Letters in Applied Microbiology ISSN 0266-8254

ORIGINAL ARTICLE

Simultaneous detection of Tomato spotted wilt virus, Dahlia mosaic virus and Chrysanthemum stunt viroid by multiplex RT-PCR in dahlias and their distribution in Japanese dahlias S. Asano1, Y. Matsushita2, Y. Hirayama1 and T. Naka1 1 Nara Prefectural Agricultural Research and Development Center, Kashihara, Nara, Japan 2 NARO Institute of Floricultural Science, Tsukuba, Ibaraki, Japan

Significance and Impact of the Study: The multiplex RT-PCR assay described in this study is the first report of simultaneous detection of virus and viroid in dahlia. This method represents a rapid, sensitive and cost effective approach to diagnose viral infections in dahlias. A field survey validated our results, indicating that TSWV was the dominant virus found in the Kansai region, DMV in the Tohoku and Kyushu regions and CSVd in the Hokkaido region.

Keywords Chrysanthemum stunt viroid, Dahlia mosaic virus, diagnosis, multiplex RT-PCR, Tomato spotted wilt virus. Correspondence Yosuke Matsushita, NARO Institute of Floricultural Science, Tsukuba, Ibaraki, Japan. E-mail: [email protected] 2015/0224: received 2 February 2015, revised 5 May 2015 and accepted 7 May 2015 doi:10.1111/lam.12442

Abstract Tomato spotted wilt virus (TSWV), Dahlia mosaic virus (DMV) and Chrysanthemum stunt viroid (CSVd) are economically important viruses and viroid that infect cultivated dahlias. Prior to this investigation, no multiplex RT-PCR assay for the detection of dahlia virus and viroid infections existed. In this study, we report the development of a multiplex RT-PCR that simultaneously detects TSWV, DMV and CSVd infections in dahlias. In addition, a simple RT-PCR method that does not require RNA extraction, microtissue direct RT-PCR, could be used to prepare samples for analysis by this multiplex RT-PCR. A field survey validated our results, indicating that TSWV was the dominant virus found in the Kansai region, DMV in the Tohoku and Kyushu regions, and CSVd in the Hokkaido region. This method represents a rapid, sensitive and cost effective approach to diagnose viral infections in dahlias.

Introduction Dahlia is an important bulb crop valued for its flowers and is widely grown in several countries. In Japan, approx. 2 million dahlia bulbs and 8 million dahlia cut flowers were produced in 2008 (Fujii and Arima 2012). Several viruses and viroids are known to infect dahlias, including Cucumber mosaic virus (CMV) (Albouy 1995), Dahlia mosaic virus (DMV) (Albouy 1995), Impatiens necrotic spot virus (INSV) (Albouy 1995), Tobacco streak virus (TSV) (Pappu et al. 2008), Tomato spotted wilt virus (TSWV) (Albouy 1995), Chrysanthemum stunt viroid (CSVd) (Nakashima et al. 2007), Potato spindle tuber viroid (PSTVd) (Tsushima et al. 2011) and Dahlia latent viroid (DLVd) (Jacobus et al. 2013). In Japan, TSWV and DMV are

prevalent and decrease productivity of commercially cultivated dahlia crops (Suematsu et al. 1977; Naka et al. 2007). Recently, infection with CSVd in dahlias was confirmed in Japan (Nakashima et al. 2007). It is important to clarify the effect of CSVd on the productivity and its distribution. A member of the genus Tospovirus within the family Bunyaviridae, TSWV is an enveloped, negative-strand RNA virus containing two glycosylated membrane proteins, a putative RNA-dependent RNA polymerase and a nucleocapsid protein (De Haan et al. 1991). Symptoms caused by infection with TSWV are diverse and include ring spots, chlorotic lines, mosaic and plant stunting (Suematsu et al. 1977; Albouy 1995). Classified as a member of the family Caulimovirus and the genus Caulimoviridae, DMV is a circular

Letters in Applied Microbiology 61, 113--120 © 2015 The Society for Applied Microbiology

