated into a microreaction vial. The probes for the ArrayTubes (Alere Technologies, Jena, Germany) were designed in the region amplified by the NAIMA reactions. Briefly, windows of 30 nucleotides (±3 nucleotides) with a calculated Tm of 65 °C (±1 °C) were slid onto the NAIMA amplicon sequences with increments of 3 nucleotides. All of the candidate probe sequences were submitted to BLAST against different databases (as for the primer design). The candidates with best hits against the target (identity, similarity, lowest E-values) and the least number of hits were selected (and/or less significant scores; i.e., high E-values). The selected sequences were then checked for secondary structure (M-fold, at 55 °C), and those with no significant structure (ΔG positive or only slightly negative; i.e., ΔG > −1 kcal/mol) were finally chosen. For

Ralstonia species, the selection was made from the best ones, as specific as possible for R. solanacearum (for one probe), and for Ralstonia genus for the other two. NAIMA Amplification Setup. First Step: Multiplex Template Synthesis. This first step consisted of a multiplexed template synthesis reaction, during which several pairs of tailed primers annealed to the specific DNA or RNA target and were extended to produce DNA templates bound to the universal regions (Figure 1). For this, 5 pmol of each of the SP6-specific and T7-specific tailed primers (i.e., two pairs of tailed primers for duplex NAIMA), 100 U SuperScriptII reverse transcriptase (Invitrogen, Carlsbad, CA), 10 mM dithiothreitol (Invitrogen, Carlsbad, CA), 1× First-Strand buffer (Invitrogen, Carlsbad, CA), 1 mM dNTP (Promega, Fitchburg, WI), and 5 μL of RNA, DNA, or RNA/DNA mixture were mixed in a final reaction volume of 10 μL. Template synthesis was carried out for 30 min at 42 °C in a Gene Amp PCR system 9700 (Applied Biosystems, Foster City, CA). The final product of this reaction (independently of whether the target is RNA or DNA) is the DNA template consisted of target region, tailed with universal sequence that is crucial for universal NASBA amplification step. Second Step: Universal NASBA Amplification. The DNA templates from the first step were used directly in the NASBA amplification step (Figure 1) as follows: 2 μL template DNA from the first step was added to 5 μL of resuspended 2× NASBA Reaction Buffer Accusphere (Life Sciences Advance Technologies, St. Petersburg, FL) and mixed with 0.5 μL of the universal primers (T7 universal primer, SP6 universal primer; each at 50 μM). When the product was to be hybridized to the ArrayTube, an additional 1.1 μL of bio-UTP (Ambion; Foster City, CA) was added to the reaction mixture. This mixture was preincubated at 95 °C for 15 min and then incubated at 2990

dx.doi.org/10.1021/jf5002149 | J. Agric. Food Chem. 2014, 62, 2989−2996

Journal of Agricultural and Food Chemistry

Article

Figure 1. Schematic representation of the NAIMA amplification. The NAIMA amplification consisted of two steps: template synthesis and NASBA amplification. In the template synthesis step, the NAIMA tailed primers with sequence complementary to the target and the 5′-end sequences necessary for the multiplex amplification bind to the target (1) and are extended by the reverse transcriptase (2), producing the DNA templates for all of the targets present with identical 5′-ends (3). These templates were used in the amplification step, where T7 RNA polymerase transcribed them into several copies of antisense RNA molecules (4), and they were further reverse transcribed into single-stranded sense DNA (ssDNA) (5,6) to form an RNA−DNA duplex. The RNA−DNA duplex was later degraded by RNase H activity (7), and the ssDNA was then used as a template by the reverse transcriptase, followed by T7-cap-extension primer annealing (8) to synthesize a second DNA strand (9). These dsDNAs enter new cycles of amplification. The main product of the NAIMA amplification was antisense cRNA. Only one pair of primers was needed in this amplification step for all of the targets to be amplified. 41 °C for 2.5 min in a Gene Amp PCR system 9700 (Applied Biosystems, Foster City, CA). Afterward, 2.5 μL of resuspended NASBA Enzyme Accusphere (Life Sciences Advanced Technologies, St. Petersburg, FL) was added. NASBA Enzyme Accusphere is a cocktail of following enzymes: AMV reverse transcriptase (3.2 units/ reaction), RNase H (0.04 units/reaction), and T7 RNA polymerase (16 units/reaction). The reactions were incubated at 41 °C for 40 min in a Gene Amp PCR system 9700. Determination of NAIMA Amplification Performance and Monitoring with qPCR. The main final product of NAIMA amplification is cRNA. To estimate the amplification rate of the multiplex NAIMA amplification with qPCR, reverse transcription was performed on the NAIMA amplification products to obtain doublestranded cDNA, as previously described.4 The primers and probes used for the qPCR detection of PSTVd and R. solanacearum are listed in Table 1. The qPCR reaction setup followed recommendations described by Cankar et al.,15 and the reactions were performed as in Morisset et al.4 using reverse-transcribed NAIMA amplification products and control samples (R. solanacearum DNA or reversetranscribed PSTVd samples) (see workflow in Supporting Information Figure S1). Two dilutions of each sample were used in the qPCR, and each dilution was assayed in duplicate. The results were analyzed using the SDS 2.3 software (Applied Biosystems, Foster City, CA), after an automatic adjustment of the baseline and manual adjustment of the fluorescence threshold. The signals were considered positive if the Cq value was 0.95.

