Cell, Vol. 63, 1033-1038,

November

30, 1990, Copyright

0 1990 by Cell Press

Single Amino Acid Substitutions in One Ca*+ Binding Site of Uvomorulin Abolish the Adhesive Function Masayuki Ozawa: Jurgen Engel,t and Rolf Kemler’ Max-Planck lnstitut fur lmmunbiologie FG Molekulare Embryologie Sttibeweg 51 D-7800 Freiburg, Federal Republic of Germany t Biozentrum der Universitat Abteilung Biophysikalische Chemie Klingelbergstrasse 70 CH-4058 Basel, Switzerland l

Summary We show that a synthetic peptide corresponding to the sequence of one putatlve Ca2+ binding motif of the cell adhesion molecule uvomorulin is able to complex Ca2+. This function is abolished if the first Asp in the peptlde Is replaced by Lys. Accordingly, we expressed in L cells mutant uvomorulln with a replacement of Asp to Lys or Ala. Mutant protein was resistant to CaVtrypsin under mild conditions but became susceptible at or near the site of replacement at higher concentrations, leaving the remainlng Ca2+ binding domains protected. Remarkably, in cell aggregation assays both mutant uvomorulins failed to medlate cell adhesiveness, demonstrating that a single amino acid substitution in one Ca2+ binding site Inactivates the adhesive function.

thought to be mediated by catenins, which complex with the cytoplasmic domain of uvomorulin and which link uvomorulin with actin (Ozawa et al., 1989, 1990). The extracellular part of uvomorulin that mediates the selective cell adhesiveness is composed largely of three repeating domains, each with two putative Ca*+ binding motifs (Ringwald et al., 1987). These motifs are well conserved and are located at analogous positions in all cadherins, suggesting that they might interact with Ca2+, but so far final proof of their functional properties is missing (Kemler et al., 1989). It has been thought that Ca2+ would influence the protein conformation and thereby stabilize the adhesive state and the resistance to proteases. Here we describe experiments designed to study the effect of Ca2+ on protein conformation and adhesive function. We show that a synthetic peptide tailored after the sequence of one Ca2+ binding motif can complex Ca2+. The interaction with Ca2+ is abolished when the first aspartic acid in this motif is replaced by a lysine. Mutant uvomorulins with substitutions at the same amino acid position were expressed in mouse L cells. We show that this sitedirected mutagenesis completely abolishes the adhesive function of uvomorulin and increases the susceptibility of the protein to trypsin digestion in the presence of calcium (Ca2+/trypsin). From this we conclude that this Ca2+ binding site is important for the adhesive function. Results

Introduction Cell adhesion molecules (CAMS) play a crucial role during development of and in the maintenance of adult tissues of multicellular organisms. CAMS are cell surface glycoproteins that have been grouped operationally into two classes: those that function Ca*+-independently and those that require Ca*+ for their binding activity (Takeichi, 1977). The major characteristics of CP+-dependent CAMS are that they express their adhesive function only in the presence of Ca*+ and that Ca2+ protects the extracellular part of the proteins from proteolytic degradation (Hyafil et al., 1981). The molecular cloning and the comparison of the primary structure of Ca2+-dependent CAMS has revealed that these proteins show an overall homology and represent a gene family also termed cadherins (Takeichi, 1988; Kemler et al., 1989). The first member of the cadherin gene family was termed uvomorulin since it was identified during early mouse development where it mediates the compaction process at the morula stage (Kern& et al., 1977; Hyafil et al., 1980). Later, during development and in adult tissues, uvomorulin is expressed exclusively in epithelial cells (Vestweber and Kemler, 1984, 1985). In polarized epithelial cells, uvomorulin is transported to the basolateral membrane compartment and is concentrated in the zonula adherens of epithelial cells (Boiler et al., 1985; Le Bivic et al., 1990). The clustering of uvomorulin in the zonula adherens is