113

A multiplex RT-PCR in dahlias

S. Asano et al.

double-stranded DNA virus containing six open reading frames (ORFs) (Pahalawatta et al. 2008). Symptoms of DMV infection include mosaic, vein-banding, leaf distortion, chlorosis and plant stunting. Symptoms vary depending on the cultivar, and cultivars displaying few or no symptoms are common (Albouy 1995). A member of the family Pospiviroidae, CSVd is a viroid consisting of a naked, single-stranded circular RNA genome containing conserved regions related to replication, but no protein-coding sequences (Palukaitis and Symons 1980; Matsushita 2013). This viroid was first recognized to infect dahlia in 2007. Of note, CSVd-specific symptoms have not been described in dahlias because all CSVdinfected dahlias were mix-infected with DMV, TSWV, TSV and/or CMV. Symptoms induced by single infection of CSVd are considered to be plant stunting and the appearance of small leaves and flowers (Nakashima et al. 2007). Dahlia is primarily cultivated by vegetative propagation, and viruses and viroids generally persist in the progeny from year to year following clonal propagation of vegetative tissues, stem cuttings and bulbs. Detection of viruses and viroids, followed by the removal of infected dahlias with and without symptoms, and further propagation of healthy dahlias can be highly effective in reducing the spread of disease. Thus, it is important to develop a sensitive and rapid method to detect viruses and viroids to ensure the selection and propagation of healthy dahlias. Multiplex reverse transcription-polymerase chain reaction (multiplex RT-PCR) can detect several viruses and viroids in a single sample, thus providing a reliable, fast and inexpensive method for routine detection of plant viruses and viroids in the field. Therefore, the goal of this study was to develop a multiplex RT-PCR method for the simultaneous detection of TSWV, DMV and CSVd in dahlias. Results and discussion Primer specificity and compatibility The expected viruses and viroid were correctly amplified, including the simultaneous amplification of both viruses and the viroid from mixed RNA combined from dahlias singly infected by each virus and viroid (Fig. 1). Nonspecific bands were not observed when extracts from uninfected dahlia or DNase and RNase-free water were used in the assay. The obtained sequences shared a high level of identity with known sequences of TSWV (GenBank accession no. HF913777), DMV (GenBank accession no. JX272320) and CSVd (GenBank accession no. AB255879). Sequence analysis confirmed the reliability of the multiplex RT-PCR assay results. This indicated that the 114

M

1

2

3

4

5

6

TSWV (720 bp) DMV (402 bp) CSVd (249 bp)

Figure 1 Detection of Tomato spotted wilt virus (TSWV), Dahlia mosaic virus (DMV) and Chrysanthemum stunt viroid (CSVd) by multiplex RT-PCR using three sets of specific primers. Lane M: 100-bp DNA marker. Lane 1: DNase- and RNase-free water. Lane 2: Healthy dahlia. Lane 3: TSWV-infected dahlia. Lane 4: DMV-infected dahlia. Lane 5: CSVd-infected dahlia. Lane 6: mixture of total RNA extracted from TSWV, DMV and CSVd-infected dahlia. The expected PCR product sizes for each virus and viroid are indicated by the arrows.

primers were correctly selected and all three primers specifically annealed to their target sequences. PCR was mainly used to detect DMV (Nicolaisen 2003; Pappu et al. 2005). However, Naka et al. (2007) reported detection of DMV by RT-PCR using total RNA extracted by TRIzol (Invitrogen, Carlsbad, CA) from DMV-infected dahlias. Thus, we confirmed whether total RNA extracted with RNeasy Plant Mini Kit (Qiagen, Chatsworth, CA) contains DMV DNA and as a result, DMV from the extracted RNA was not detected using PCR with KOD dash (TOYOBO, Tokyo, Japan), indicating that the total RNA extraction does not contain DMV DNA. Therefore, transcribed RNA from genome DMV could be detected by the multiplex RT-PCR. Sensitivity of single and multiplex RT-PCR In single RT-PCR, virus- and viroid-specific bands for TSWV, DMV and CSVd were observed after RNA was diluted to endpoints of 105, 103 and 103 ng respectively (Fig. 2). Using the multiplex RT-PCR assay, bands specific for TSWV, DMV and CSVd were detected after template RNA was diluted to 105, 103 and 102 ng. Therefore, the sensitivity of multiplex RT-PCR for TSWV and DMV was the same as that obtained using single RTPCR, while the sensitivity of the assay to detect CSVd was 10-fold less than that of the individual RT-PCR assay. Multiplex microtissue direct RT-PCR We also investigated the usefulness of multiplex microtissue direct RT-PCR to detect virus as well as viroid infections (Hosokawa et al. 2006). When multiplex

Letters in Applied Microbiology 61, 113--120 © 2015 The Society for Applied Microbiology