■

and issues with possible nonspecific background amplification.16 Three different primer−pair combinations were initially designed for each pathogen target (data not shown), from which the best combination (Table 1) was chosen based on their amplification efficiencies. Likewise, different amplification protocols were initially tested for singleplex assays to obtain optimal amplification efficiency and sensitivity. Briefly, the changes included a combination of the following parameters: elimination of the denaturation step, supplying the reaction with additional reverse transcriptase enzyme, and performing both steps of the reaction in one tube. Amplification of R. solanacearum was not affected by changes in the protocols, whereas PSTVd amplification was shown to be more sensitive to these protocol modifications. Namely, no amplification was observed for PSTVd when the reverse transcriptase was absent from the reaction. Moreover, the absence of denaturation before NAIMA amplification decreased its efficiency. Thus, the selected protocol is the one that provides the optimal amplification efficiencies of both of these targets. The efficiencies of this duplex assay were assessed with the protocol that was optimal for both singleplex assays. For the custommade ArrayTubes, three different probes were designed for each target (Table 1). For R. solanacearum, one targeted an R. solanacearum-specific region of the 16S rRNA gene (RsNAIMA-16S/3) and the two others targeted less specific sequences of the same gene, which shares a common pattern with bacteria closely related to R. solanacearum. The sensitivity of the PSTVd RNA amplification in the singleplex NAIMA reactions was estimated to be from 250 to 2500 copies, four times higher than the conventional RTPCR12,17 and approximately 25 times lower than the reverse transcriptase (RT)-qPCR,10 and for R. solanacearum, the sensitivity was 104 cells/mL, which is slightly lower than for the qPCR assay, where it was set between 102 and 104 cells/ mL.13 The same sensitivity for both targets was achieved when the multiplex reactions (containing both sets of primers) were

RESULTS AND DISCUSSION

In the course of the method development (Supporting Information Figure S2), the NAIMA amplification (template synthesis together with NASBA amplification, Figure 1) efficiency was always measured using qPCR as an independent assessment technique, where relative differences in the amounts of target before and after the NAIMA amplification were compared (Supporting Information Figure S1). The qPCR assay used for checking the R. solanacearum is routinely used in R. solanacearum diagnostics.13 The sensitivity and specificity of the amplification were evaluated at different experimental stages and at two different procedure steps: after NAIMA amplification and after product hybridization on the microarray. Primer design is of key importance, especially in multiplex reactions, due to the complexity of primer−pair combinations 2992