Ca2+ Binding Properties of Synthetic Peptldes The putative Ca2+ binding “motif B” of the amino-terminal domain was chosen because it has the best resemblance to the known Ca2+ binding site of a-lactalbumin (Stuart et al., 1988; Ringwald et al., 1987; see also Figure 2A). To determine whether motif B can indeed complex Ca2+, circular dichroism (CD) analysis was performed because this technique is sensitive to secondary structure and can be applied to peptides in solution. Synthetic peptide B corresponding to amino acids 129-138 of wild-type uvomorulin (Figure 2A) exhibited a Ca2+-dependent change of its CD spectrum in the 220 nm region (Figure 1A). This change indicated binding of one or several Ca*+ ions to the peptide, inducing a conformational change. The Ca2+-induced conformational change is intrinsic since peptide B was monomeric both in the presence (5 mM Ca2+) and in the absence of Ca2+ (1 mM EDTA), as verified by short-column sedimentation equilibrium experiments performed according to Yphantis (1980). The change in CD was used as a signal for Ca*+ titration (Figure 1B). Since the peptide concentration was much lower than that of midpoint Ca2+, the total Caz+ concentration (abscissa, Figure 1B) approximately equaled the free Ca2+ concentration. The dissociation equilibrium constant Ko = 2 (f 0.2) mM was obtained by a best fit of the mass law relation for independent binding sites to the experimental data (Figure 1s).

Cell 1034

A

CD SPECTRA

A (nm) ---

KVSATDADDDVLL I, I, KVSATKADDDVLL

Figure

+ 2mM Co” + 2mM EDTA ? 2mM EDTAjor Ca”

1. Calcium-Induced

Conformational

Change

in Peptide

B but Not in B’ as Monitored

by Circular

Dichroism

(A) Circular dichroism spectra of peptide B in the presence of Ca2+ (2 mM ) (solid line) and in its absence (2 mM ECXA) (dashed line). Identical spectra were recorded for peptide W in the presence and absence of Ca2+ (dotted line). (B) Titration of Ca2+ binding as monitored by the change in ellipticity at 220 nm ([@]A - [O]sm)/([O]$$ - [O] 22s = Ko/[Ca2+], the third dissocia[Ca2+] and at Ca2+ saturation, respection equilibrium constant of Ko = 2 mM. Superscripts 0 and Ooindicate [S] values at zero Ca2+ concentration tively. The peptide concentration in (A) and (B) was 0.5 mglml (0.35 mM) in 10 mM Tris-HCI (pH 7.4) at 20%.

were subjected to immunoprecipitation, immunoblot, and immunofluorescence experiments. Cell surface expression of mutant uvomorulins in L-D134K and L-D134A cells was as efficient as wild-type uvomorulin in Ll-1 cells. No intracellular retention of the mutant polypeptides was observed. Both mutant uvomorulins were recognized by the monoclonal antibody DECMA-1, which is known to inhibit cell aggregation (Vestweber and Kemler, 1985). Both had the correct molecular size and complexed with catenin a, 8, and y which had molecular weights of 102, 88, and 80 kd, respectively (Figure 28).

The synthetic peptide B* was identical to peptide B with the exception of the first Asp, which was changed to Lys, and exhibited a similar CD spectrum which was, however, completely independent of Ca2+ (Figure 1A). Expression of Uvomoruiin with Single Amino Acid Substitutions To test whether a similar amino acid substitution might affect the Ca*+/trypsin susceptibility of uvomorulin, mutant cDNAs, pSUM-D134K and pSUM-D134A, were generated using synthetic oligonucleotides (Figure 2A). The mutant uvomorulin cDNAs were introduced into L cells together with the neomycin resistance gene (neo-gene). G-418resistant cells were selected for cell surface expression by fluorescence-activated cell sorting (FACS) with affinitypurified rabbit antiuvomorulin (anti-gp84). Transfectants

