TISSUE-SPECIFIC STEM CELLS SIRT6 Regulates Osteogenic Differentiation of Rat Bone Marrow Mesenchymal Stem Cells Partially via Suppressing the Nuclear Factor-jB Signaling Pathway HUALING SUN, YANRU WU, DONGJIE FU, YINCHEN LIU, CUI HUANG Key Words. SIRT6 • BMSCs • Nuclear factor-jB • Collagen/chitosan/HA scaffolds • Bone regeneration • Calvarial defects

The State Key Laboratory Breeding Base of Basic Science of Stomatology (Hubei-MOST) and Key Laboratory of Oral Biomedicine Ministry of Education, School and Hospital of Stomatology, Wuhan University, Wuhan, Hubei, People’s Republic of China Correspondence: Cui Huang, PhD, The State Key Laboratory Breeding Base of Basic Science of Stomatology (Hubei-MOST) and Key Laboratory for Oral Biomedical Ministry of Education, School, and Hospital of Stomatology, Wuhan University, Wuhan, Hubei 430079, People’s Republic of China. Telephone: 86–278-768– 6130; Fax: 86–278-787–3260; e-mail: [email protected] Received September 2, 2013; accepted for publication January 26, 2014; first published online in STEM CELLS EXPRESS February 9, 2014. C AlphaMed Press V

1066-5099/2014/$30.00/0 http://dx.doi.org/ 10.1002/stem.1671

ABSTRACT Sirtuin 6 (SIRT6) is a NAD-dependent deacetylase involved in lifespan regulation. To evaluate the effect of SIRT6 on osteogenesis, rat bone marrow mesenchymal stem cells (rBMSCs) with enhanced or reduced SIRT6 function were developed. We observed that SIRT6 knockdown significantly reduced the mRNA levels of several key osteogenic markers in vitro, including alkaline phosphatase (ALP), Runt-related transcription factor 2 (RUNX2), and osteocalcin, while overexpression of SIRT6 enhanced their expression. Additionally, SIRT6 knockdown activated nuclear factor-jB (NF-jB) transcriptional activity and upregulated the expression of acetyl-NF-jB p65 (Lys310). The decreased osteogenic differentiation ability of rBMSCs could be partially rescued by the addition of NF-jB inhibitor BAY 11–7082. Furthermore, SIRT6 overexpression in rBMSCs combined with the use of collagen/chitosan/hydroxyapatite scaffold could significantly boost new bone formation in rat cranial critical-sized defects, as determined by microcomputed tomography and histological examination. These data confirm that SIRT6 is mainly located in the nuclei of rBMSCs and plays an essential role in their normal osteogenic differentiation, partly by suppressing NF-jB signaling. STEM CELLS 2014;32:1943–1955

INTRODUCTION The balance between bone resorptive and formative processes can be disrupted by aging, resulting in faster bone resorption and osteoporosis with typically increased osteoclast formation and decreased osteoblast formation [1]. Age-related bone loss may be due to telomere shortening, decreased production of growth factors, oxidative stress, and DNA damage, which affect the self-renewal capacity of progenitors as well as the production of osteoblasts from them [2]. The understanding of genetic factors linking aging and longevity to the maintenance of sufficient bone mass throughout life has been a very active area of research. Sirtuin 6 (SIRT6), a member of the evolutionarily conserved sirtuin family of NAD1dependent protein deacetylases, plays an important role in lifespan regulation [3, 4]. It participates in several important biological processes including maintenance of genomic stability, DNA repair, and anti-inflammatory processes [5, 6]. An enhanced extent of DNA double-strand breaks (DSBs) can be detected during senescence induction in human mesen-

STEM CELLS 2014;32:1943–1955 www.StemCells.com

chymal stem cells (MSCs) [7]. SIRT6 functions as an anti-aging gene by promoting the repair of these DSBs through homologous recombination [8, 9]. SIRT6-deficient mice are small and osteoporotic with a 30% loss in bone mineral density, develop a striking degenerative phenotype, and typically die at approximately 4 weeks of age [4]. On the other hand, male transgenic mice overexpressing SIRT6 have a longer life span and improved metabolic indices [3]. It has been confirmed that human SIRT6 is chiefly expressed in bone and ovarian cells [10]. However, the expression and functional characteristics of SIRT6 in the bone marrow MSCs (BMSCs) remain to be elucidated. NF-jB plays important roles in normal skeletal remodeling and bone homeostasis by controlling the differentiation of osteoprogenitor cells into osteoclasts, osteoblasts, osteocytes, and chondrocytes [11]. Increased NF-jB activity has been shown to decrease mature osteoblast function and impair production and maturation of bone matrix [12]. RelA/p65, a subunit of NF-jB, promotes osteoclast differentiation by blocking a RANKL-induced apoptotic JNK pathway in mice [13]. Osteoporotic SIRT1-deficient mice could be rescued by C AlphaMed Press 2014 V