S. Asano et al.

M (a)

1 2

A multiplex RT-PCR in dahlias

3

4 5

6 7 8

9 10

TSWV (720 bp) DMV (402 bp) CSVd (249 bp)

M (b)

1 2

3 4

5

6 7 8

9 10

TSWV (720 bp)

M (c)

1 2

3 4

5

6 7 8

9 10

RT-PCR was used were identical to those generated by multiplex RT-PCR. Microtissue direct RT-PCR has been previously used to detect infections caused by viroids such as CSVd, Chrysanthemum chlorotic mottle viroid (Hosokawa et al. 2006), Tomato chlorotic dwarf viroid, Potato spindle tuber viroid (Matsushita et al. 2010) and Apple latent spherical virus (Kawai et al. 2014). There have been no reports of detection of DNA viruses using microtissue direct RT-PCR. To the best of our knowledge, our study is the first to confirm that multiplex microtissue direct RT-PCR can detect infections with DMV, a DNA virus. In addition, to confirm that TSWV, DMV and CSVd are detectable using a needle without false negative; we compared the result of multiplex microtissue direct RT-PCR using needles with the multiplex RT-PCR with total RNA as templates. As a result, each virus and viroid was detected from all samples using both methods (data not shown). Therefore, multiplex microtissue direct RT-PCR is detectable to TSWV, DMV and CSVd without false negative. Application for dahlias infected in field

DMV (402 bp)

M

1 2

3

4

5

6

7 8

9 10

(d)

CSVd (249 bp)

Figure 2 Comparison of the sensitivities of single and multiplex RTPCR for amplification of serially diluted RNA for the detection of Tomato spotted wilt virus (TSWV), Dahlia mosaic virus (DMV) and Chrysanthemum stunt viroid (CSVd). Lane M: 100-bp DNA marker. Lane 1: DNase- and RNase-free water. Lane 2: healthy dahlia RNA. Lanes 3–10: Amplicons from 10-fold serial dilutions of total RNA mixtures (1 ng ll1) from dahlias individually infected with TSWV, DMV and CSVd (a) and that from dahlias infected with TSWV (b), DMV (c) or CSVd (d). (a) multiplex RT-PCR, (b) single RT-PCR for TSWV, (c) single RT-PCR for DMV and (d) single RT-PCR for CSVd. The expected PCR product sizes for each virus and viroid are indicated by the arrows.

microtissue direct RT-PCR was employed, the expected virus and viroid products were correctly amplified the same as multiplex RT-PCR (date not shown). The specific bands observed when multiplex microtissue direct

The results of our field assays using multiplex microtissue direct RT-PCR are depicted in Table 2. This is the first report to show the distribution of TSWV, DMV and CSVd in dahlia fields in Japan. In the Hokkaido region, CSVd was detected in 39 samples (722%) and DMV was detected in 24 samples (444%). No samples showed evidence of TSWV infection. In the Tohoku region, DMV was detected in 41 samples (427%), CSVd in 13 samples (135%) and TSWV in eight samples (83%). In the Kansai region, TSWV was detected in 22 samples (318%), CSVd in one sample (14%) and DMV was not detected. In the Kyushu region, DMV was detected in 30 samples (375%), CSVd in four samples (50%) and TSWV was not detected. To confirm the result of multiplex RT-PCR, amplified products were directly sequenced with a primer specific to each virus and viroid. The sequences showed high identity in each virus and viroid. In addition, the results of multiplex microtissue direct RT-PCR and single direct RT-PCR were the same using 90 dahlias in the Kansai and Kyushu regions. While double infections with TSWV and DMV, TSWV and CSVd, and DMV and CSVd were confirmed, triple infections were not confirmed. These results indicated that the dominant species of viruses and viroid differed among the four regions. While DMV was the most widespread and was detected in about 40% of dahlias in three regions, it did not appear in the Kansai region. Importantly, in this region, seedlings derived from meristem tip-cultured dahlias were planted; thus, viruses and viroids have been almost eliminated from the dahlia fields. In addition, DMV has an

Letters in Applied Microbiology 61, 113--120 © 2015 The Society for Applied Microbiology

115

A multiplex RT-PCR in dahlias

S. Asano et al.

(b)

(a)

Figure 3 Symptoms observed in dahlias infected by viruses in Japan. (a) Yellowish spot and ring spot. (b) Yellowish spot and mosaic. (c) Mosaic. (d) Vein clearing. (a and b) The symptoms displayed by a leaf of dahlia infected by Tomato spotted wilt virus, as detected by multiplex microtissue direct RTPCR. (c and d) Symptoms displayed by a leaf of dahlia infected by Dahlia mosaic virus, as detected by multiplex microtissue direct RTPCR.