A

Ca2+/lkypsin lVeatment In a first series of experiments, cells were treated with 0.01% trypsin in the presence of 2 mM CaC12 for 10 min at 37%. These are the standard conditions used to treat Figure 2. Single Amino One Ca2+ Binding Site

0 0

200

400

600

so0

iFT -89

.d 9 0

VW-

NH2

+-!I 2 if

-4;

COO” ab

ab

ab

- 200 1

0

---

-z

128 KVSAT KVSAT KVSAT

138 [pi ADDD wild-type q ADDD D134K m ADDD D134A

C -97 -67 -45

1

2

3

45

6

Acid Substitutions

in

(A) Scheme of uvomorulin polypeptide and the amino acid sequence of the Ca2+ binding motif B. The amino acids replaced in the mutant proteins are boxed. (B) lmmunoblot (lanes l-3) and immunoprecipitation (lanes 4-6) analysis of L cells expressing normal (Ll-1) or mutant uvomorulin (L-D134K and L-D134A). The mutant proteins have the correct size and complex with catenins only in immunoprecipitation experiments. lmmunoprecipiations were analyzed by 3% polyacrylamide gel electrophoresis. Arrow indicates the position of uvomorulin.

Ca2+ Binding 1035

Site and Cell Adhesive

Ll -1

Function

~D134A

~.D134K

B

A

--1

wild type

D134A

wild type

D134A

1.0 0.1 001

1.0 0.1 0.01

200--

-mm

LW

97. 67-

15 30 60 120 12

Figure 3. Mutant Uvomorulin Presence of Ca*+

345 Is Resistant

6

7

0

15 30 60 120

(mm)

CaClz

Figure 4. Mutant Proteins Are More Susceptible age at or near the Site of Substitutions

to Proteolytic

Time

(mM)

9

to Mild Trypsinization

in the

Cells expressing normal (Ll-1) or mutant (L-D134K and L*D134A) uvomorulin were lysed with SDS-PAGE sample buffer without trypsinization (lanes 1, 4, and 7) or after trypsinization (O.Ol%, 10 min, 37X), in the presence of 2 mM CaZ+ (lanes 2,5, and 6) or 1 mM EGlA (lanes 3,6, and 9) and subjected to immunoblot analysis using affinity-purified rabbit anit-gp94.

cells for Ca2+-dependent cell aggregation assays (see below). lmmunoblot analysis from cell lysates of Ll-1, L-D134K, and L-D134A cells gave identical results for control and Ca*/trypsin-treated cells in that the intact 120 kd protein was detected (Figure 3). No degradation products were observed in the case of LD134K and LD134A cells. As expected, in the absence of Ca2+, both wild-type and mutant proteins were degraded (Figure 3, lanes 3, 6, and 9). After trypsinization, both wild-type and mutant proteins were present on the cell surface in similar amounts as judged by immunofluorescence tests (data not shown). It is known that at high trypsin concentrations in the presence of 2 mM Ca2+, a stable 84 kd fragment is released from normal uvomorulin. Metabolically labeled Ll-1, L-D134A, and L-D134K cells were treated with Ca2+/ trypsin, and the soluble material was subjected to immunoprecipitation experiments. Cells were digested with 0.1% trypsinn mM Ca2+ (instead of 0.01% trypsin as in Figure 3) for different times as indicated in Figure 4A. The 84 kd fragment from wild-type uvomorulin was stable at all time points. In contrast, the 84 kd fragment, which was released from mutant uvomorulin D134A, was progressively converted into 70 kd and 54 kd fragments (Figure 4A). When cells were incubated with 0.1% trypsin for 1 hr in the presence of different Ca2+ concentrations, both wild-type and mutant uvomorulin became susceptible to proteolytic degradation at low Ca* (Figure 48). Although the relative amount of the lower molecular weight fragments was higher in D134A than in wild-type uvomorulin, major and distinct fragments of 70 kd and 54 kd were generated in both cases. Mutant L-D134K gave identical results (data not shown). Single Amino Acid Substitution Inactivates the Adhesive Function The Ca2Vtrypsin experiments clearly demonstrate that both mutant proteins were stable when cells were treated