dx.doi.org/10.1021/jf5002149 | J. Agric. Food Chem. 2014, 62, 2989−2996

Journal of Agricultural and Food Chemistry

Article

performed in the presence of each single target. This is the expected situation when testing actual samples, in which only one of the pathogens is usually present. Nevertheless, we also tested the sensitivities of the multiplex reactions in the presence of both targets in four parallel situations using asynchronous target concentrations, where the pathogens titers were not equal. In these cases, the multiplex amplification efficiency for R. solanacearum dropped significantly when the target concentration was close to or at the limit of detection of the respective NAIMA system, irrespective of the concentration of the PSTVd target in the sample (Figure 2). These results suggest that when the R. solanacearum target is at the limit of detection, the amplification is affected by the presence of the PSTVd target. Of note, the sensitivity of the R. solanacearum qPCR assay was lower than most of the other qPCR assays that are commonly used in our laboratory for routine plant health detection (data not shown). This lower qPCR sensitivity can therefore be correlated with the observed drop in the NAIMA amplification efficiency for the R. solanacearum system in the multiplex mode. Anyway, in the cases where the amplification was successful for R. solanacearum at this limit situation, it was as efficient as in the other reactions (Figure 2). However, we have shown that in the rare case where both of these targets are in the same plant sample, the NAIMA duplex would allow the detection of at least one of them and thus would trigger further analysis for quarantine-pest confirmation, with an alternative approach. The specificities of both systems were tested on several PSTVd isolates and other related viroids (Supporting Information Table S1) as well as on several R. solanacearum strains and other nontarget and potentially cross-reactive strains (as listed in European Union Council Directive 2000/29/EC)9 (Supporting Information Table S2). Moreover, we tested NAIMA on denatured bacterial suspensions without any DNA isolation and purification. The specificity of the singleplex and multiplex NAIMA assays was also compared to that of the singleplex qPCR.13,17 The NAIMA assays showed suitable specificity for their respective targets, which matches the performance of the qPCR (Table 2). For practical reasons, and as the microarrays were already shown to be suitable for detection of multiplex amplification products,18−21 we have coupled the multiplex NAIMA amplification to product detection on microarrays. To do so, custom-made ArrayTubes were chosen, as this technology allows simple and relatively fast hybridization procedures. Moreover, the ArrayTubes can be scanned using a small and inexpensive benchtop machine, the ATR03 ArrayTube reader (Alere Technologies). To enable visualization of the hybridized products on the arrays, biotin was incorporated into the NAIMA amplification product. To do so, several ratios of different concentrations of biotinylated UTPs (bio-UTPs) versus nonbiotinylated UTPs were evaluated during the NAIMA reactions, with the focus on the amplification efficiency. None of the tested bio-UTP concentrations negatively affected the NAIMA amplification (data not shown), and therefore the highest tested concentration (1 mM, 20% of the total UTPs in the reaction) was used to maximize the final signal. All of the NAIMA products were checked with qPCR in parallel to the hybridization for confirmation of the array readings. The sensitivity of the ArrayTubes detection platform was compared to that of the previously measured NAIMA amplification. For the PSTVd amplicon, similar sensitivity was

Table 2. Specificity of the NAIMA Amplification Step as Compared to qPCRe

a

qPCR results presented are for control samples that were not subjected to NAIMA amplification (see workflow in Supporting Information Figure S1). bDifferent isolates of the same species were tested and all showed the same result. cR. syzigii and blood-disease bacterium are part of the R. solanacearum species complex phylotype 4. d One out of two samples was positive. e+, target was successfully amplified and detected; −, target was not amplified and not detected.NAIMA targets are indicated with a clear background, nontarget organisms are indicated with the gray background. R. solanacearum-negative samples, samples of Clavibacter michiganensis DNA, used as the R. solanacearum-negative sample.

observed (250−2500 RNA copies), which is comparable to RTPCR,12,17 and about 25 times lower than for RT-qPCR10 (Table 3). For the R. solanacearum amplicon, the sensitivity of the ArrayTubes detection (106 cells/mL) is about two log units lower than the NAIMA amplification sensitivity, which shows a loss of signal (Table 3) that probably occurs due to the lower numbers of incorporated biotinylated UTPs that is caused by the packed structure of the DNA chromosome. However, on the basis of the experience in our laboratory that shows that asymptomatic R. solanacearum infections of potato tubers show bacterial concentrations of 106 CFUs/mL (unpublished data), the displayed sensitivity is sufficient even for the testing of these samples. The importance of the probe design is illustrated by the different probes used, which were mainly targeting specific regions of both of the amplicons. The probes present on the 2993

dx.doi.org/10.1021/jf5002149 | J. Agric. Food Chem. 2014, 62, 2989−2996

Journal of Agricultural and Food Chemistry

Article

Table 3. Sensitivity of the NAIMA Detection on the ArrayTubes in a Dilution Seriese

a

qPCR results are for the NAIMA amplified samples (see workflow in Supporting Information Figure S1). bR. solanacearum species-specific probe. Weak signal just above the limit of the background-noise signal. dIn one of the two replicates, the signal was negative. e+, positive signal for the target; −, negative signal for the target; PSTVd 1−4, decimal dilutions of PSTVd RNA from 2.5 × 103 to 2.5 × 104, to 2.5−25 copies per reaction; R. solanacearum 1−4, decimal dilutions of R. solanacearum DNA from 106 cells/mL to 103 cells/mL; the decreasing intensity of the gray background indicates the decreasing target concentration in the samples. c