(d)

(c)

Table 2 Primer sequences used for the multiplex RT-PCR method for Tomato spotted wilt virus (TSWV), Dahlia mosaic virus (DMV) and Chrysanthemum stunt viroid (CSVd) detection Virus/Viroid

Primer name

Direction

Nucleotide sequence (50 – 30 )

Expected size (bp)

Reference

TSWV

TSWV-Rnp TSWV-Fnp DMV-R1345 DMV-F944 CSVdD-R CSVdD-F

Reverse Forward Reverse Forward Reverse Forward

ACCCTAAGAAACGACGACTGCG TCTTCACCTGATCTTCATTCATT ACTTCCTGCTAGGACACTCA AAAAAGAGGCTACCATACCC TCTCCAGGAGAGGAAGGAAACTA GGAGTAAGCCCGTGGAACCTTAG

720

Seo et al.(2009)

402

Naka et al. (2007)

249

This study

DMV CSVd

72°C. Final extension was performed for 5 min at 72°C. The amplified PCR products were separated by electrophoresis using 10% agarose gels. Single RT-PCR Single RT-PCR was carried out using the PrimeScript One-Step RT-PCR Kit Ver. 2 (Dye plus; TaKaRa, Shiga, Japan) in 02-ml micro test tubes, following the manufacturer’s instructions. One microlitre of total RNA was added to the tube containing the reaction mixture, including the primer set. The virus- or viroid-specific primer set was used at final concentrations of 2 lmol l1. RT-PCR was performed under the following conditions: 10 min at 50°C, 2 min at 94°C, followed by 30 cycles of melting for 30 s at 94°C, annealing for 30 s at 60°C and extension for 30 s at 72°C. Final extension was performed for 5 min at 72°C. Sensitivity of single and multiplex RT-PCR To determine the detection limits of single RT-PCR and multiplex RT-PCR, total RNA extracted from the infected 118

leaves was serially diluted tenfold (100–108). Individual and multiplex RT-PCR reactions were carried out simultaneously for a direct comparison of the products produced by the dilution series. PCR analyses were conducted in three replicates. Multiplex microtissue direct RT-PCR To simplify the detection procedure, we confirmed that a simple method that did not require RNA extraction, ‘microtissue direct RT-PCR’ (Hosokawa et al. 2006), could be used in our multiplex RT-PCR. Briefly, a needle (a white No. 3 stainless Shiga unified head type insect pin; Shiga, Tokyo, Japan) was used to pierce the rachis on the middle leaves of virus or viroid-infected or uninfected plants (the same cultivars as those listed above) to a depth of 01– 02 mm. We pierced on the rachis of dahlias five times at different points to avoid false-negative results. The needles were then dipped in the RT-PCR mixture (described above) to recover the sample that adhered to the needle. Moreover, to confirm that TSWV, DMV and CSVd are detectable using a needle without false negative results, we conducted the multiplex microtissue direct RT-PCR using needles of

Letters in Applied Microbiology 61, 113--120 © 2015 The Society for Applied Microbiology

S. Asano et al.

A multiplex RT-PCR in dahlias

Table 1 Number of Tomato spotted wilt virus (TSWV), Dahlia mosaic virus (DMV) and Chrysanthemum stunt viroid (CSVd) detected in dahlias and their symptoms in four regions in Japan Detected viruses and viroid*

Regions

Symptoms

TSWV

DMV

CSVd

TSWV DMV

Hokkaido

Yellowish spot Yellowish spot + ring spot (Fig. 3a)‡ Yellowish spot + mosaic (Fig. 3b)§ Mosaic (Fig. 3c)¶ Vein clearing (Fig. 3d)** Vein clearing + mosaic Vein clearing + stunt Leaf distortion Asymptomatic Total Yellowish spot Yellowish spot + ring spot Yellowish spot + mosaic Mosaic Vein clearing Vein clearing + mosaic Vein clearing + stunt Leaf distortion Asymptomatic Total Yellowish spot Yellowish spot + ring spot Yellowish spot + mosaic Mosaic Vein clearing Vein clearing + mosaic Vein clearing + stunt Leaf distortion Asymptomatic Total Yellowish spot Yellowish spot + ring spot Yellowish spot + mosaic Mosaic Vein clearing Vein clearing + mosaic Vein clearing + stunt Leaf distortion Asymptomatic Total