Cleav-

(A) Metabolically labeled L cells expressing wild-type (Ll-1) or mutant (D134A) uvomorulin were treated with 0.1% trypsin, 2 mM Ca2+ for the time indicated at 3PC, and the soluble 94 kd fragment was immunoprecipitated. The mutant 64 kd fragment was progressively converted into smaller fragments of 70kd and 54 kd. (B) Same sxperimental design as above but incubating cells (0.1% trypsin, 3PC, 1 hr) in the presence of different Ca*+ concentrations. At low Ca*+, the 64 kd fragment was cleaved into smaller fragments with similar size in wild-type and mutant uvomorulin.

with Ca2+/trypsin under standard conditions for Ca2+-dependent cell aggregation assays (Figure 3). These conditions destroy the Ca2+-independent cell adhesion mechanism but leave the Ca2+-dependent cell adhesion intact because of the Ca2+/trypsin resistance of the latter (Takeichi, 1988). Cell aggregation assays were performed to elucidate whether the mutant uvomorulins could still express their adhesive function. Both mutant uvomorulins showed no adhesiveness at all (Figure 5). Thus, a single amino acid substitution completely abolished the adhesive properties of uvomorulin. In cell mixing experiments between Ll-1 and L-D134A or L-D134K cells, mutant polypeptides were unable to interact with wild-type uvomorulin (data not shown). Discussion It has been shown previously that Ca2+ binds to uvomorulin, but the site of interaction remained to be determined (Ringwald et al., 1987). We show here that one of the putative Ca2+ binding motifs previously identified by primary structure analysis can indeed complex Ca2+. For the synthetic peptides, Ca2+ binding is abolished by the Asp to Lys replacement. In addition, the Ko value determined for the unaltered site in the peptide corresponds to the midpoint concentrations observed for the physiological effect of Ca2+ on the adhesive function of uvomorulin (Takeichi, 1977). Synthetic peptide analogs of Ca2+ binding sites in proteins often exhibit smaller Cap+ affinities than the corresponding sites in the intact proteins (Reid, 1987; Borin et al., 1989). For uvomorulin, direct information on the Ca2+ affinity to the site in the intact protein is not available at present. Indirect evidence (Hyafil et al., 1981) suggests the presence of one or several sites of higher affinity (Ko = 10e5 M) than that of pep-

Cell 1036

Figure 5. The Single Amino Acid Substitution the Adhesive Function in Both Mutants Cell aggregation pressing normal The single amino function in both

Completely

Abolished

assay with untransfected (L) and transfected cells ex(Ll-1) or mutant (L-D134K and L-D134A) uvomorulin. acid substitution completely abolished the adhesive mutants.

tide B, but their relation with the motif B site is unknown. Attempts to monitor binding of Ca*+ to the intact extracelMar domain of uvomorulin represented by its 84 kd fragment have failed so far because of the lack of sufficiently large spectroscopic signals (data not shown). In particular, there was no detectable change of the CD spectra of the fragment upon addition or removal of Ca*+, which argues against gross conformational changes. To test whether a similar change in the Ca*+ binding site would affect the function of uvomorulin, cDNAs were constructed encoding mutant polypeptides with a single amino acid substitution (Asp to Lys or Ala) in the same Ca*+ binding site. After transfection into L cells, the mutant polypeptides were expressed on the cell surface in an amount similar to wild-type uvomorulin in Ll-1 cells. The mutant proteins were also identical to wild-type uvomorulin with respect to their association with catenin a, 8, and y (Figure 28; Ozawa et al., 1989, 1990). When transfectants expressing wild-type or mutant uvomorulin were subjected to trypsin digestion at high Ca*+, the mutant protein was found to be distinctly more susceptible to proteolytic degradation. This can best be explained by a loss of Ca*+ protection due to the amino acid substitution in the Ca*+ binding site. The mutant proteins were not completely degraded by trypsin, rather, discrete and stable fragments were generated. The molecular size of the major fragment generated (70 kd) fits well with cleavage near the site of the amino acid substitution. Lack of stabilization by Ca*+ binding may render this area of the protein susceptible to trypsin cleavage. This is in agreement with the observation that fragments of similar molecular size are generated from the wild-type 84 kd fragment at low Ca*+ concentrations. The fact that in wild-type and mutant uvomorulins trypsin generates defined fragments supports the domain structure deduced from the primary sequence (Ringwald et al., 1987). The data moreover suggest that these domains might function independently with respect to Ca’Vtrypsin sensitivity. Our most striking observation is that a single amino acid substitution in one Ca*+ binding site inactivates the adhe-