Table 4. Specificity of the NAIMA Detection on the ArrayTubesd

a

qPCR results are for NAIMA-amplified samples (see workflow in Supporting Information Figure S1). bR. solanacearum species-specific probe. Weak signal just above the limit of the background-noise signal. dTarget organisms are indicated with clear background, nontarget organisms are indicated with gray background. +, target was detected; −, target was not detected; NTC, replicates of negative control reactions with water instead of DNA or RNA; TPMVd, tomato planta macho viroid; TCDVd, tomato chlorotic dwarf viroid; CEVd, citrus exocortis viroid; PSTVd neg. pool, pool of different viroid RNA samples previously determined to be negative for PSTVd (tomato apical stunt viroid, chrysanthemum stunt viroid, citrus exocortis viroid, columnea latent viroid, hop stunt viroid, eggplant latent viroid); Ralstonia neg. pool, pool of Ralstonia and other species DNA samples previously determined to be negative for R. solanacearum (Ralstonia pickettii, Burkholderia caryophilli, Burkholderia cepacia, Paenibacillus polymyxa, Pseudomonas marginalis pv Marginalis, Enterobacter sp.); Bdb, blood-disease bacterium; duplex, two replicates of the duplex reaction with a target concentration of 108 cells/mL of R. solanacearum and 105 to 106 copies of PSVTd. c

arrays spanned different regions than the probes used in the (RT-)qPCR assays. Often, the detection of the NAIMA products on the ArrayTubes appeared more specific than the (RT-)qPCR assays. For example, one of the probes (RsNAIMA-16S/3) that was designed to be specific for R. solanacearum was shown to provide more specific detection toward R. solanacearum than qPCR, as it did not detect the related Ralstonia mannitolilytica (Table 4). In comparison, the

other two ArrayTubes probes designed to cover the wider range of the Ralstonia genus led to positive signals when hybridized with the NAIMA products from the reaction performed on other Ralstonia species or in R. solanacearumnegative samples. Intriguingly, some of the NAIMA reactions performed on a PSTVd RNA sample also gave positive signals when hybridized on these two ArrayTubes Ralstonia-specific probes. Further bioinformatic analysis of the bacterial 2994

dx.doi.org/10.1021/jf5002149 | J. Agric. Food Chem. 2014, 62, 2989−2996

Journal of Agricultural and Food Chemistry

Article

demonstrated.4,6 As the method is isothermal, it can also be applied for on-site diagnostics after further optimization, especially as it is robust enough to detect the bacterial DNA directly from denatured bacterial suspension. Moreover, the limited size of the microarray reader and the ArrayTubes hybridization phase should allow the use of the NAIMA procedure out of the laboratory. The method as described here is a general approach for sensitive and specific multiplex RNA and DNA target identification, and it can be applied to domains of research and molecular testing where multiplex amplification and detection of DNA, RNA or both of these target types are required.

sequences revealed that these signals were most probably due to the presence of the ubiquitous Ralstonia pickettii22 in the samples, as they came from a natural environment. For the PSTVd target, all of the ArrayTubes probes provided detection that was at least as specific as that for the RT-qPCR assay. NAIMA appeared to be even slightly more specific, as it did not detect the nontarget TPMVd and TCDVd. However, it could be argued that this difference in specificity between qPCR and NAIMA is linked to the higher sensitivity of the former rather than the better performance of the latter. Nevertheless, the general finding is that the NAIMA primers allow the amplification of a wider, less specific range of targets than the qPCR assays (because of the high specificity of the TaqMan probe), with the overall specificity of the NAIMA assay determined by the ArrayTubes probe. In addition to the abovediscussed specificity, the selectivity of the multiplex assay was satisfying, as when one of the targets or both the R. solanacearum and PSTVd targets were present in the samples and were amplified, a signal was detected for all of the relevant ArrayTubes probes (Figure 3, Table 4).

■

ASSOCIATED CONTENT

* Supporting Information S

List of PSTVd isolates used in the NAIMA amplification. List of bacterial strains tested in this study. Schematic representation of the NAIMA workflow. Schematic representation of developmental procedure. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*Phone: +386-5-9232819. Fax: +386-1-2573847. E-mail: david. [email protected]. Present Address ‡

D.M. CropDesign NV, Technologiepark 21C, 9052 Gent (Zwijnaarde), Belgium. Author Contributions §

D.D. and D.M contributed equally to this study.