0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 5 7 9 2 0 0 0 0 0 3 21 0 0 0 0 0 0 0 0 0 0

0 0 0 2 3 0 0 0 2 7 0 0 0 10 3 5 0 2 12 32 0 0 0 0 0 0 0 0 0 0 0 0 0 5 2 0 2 0 21 30

0 0 0 0 0 0 0 0 21 21 0 0 0 0 0 0 0 0 8 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 3

0 0 0 0 0 0 0 0 0 0 2 (21) 0 0 0 0 0 0 0 0 2 (21) 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Tohoku

Kansai

Kyushu

(52)

(52) (101) (130) (290)

(43) (304)

(37)† (56)

(37) (130)

(104) (31) (52) (21) (125) (333)

(63) (25)

(263) (375)

(389) (389)

(83) (83)

(38) (38)

TSWV CSVd

DMV CSVd

TSWV DMV CSVd

Negative

Total

0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0

0 0 0 1 9 2 0 0 6 18 0 0 0 0 2 0 3 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

0 0 0 0 0 0 0 0 8 8 0 0 0 0 0 0 0 0 43 43 0 0 0 0 0 0 0 0 47 47 0 0 0 0 0 0 0 0 46 46

0 0 0 3 12 2 0 0 37 54 2 6 0 10 5 5 3 2 63 96 7 10 2 0 0 0 0 0 50 69 0 0 0 5 2 0 2 0 71 80

(10)

(10) (14)

(14)

(19) (167) (37)

(111) (333)

(21) (31)

(52)

(13) (13)

(148) (148)

(448) (448)

(681) (681)

(575) (575)

(56) (222) (37)

(685) (100) (21) (63) (104) (52) (52) (31) (21) (656) (100)

(725) (100)

(63) (25) (25) (888) (100)

*TSWV, DMV and CSVd were detected by multiplex microtissue direct RT-PCR. † Number of detected viruses and viroids. (Percent of detected virus and viroid). ‡ Symptom shown in Fig. 3a. § Symptom shown in Fig. 3b. ¶ Symptom shown in Fig. 3c. **Symptom shown in Fig. 3d.

tube containing the reaction mixture, including the primer sets for multiplex RT-PCR: TSWV-Rnp + TSWVFnp, DMV-R1345 + DMV-F944 and CSVdD-R +CSVdDF (Table 2). The virus- or viroid-specific primers were used

at final concentrations of 2 lmol l1. RT-PCR was performed under the following conditions: 10 min at 50°C, 2 min at 94°C, followed by 30 cycles of melting for 30 s at 94°C, annealing for 30 s at 60°C and extension for 30 s at

Letters in Applied Microbiology 61, 113--120 © 2015 The Society for Applied Microbiology

117

A multiplex RT-PCR in dahlias

S. Asano et al.

(b)

(a)

Figure 3 Symptoms observed in dahlias infected by viruses in Japan. (a) Yellowish spot and ring spot. (b) Yellowish spot and mosaic. (c) Mosaic. (d) Vein clearing. (a and b) The symptoms displayed by a leaf of dahlia infected by Tomato spotted wilt virus, as detected by multiplex microtissue direct RTPCR. (c and d) Symptoms displayed by a leaf of dahlia infected by Dahlia mosaic virus, as detected by multiplex microtissue direct RTPCR.

(d)

(c)

Table 2 Primer sequences used for the multiplex RT-PCR method for Tomato spotted wilt virus (TSWV), Dahlia mosaic virus (DMV) and Chrysanthemum stunt viroid (CSVd) detection Virus/Viroid

Primer name

Direction

Nucleotide sequence (50 – 30 )

Expected size (bp)

Reference

TSWV

TSWV-Rnp TSWV-Fnp DMV-R1345 DMV-F944 CSVdD-R CSVdD-F

Reverse Forward Reverse Forward Reverse Forward

ACCCTAAGAAACGACGACTGCG TCTTCACCTGATCTTCATTCATT ACTTCCTGCTAGGACACTCA AAAAAGAGGCTACCATACCC TCTCCAGGAGAGGAAGGAAACTA GGAGTAAGCCCGTGGAACCTTAG