sive properties of uvomorulin. In fact, the substitution created a much stronger effect on the adhesive function compared with the rather moderate effect on protein stability seen only at high trypsin concentrations. This strongly suggests that at least this Ca*+ binding site is of crucial importance for the functioning of uvomorulin. Since this site is common to all cadherins, this finding might be relevant to other members of the cadherin gene family. Recently, attempts were made to map the sites that regulate the homophilic specificity of E-and P-cadherin by analyzing chimeric and point-mutated proteins (Nose et al., 1990). It was found that the amino-terminal 113 residues of the proteins mediate the adhesive selectivity. The amino acid substitution we have performed is at position 134, which is outside of the 113 amino acid domain. Thus it is unlikely that the Ca*+ binding site takes part in determining the adhesive specificity. It is possible that the substitution induces achange in the protein structure due to the loss of Ca*+ binding, which in turn affects a more distant site that is essential for the adhesive specificity. However, numerous substitutions in the 113 amino acid domain neither abolished nor changed the specificity of adhesiveness (Nose et al., 1990). This suggests that Ca*+ is of crucial importance for the molecular mechanism of adhesion. If so, Ca*+ could be a regulatory factor in the homophilic interaction of cadherins. Local changes in Ca*+ concentrations could influence the adhesive properties of cadherins although presently there is no evidence for Ca*+ gradients in the extracellular space of tissues or during development. Alternatively, Ca*+ may in fact be directly involved in the interaction between molecules from neighboring cells (Ringwald et al., 1987). Obviously an interaction of this type would also be abolished by a mutation that abolishes Ca*+ binding. Our results provide the first evidence that a single Ca*+ binding site in the amino-terminal domain of uvomorulin is essential for the functioning of the entire molecule. This does not exclude the possibility that there are other related or different sites in the repeating domains of the protein of comparable importance. Sites in the other two domains may possess interaction potentials of their own but the data clearly underline the importance of a functional amino-terminal domain. Experimental

Procedures

Circular Dlchrolsm and Tltratlon with Calcium Peptide S contained the amino acid sequence of motif I3 (Figure 2A). It was terminated by VLL instead of VNT in the uvomorulin sequence in order to avoid complications in the synthesis and purification (Reid, 1987). The first aspartic acid of motif B was replaced by lysine in peptide 6.. Peptides were synthesized and high pressure liquid chromatography (HPLC) purified (each over 90% purity) by Novabiochem (Switzerland). Circular dichroism (CD) spectra were recorded by a Cary 61 spectropolarimeter calibrated with d-lo-camphorsulfonic acid in a thermostatted quartz cell 1 mm in length. The molecular ellipticity [O] (expressed in deg cm*/dmol) was calculated on the basis of a mean residue molecular mass of 104.7 daltons for peptide B and 104.3 daltons for peptide 8: Peptide concentrations were 0.5 mglml in 10 mM Tris-HCI (pH 7.4). Prior to Ca2+ titration, the peptide solution (about 2 mglml) in 10 mM Tris-HCI (pH 7.4) was freed of Gas+ and other divalent ions by