Funding

This work was financially supported by the Slovenian Research Agency (contract no. L4-3642) and the EU Framework 7 Programme (FP7-KBBE-2009-3) project 245047 (Q-DETECT: Developing Quarantine Pest Detection Methods for Use by National Plant Protection Organizations (NPPO) and Inspection Services). Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We thank Neil Boonham, Tom Nixon, Samantha Bennett, and Adrian Fox from the Food and Environment Research Agency (FERA) in York, UK, Jacobus T. J. Verhoeven from the National Plant Protection Organization of The Netherlands for providing us with a valuable collection of viroid-infected material, and Philippe Prior from INRA/CIRAD, France, for providing the R. solanacearum strains. We thank Jenny Tomlinson and Neil Boonham from FERA for providing tailored ArrayTubes and the hybridization protocol. We thank Tanja Dreo, Manca Pirc and Nataša Mehle for preparing the bacterial samples and viroid isolates used in this study. We also thank Kristina Gruden for helpful suggestions related to the experimental work.

Figure 3. Samples of the scanned arrays after the hybridization of the NAIMA-amplified products. Duplex amplification was performed in the presence of both targets (A), with only the PSTVd target (B), and with only R. solanacearum (C). The legend for the probes is shown in (D): 1, Rs-NAIMA-16S/3; 2, Rs-NAIMA-16S/1; 3, Rs-NAIMA-16S/ 2; A, PSTVd-NAIMA-1; B, PSTVd-NAIMA-2; C, PSTVd-NAIMA-3.

In conclusion, the herein-proposed NAIMA method allows simultaneous, multiplex amplification and detection of RNA and DNA targets in the same reaction with satisfying performance for plant pathogen screening in terms of sensitivity and specificity. To our knowledge, this is the first report of an assay that allows both RNA and DNA target detection in a single experimental setup without PCR cycling. The time needed for the complete analysis is comparable to that of real-time PCR, although there was no particular focus on the shortening of the NAIMA procedure. As proof of concept, we tested a duplex reaction; however, the method itself has higher multiplexing capabilities, as has already been

■

ABBREVIATIONS USED CFU, colony forming units; NAIMA, nucleic acid sequence based amplification [NASBA]-implemented microarray analysis; NASBA, nucleic acid sequence based amplification; PBS, phosphate buffered saline; PSTVd, potato spindle tuber viroid; qPCR, quantitative real-time PCR; RT-qPCR, reverse tran2995

dx.doi.org/10.1021/jf5002149 | J. Agric. Food Chem. 2014, 62, 2989−2996

Journal of Agricultural and Food Chemistry

Article

Multiplex PCR Coupled with Oligonucleotide Microarray Hybridization. J. Agric. Food Chem. 2008, 56, 6791−6800. (20) Kim, J. H.; Kim, S. Y.; Lee, H.; Kim, Y. R.; Kim, H. Y. An EventSpecific DNA Microarray To Identify Genetically Modified Organisms in Processed Foods. J. Agric. Food Chem. 2010, 58, 6018−6026. (21) Tortajada-Genaro, L. A.; Santiago-Felipe, S.; Morais, S.; Gabaldón, J. A.; Puchades, R.; Maquieira, Á . Multiplex DNA Detection of Food Allergens on a Digital Versatile Disk. J. Agric. Food Chem. 2011, 60, 36−43. (22) Gilligan, P. H.; Lum, G.; Vandamme, P.; Whittier, S. Burkholderia, Stenotrophomonas, Ralstonia, Brevundimonas, Comamonas, Delftia, Pandoraea, and Acidovorax. In Manual of Clinical Microbiology; Murray, P. R., Baron, E. J., Jorgenson, J. H., Pfaller, M. A., Yolken, R. H., Eds.; ASM Press: Washington, DC, 2003; pp 729−748.

scription quantitative real-time PCR; TCDVd, tomato chlorotic dwarf viroid; TPMVd, tomato planta macho viroid