720

Seo et al.(2009)

402

Naka et al. (2007)

249

This study

DMV CSVd

72°C. Final extension was performed for 5 min at 72°C. The amplified PCR products were separated by electrophoresis using 10% agarose gels. Single RT-PCR Single RT-PCR was carried out using the PrimeScript One-Step RT-PCR Kit Ver. 2 (Dye plus; TaKaRa, Shiga, Japan) in 02-ml micro test tubes, following the manufacturer’s instructions. One microlitre of total RNA was added to the tube containing the reaction mixture, including the primer set. The virus- or viroid-specific primer set was used at final concentrations of 2 lmol l1. RT-PCR was performed under the following conditions: 10 min at 50°C, 2 min at 94°C, followed by 30 cycles of melting for 30 s at 94°C, annealing for 30 s at 60°C and extension for 30 s at 72°C. Final extension was performed for 5 min at 72°C. Sensitivity of single and multiplex RT-PCR To determine the detection limits of single RT-PCR and multiplex RT-PCR, total RNA extracted from the infected 118

leaves was serially diluted tenfold (100–108). Individual and multiplex RT-PCR reactions were carried out simultaneously for a direct comparison of the products produced by the dilution series. PCR analyses were conducted in three replicates. Multiplex microtissue direct RT-PCR To simplify the detection procedure, we confirmed that a simple method that did not require RNA extraction, ‘microtissue direct RT-PCR’ (Hosokawa et al. 2006), could be used in our multiplex RT-PCR. Briefly, a needle (a white No. 3 stainless Shiga unified head type insect pin; Shiga, Tokyo, Japan) was used to pierce the rachis on the middle leaves of virus or viroid-infected or uninfected plants (the same cultivars as those listed above) to a depth of 01– 02 mm. We pierced on the rachis of dahlias five times at different points to avoid false-negative results. The needles were then dipped in the RT-PCR mixture (described above) to recover the sample that adhered to the needle. Moreover, to confirm that TSWV, DMV and CSVd are detectable using a needle without false negative results, we conducted the multiplex microtissue direct RT-PCR using needles of

Letters in Applied Microbiology 61, 113--120 © 2015 The Society for Applied Microbiology

S. Asano et al.

each twenty leaves infected with TSWV, DMV and CSVd, respectively, and then compared with the result of the multiplex RT-PCR using extracted RNA as templates. Application for dahlias infected in field To assess the field performance of our multiplex microtissue RT-PCR assay, tests were extended to 299 samples of field dahlias collected in 2014 from the Hokkaido, Tohoku, Kansai and Kyushu regions that were subsequently used in the multiplex microtissue direct RT-PCR assay (Table 1). The direct sequencing was conducted about five to ten samples at each region. In addition, to confirm that the result of multiplex microtissue direct RT-PCR and single microtissue direct RT-PCR is the same using samples, we compared the result of both methods using 90 dahlia samples in the Kansai and Kyushu regions. Sequence determination To confirm their origins from the target virus and viroid species, the amplified RT-PCR products were directly sequenced using a Life Technologies dGTP BigDye Terminator Cycle Sequencing Kit (Thermo Fisher Scientific) in accordance with the manufacturer’s instructions. Acknowledgements We thank Mr. K. Inda and Mr. A. Kurata for preparing the experimental materials. This study was supported by a Grant-in-Aid for ‘Research and development projects for application in promoting new policy of agriculture, forestry and fisheries’ from the Ministry of Agriculture, Forestry and Fisheries of Japan. Conflict of Interest No conflict of interest declared. References Albouy, J. (1995) Dahlia. In Virus and Virus-like Diseases of Bulb and Flower Crops ed. Lobenstein, G., Lawson, R.H. and Brunt, A.A. pp. 265–273. Hoboken: John Willey & Sons. De Haan, P., Kormelink, R., de Oliveira, R., van Poelwijk, F., Peters, D. and Golbach, R. (1991) Tomato spotted wilt virus L RNA encodes a putative RNA polymerase. J Gen Virol 71, 2207–2216. Fujii, Y. and Arima, T. (2012) Dahlia in Nara prefecture supports to produce bulbs, cuttings and seedlings. Bull Nara Agr Exp Sta 43, 71–74. (In Japanese).