Ca2+ Binding 1037

Site and Cell Adhesive

Function

passing it over a Chelex column (1 cm x 5 cm) (Bio-Rad) according to the protocol provided by the manufacturer. Chelex-treated 10 mM Tris-HCI buffer was used for elution and for adjusting the peptide concentration to 0.5 mg/ml after decalcification. Completeness of decalcification was tested for in an aliquot of the solution. Only those solutions in which no change of ellipticity was recorded after addition of EDTA to a final concentrations of 1 mM were employed for titration experiments. Titrations were performed with 1 ml of the peptide solution in a rectangular cell of 1 cm path length to which 2.56 ul aliquots of a 200 mM CaCI, solution were added up to a final concentration of 20 mM, at which a plateau value was reached. Readings were taken at constant ware length (206 urn) and corrected for the dilution factors. At the end of the experiment, EDTA was added in 5 mM excess to test for reversibility. A complete reversal of the calcium-induced spectroscopic change was observed.

trypsin (Sigma, type Xl) in HEPES-buffered saline (HBS) containing 2 mM CaCla or 1 mM EGTA for 10 min at 3pc. After adding 40 ul of soybean trypsin inhibitor (Boehringer, 05% in HBS), cells were collected and boiled in 560 ul of SDS-PAGE sample buffer (Laemmli, 1970). Aliquots (100 ul) were subjected to SDS-PAGE, and immunoblot analysis was performed as described (Ringwald et al., 1967). To analyze the soluble 64 kd fragment of uvomorulin, [erS]methionine-labeled cells were incubated with 0.5 ml of 0.1% (w/v) of trypsin in HBS containing 2 mM CaCla at 3pC for the time indicated in the Figure 4A. For Ca*+ titration experiments, [asS]methionine-labeled cells were washed twice in HBS containing 1 mM EDTA and once in HBS, and incubated in 0.5 ml of 0.1% (whr) of trypsin in HBS containing different concentrations of CaC12 for 1 hr at 3pc. After adding 50 t.11 of soybean trypsin inhibitor (20 mglml in HBS), the supernatants were collected and subjected to immunoprecipitation.

Analytlcal Ultracantrtfugation Analytical ultracentrifugation was performed in a Spinco model E analytical ultracentrifuge (Beckman Instruments) equipped with Schlieren optics. Sedimentation equilibrium runs were performed by the short column method (Yphantis, 1960) with a filled Epon double sector cell in an AnD rotor at 46,000 rpm at 2oOC. The concentration of peptide B was 3.6 mg/ml in 10 mM Tris-HCI (pH 7.4) to which either 1 mM EDTA or 2 mM or 20 mM CaCls were added. The apparent molecular mass (uncorrected for concentration dependence and calculated with a partial specific volume of 0.72 ml/g) was 1300 (rt 150) daltons in the absence and 1600 (* 200) daltons in the presence of calcium. These values may be compared with the formula molecular mass of 1361.5 daltons of the monomeric peptide. A small association tendency may exist at the relatively high peptide concentration of 2.6 mM, but most of the peptide is in monomeric form even in the presence of calcium. Note that the CD measurements were performed at about Sfold lower peptide concentrations, at which even less association is expected.

Cell Aggmgatlon Cells were dissociated by trypsin in the presence of 2 mM CaC12 as described above. After washing with a I:1 mixture of HBS and DMEM containing 4% FCS, cells were resuspended in the same medium containing 5 pa/ml of DNAase I (Boehringer). Cells were allowed to aggregate for 45 min at 3pc with a constant rotation of 70 rpm. The extent of cell aggregation was calculated according to Nagafuchi and Takeichi (1966) by the index (No-N,)/Nc where Nr is the total particle number after the incubation (45 min) and No is the total particle number at the initiation of incubation.