■

REFERENCES

(1) Defoort, J. P.; Martin, M.; Casano, B.; Prato, S.; Camilla, C.; Fert, V. Simultaneous detection of multiplex-amplified human immunodeficiency virus type 1 RNA, hepatitis C virus RNA, and hepatitis B virus DNA using a flow cytometer microsphere-based hybridization assay. J. Clin. Microbiol. 2000, 38, 1066−1071. (2) Mercier, B.; Burlot, L.; Ferec, C. Simultaneous screening for HBV DNA and HCV RNA genomes in blood donations using a novel TaqMan PCR assay. J. Virol. Methods 1999, 77, 1−9. (3) Xu, X. G.; Chen, G. D.; Huang, Y.; Ding, L.; Li, Z. C.; Chang, C. D.; Wang, C. Y.; Tong, D. W.; Liu, H. J. Development of multiplex PCR for simultaneous detection of six swine DNA and RNA viruses. J. Virol. Methods 2012, 183, 69−74. (4) Morisset, D.; Dobnik, D.; Hamels, S.; Zel, J.; Gruden, K. NAIMA: target amplification strategy allowing quantitative on-chip detection of GMOs. Nucleic Acids Res. 2008, 36, e118. (5) Compton, J. Nucleic acid sequence-based amplification. Nature 1991, 350, 91−92. (6) Dobnik, D.; Morisset, D.; Gruden, K. NAIMA as a solution for future GMO diagnostics challenges. Anal. Bioanal. Chem. 2010, 396, 2229−2233. (7) Hayward, A. C. Biology and Epidemiology of Bacterial Wilt Caused by Pseudomonas solanacearum. Annu. Rev. Phytopathol. 1991, 29, 65−87. (8) Owens, R. A. Potato spindle tuber viroid: the simplicity paradox resolved? Mol. Plant Pathol. 2007, 8, 549−560. (9) Council Directive 2000/29/EC of 8 May 2000 on Protective Measures against the Introduction into the Community of Organisms Harmful to Plants or Plant Products and against Their Spread within the Community. Official J. Eur. Communities; 2000, 169, 1−159. (10) Boonham, N.; Perez, L. G.; Mendez, M. S.; Peralta, E. L.; Blockley, A.; Walsh, K.; Barker, I.; Mumford, R. A. Development of a real-time RT-PCR assay for the detection of potato spindle tuber viroid. J. Virol. Methods 2004, 116, 139−146. (11) Markham, N. R.; Zuker, M. DINAMelt web server for nucleic acid melting prediction. Nucleic Acids Res. 2005, 33, W577−W581. (12) Lenarčič, R.; Morisset, D.; Mehle, N.; Ravnikar, M. Fast realtime detection of potato spindle tuber viroid by RT-LAMP. Plant Pathol. 2012, 62, 1147−1156. (13) Weller, S. A.; Elphinstone, J. G.; Smith, N. C.; Boonham, N.; Stead, D. E. Detection of Ralstonia solanacearum Strains with a Quantitative, Multiplex, Real-Time, Fluorogenic PCR (TaqMan) Assay. Appl. Environ. Microbiol. 2000, 66, 2853−2858. (14) Bentsink, L.; Leone, G.; Van Beckhoven, J.; Van Schijndel, H.; Van Gemen, B.; Van Der Wolf, J. Amplification of RNA by NASBA allows direct detection of viable cells of Ralstonia solanacearum in potato. J. Appl. Microbiol. 2002, 93, 647−655. (15) Cankar, K.; Štebih, D.; Dreo, T.; Ž el, J.; Gruden, K. Critical points of DNA quantification by real-time PCReffects of DNA extraction method and sample matrix on quantification of genetically modified organisms. BMC Biotechnol. 2006, 6, 37. (16) Markoulatos, P.; Siafakas, N.; Moncany, M. Multiplex polymerase chain reaction: a practical approach. J. Clin. Lab. Anal. 2002, 16, 47−51. (17) Verhoeven, J. T. J.; Jansen, C. C. C.; Willemen, T. M.; Kox, L. F. F.; Owens, R. A.; Roenhorst, J. W. Natural infections of tomato by Citrus exocortis viroid, Columnea latent viroid, potato spindle tuber viroid and tomato chlorotic dwarf viroid. Eur. J. Plant Pathol. 2004, 110, 823−831. (18) Xu, J.; Zhu, S.; Miao, H.; Huang, W.; Qiu, M.; Huang, Y.; Fu, X.; Li, Y. Event-Specific Detection of Seven Genetically Modified Soybean and Maizes Using Multiplex-PCR Coupled with Oligonucleotide Microarray. J. Agric. Food Chem. 2007, 55, 5575−5579. (19) Schmidt, A. M.; Sahota, R.; Pope, D. S.; Lawrence, T. S.; Belton, M. P.; Rott, M. E. Detection of Genetically Modified Canola Using 2996

dx.doi.org/10.1021/jf5002149 | J. Agric. Food Chem. 2014, 62, 2989−2996