A multiplex RT-PCR in dahlias

German, T.L., Ullman, D.E. and Moyer, J.W. (1992) Tospoviruses: diagnosis, molecular biology, phylogeny, and vector relationships. Annu Rev Phytopathol 30, 315–348. Hosokawa, M., Matsushita, M., Uchida, H. and Yazawa, S. (2006) Direct RT-PCR method for detecting two chrysanthemum viroids using minimal amounts of plant tissue. J Virol Methods 131, 28–33. Jacobus, Th.J.V., Ellis, T.M., Johanna, W.R., Ricardo, F. and Pedro, S. (2013) Dahlia latent viroid: a recombinant new species of the family Pospiviroidae posing intriguing questions about its origin and classification. J Gen Virol 94, 711–719. Kawai, K., Gonoi, A., Nitta, M., Kaido, M., Yamagishi, N., Yoshikawa, N. and Tao, R. (2014) Virus-induced gene silencing in apricot (Prunus armeniaca L.) and Japanese apricot (P. mume Siebold & Zucc.) with the Apple Latent Spherical Virus vector system. J Jpn Soc Hort Sci 83, 23–31. Matsushita, Y. (2013) Chrysanthemum stunt viroid. JARQ 47, 237–247. Matsushita, Y., Usugi, T. and Tsuda, S. (2010) Development of a multiplex RT-PCR detection system for Potato spindle tuber viroid and Tomato chlorotic dwarf viroid. Eur J Plant Pathol 182, 165–170. Naka, T., Fujii, Y., Hosokawa, M., Nakajima, A., Asao, H., Okada, K. and Maeda, S. (2007) Effect of apical meristem culture propagation of Dahlia (Dahlia 9 Cultorum) on the growth and viruliferous level. Bull Nara Agr Exp Sta 38, 17–22. (In Japanese). Nakashima, A., Hosokawa, M., Maeda, S. and Yazawa, S. (2007) Natural infection of Chrysanthemum stunt viroid in dahlia plants. J Gen Plant Pathol 73, 225–227. Nicolaisen, M. (2003) Partial molecular characterization of Dahlia mosaic virus and its detection by PCR. Plant Dis 87, 945–948. Pahalawatta, V., Druffel, K.L., Wyatt, S.D., Eastwell, K.C. and Pappu, H.R. (2008) Genome structure and organization of a member of a novel and distinct species of the genus Caulimovirus associated with dahlia mosaic. Arch Virol 153, 733–738. Palukaitis, P. and Symons, R.H. (1980) Purification and characterization of the circular and linear forms of Chrysanthemum stunt viroid. J Gen Virol 46, 477–489. Pappu, H.R., Wyatt, S.D. and Druffel, K.L. (2005) Dahlia mosaic virus: molecular detection and distribution in Dahlia in the United States. HortScience 40, 697–699. Pappu, H.R., Hammet, K.R. and Deuffel, K.L. (2008) Dahlia mosaic virus and Tobacco streak virus in Dahlia (Dahlia variabilis) in New Zealand. Plant Dis 92, 1138. Seo, N., Sato, H., Itabashi, K. and Nakamura, S. (2009) Multiplex RT-PCR for detection of three viruses and two viroids from chrysanthemum. Ann Rept Plant Prot North Japan 60, 288. (In Japanese). Suematsu, T., Sato, Y., Senboku, T. and Yomo, E. (1977) Virus diseases of Dahlia in Hokkaido. HUSCAP 11, 138–147. (In Japanese).

Letters in Applied Microbiology 61, 113--120 © 2015 The Society for Applied Microbiology

119

A multiplex RT-PCR in dahlias

S. Asano et al.

Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994) CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Res 22, 4673–4680.

120

Tsushima, T., Murakami, S., Ito, H., Adkar, Y. and Sano, T. (2011) Molecular characterization of Potato spindle tuber viroid in dahlia. J Gen Plant Pathol 77, 253–256.

Letters in Applied Microbiology 61, 113--120 © 2015 The Society for Applied Microbiology

Simultaneous detection of Tomato spotted wilt virus, Dahlia mosaic virus and Chrysanthemum stunt viroid by multiplex RT-PCR in dahlias and their distribution in Japanese dahlias.

Tomato spotted wilt virus (TSWV), Dahlia mosaic virus (DMV) and Chrysanthemum stunt viroid (CSVd) are economically important viruses and viroid that i...
377KB Sizes 2 Downloads 8 Views