cDNA Constructs Plasmid pSUM-1 contains full-length uvomorulin cDNA (Ozawa et al., 1969). cDNAs encoding uvomorulin polypeptides with substitutions in the putative Ca*+ binding site were constructed as schematically outlined in Figure 2A. A 74 bp BamHI-Hincll fragment coding for 25 amino acid residues of the Ca*+ binding B motif was replaced by the following synthetic oligonucleotide. An oligonucleotide with the sequence of GATCCGTTGCAGAAGGCGCTGTTCCAGGAACCTCCGTGATGAAGGTCAGCGCTACCAAGGCAGACGATGACGTC and its complementary oligonucleotide were used to substitute Asp 134 in the motif to Lys (see Figure 2A), and for the subsequent construction of mutant cDNAs, a unique Eco47lll restriction enzyme site (AGCGCT) was introduced without changing the amino acid sequence. An oligonucleotide GCTACCGCGGCAGACGATGACGTT and its complementary oligonucleotide were used to change Lys to Ala residue (see Figure 2A). The sequence of the substituted cDNAs was confirmed by direct DNA se quencing (Hattori and Sakaki, 1986) and the cDNAs were subcloned into the expression vector pSVtkneo5 (Nicolas and Berg, 1963) as described (Ozawa et al., 1989). DNA Ransfection Purified plasmid DNAs were cium phosphate precipitation ratio as described (Ozawa et selection, cells expressing cloned.

introduced into mouse L-tk- cells by caltogether with pSVtkneo5 at a IO:1 molar al., 1969). After 2 weeks of G418 (1 ma/ml) uvomorulin were isolated by FACS and

Immunopmclpitatlon and lmmunoblot Antibodies against the extracellular part of mature uvomorulin (antigp64) were purified as described (Vestweber and Kemler, 1965). Cells (1 x 10s) were labeled with 50 t&i/ml IssS]methionine (Amensham) for 16 hr in Dulbeccos modified Eagle’s medium (DMEM) without methionine, 10% FCS and lysed with phosphate-buffered saline (PBS) containing 1% Triton X-100, 1% NP40. 2 mM CaC12, and 1 mM phenylmethylsulfonyl fluoride (PMSF). After centrifugation, supernatants were incubated with afftntty-purtfled antibodies, and immunecomplexes were collected by protein A-Sephamse CL46 (Pharmacia). To analyze Ca2+ sensitivity of uvomorulin polypeptides, cells (5 x lC@) were washed with PBS and incubated with 1 ml of 0.01% (w/v)

We thank Ariel Lustig for performing the ultracentrifugation experiments, Therese Schulthess for expert technical assistance, Lore Lay for preparing the photographs, and Rosemary Schneider for typing the manuscript. We thank Drs. Jean Langhorneand Peter Nielsen for help ful discussion and critical reading of the manuscript. This work was supported by the Swiss National Science Foundation (to J. E.) and by the Deutsche Forschungsgemeinschaft. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “adverfisement” in accordance with 16 USC Section 1734 solely to indicate this fact. Received

July 24, 1990; revised

September

10, 1990.

References Boiler, K., Vestweber, D., and Kemler, R. (1965). Cell adhesion molecule uvomorulin is localized in the intermediate junctions of adult intestinal epithelial cells. J. Cell Biol. 100, 327-332. Borin, G., Ruzza, P, Rossi, M.. Calderan. A., Marchiori. F., and Peggion, E. (1969). Conformation and ion binding properties of peptides related to calcium binding domain Ill of bovine brain calmodulin. Biopolymers 28, 353-369. Hattori, M., and Sakaki, Y. (1966). Dideoxy sequencing method using denatured plasmid templates. Anal. Biochem. 752, 232-236. Hyafil, F, Morello, D., Babinet, C., and Jacob, F (1960). A cell surface glycopmtein involved in the compaction of embryonal carcinoma cells and cleavage stage embryos. Cell 21, 927-934. Hyafil, F., Babinet, C., and Jacob, F. (1961). Cell-cell interactions in early embryogenesis: a molecular approach to the role of calcium. Cell 26, 447-454. Kemler, R., Babinet, C., Eisen, H., and Jacob, F. (1977). Surface antigen and early differentiation. Proc. Natl. Acad. Sci. USA. 74, 44494452. Kemler, R., Ozawa, M., and Ringwald, M. (1969). Calcium-dependent cell adhesion molecules. Curr. Opinion Cell Biol, 1, 692-697. Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 660-665. Le Bivic, A., Sambuy, Y., Mostov, K., and Rodriguez-Boulan, E. (1990). Vectorial targeting of an endogenous apical membrane sialoglycoprotein and uvomorulin in MDCK cells. J. Cell Biol. 110, 1533-1539. Nagafuchi, A.. and Takeichi, M. (1966). Cell binding function of E-cad-

C@ll 1036

herin is regulated 3664.

by the cytoplasmic

domain.

EMBO

J. 7, 3679-

Nicolas, J. F., and Berg, f? (1963). Regulation and Expression of Genes Transduced into Embryonal Carcinoma Cells. In Tetracarcinoma Stem Cells, L. M. Silver, G. R. Martin, and S. Strickland, eds. (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory), pp. 469-485. Nose, A., Tsuji, K.. and Takeichi, determining sites in cadherin 147-155.

M. (1990). Localization of specificity cell adhesion molecules. Cell 67,

Ozawa, M., Baribault, H., and Kemler, R. (1969). The cytoplasmic domain of the cell adhesion molecule uvomorulin associates with three independent proteins structurally related in different species. EMBO J. 8, 17ll-1717. Ozawa, M., Ringwald, M., and Kemler, R. (1990). Uvomorulin-eatenin complex formation is regulated by a specific domain in the cytoplasmic region of the cell adhesion molecule. Proc. Natl. Acad. Sci. USA. 87, 4246-4250. Reid, R. E. (1967). A synthetic 33-residue analogue of bovine brain calmodulin calcium binding site III: synthesis, purification and calcium binding. Biichemfstry 26, 6070-6073. Ringwald, M., Schuh, R., Vestweber, D., Eistetter, H., Lottspeich, F., Engel, J., Dolz, R, Jahnig, F, Epplen, J., Mayer, S, Miilfer, C., and Keller, R. (1967). The structure of cell adhesion molecule uvomorulin. Insights into the mo)ecular mechanism of Gas+-dependent cell adhesion. EMBO J. 8, 3647-3653. Stuart, D. I., Acharya, K. R., Walker, N. P C., Smith, S. G., Lewis, M., and Philips, D. C. (1966). a-lactalbumin possesses a novel calcium binding loop. Nature 324, 64-67. Takeichi, M. (1977). Functional erties and some cell surface

correlation between cell adhesive prop proteins. J. Cell Biol. 75, 464-474.

Takeichi, M. (1966). The cadherins: cell-cell adhesion molecules trolling animal morphogenesis. Development 702, 639-655.

con-

Vestweber, D., and Kemler, R. (1984). Rabbit antiserum against a purified surface glycoprotein decompacts mouse preimplantation embryos and reacts with specific adult tissues. Exp. Cell Res. 752, 169-176. Vestweber, D., and Kemler, R. (1965). Identification of a putative adhesion domain of uvomorulin. EMBO J. 4, 3393-3396. Yphantis, peptides

D. A. (1960). and proteins.

Rapid determination of molecular Ann. NY Acad. Sci. 88, 566-601.

weights

cell of

Single amino acid substitutions in one Ca2+ binding site of uvomorulin abolish the adhesive function.

We show that a synthetic peptide corresponding to the sequence of one putative Ca2+ binding motif of the cell adhesion molecule uvomorulin is able to ...
694KB Sizes 0 Downloads 0 Views