Effect of SIRT6 on rBMSCs Osteogenesis

1944

pharmacological inhibition of NF-jB [14]. Interestingly, SIRT6 binds to the NF-jB subunit RelA and attenuates NF-jB signaling by modifying the chromatin of NF-jB target genes [15]. Haploinsufficiency of RelA rescues the early lethality and aging-like phenotype of SIRT6-deficient mice [15]. SIRT6 has been shown to protect cardiomyocytes from hypertrophy through inhibition of NF-jB-dependent transcriptional activity [16]. Furthermore, nuclear expression of the NF-jB p65/RelA protein is increased after SIRT6 inhibition in human dermal fibroblasts, leading to a decrease in type I collagen synthesis [17]. It is well known that type I collagen is the major structural component of not only the dermal ECM but also of bone. Taking all these facts together, we hypothesized that SIRT6 plays an important role in regulating osteogenic differentiation of BMSCs through the NF-jB signaling pathway. In this article, we investigated the expression and localization of SIRT6 in rat BMSCs (rBMSCs), and its effect on the osteogenic differentiation of rBMSCs. We found that SIRT6 knockdown impaired osteogenesis of rBMSCs in vitro and upregulated NF-jB transcriptional activity and the expression of acetyl-NF-jB p65 (Lys310). The decrease in osteogenic differentiation of rBMSCs as a consequence of SIRT6 knockdown could be partially rescued by the addition of NF-jB inhibitor BAY 11–7082. We also used a rat calvarial defect model for transplanting SIRT6-overexpressing rBMSCs combined with the use of collagen/chitosan/hydroxyapatite (HA) scaffold (CCHS). We found that SIRT6 overexpression could promote the osteogenic differentiation of rBMSCs in vitro and in vivo.

MATERIALS

AND

METHODS

Isolation of rBMSCs The isolation and culture of rBMSCs from the tibias and femurs of 8-week old male Sprague-Dawley (SD) rats were performed as described previously [18]. Briefly, the rats were killed by cervical dislocation and sterilized using 75% ethanol for 5 minutes before surgery. After dissecting the metaphyseal ends of the bones under sterile conditions, the bone marrow cells were flushed out with Dulbecco’s modified Eagle’s medium (DMEM) (Catalog No. SH30022; Hyclone, Beijing, China, www.thermo.com.cn) using a 5-ml syringe, and centrifuged at 1,000 rpm for 5 minutes. The cells were resuspended and expanded in growth medium (a-minimum essential medium, Catalog No. SH30265; Hyclone) containing 10% fetal bovine serum (FBS) and 1% Penicillin/Streptomycin at a concentration of 8.5 3 107 cells per 10 cm dish (NEST, Wuxi, China, www.cell-nest.com), and incubated at 37 C under conditions of 5% CO2 until 70–80% confluence was reached. The medium was changed every 3 days. Upon reaching 70–80% confluence, adherent cells were trypsinized, harvested, and expanded in T-75 flasks (NEST, Wuxi, China). Cells that had undergone 6–9 population doublings were used in subsequent experiments.

Immunofluorescence Staining SIRT6 expression in primary rBMSCs was examined by immunofluorescence staining. Briefly, rBMSCs in growth medium were seeded in 24-well plates (NEST, Wuxi, China) at a density of 2 3 104 cells per square centimeter. After incubation for 24 hours, the rBMSCs were fixed with 4% paraformaldehyde C AlphaMed Press 2014 V

for 15 minutes at room temperature, and washed using phosphate-buffered saline (PBS) solution. The cells were then treated with 0.5% Triton X-100 for 15 minutes at room temperature, followed by incubation with 10% normal goat serum in PBS for 1 hour (Sigma, St. Louis, MO, www.sigmaaldrich.com). Anti-SIRT6 primary antibody (1:400; Proteintech, Wuhan, China, www.ptgcn.com) was then added and incubated for 2 hours at 37 C. For visualization, TRITC-conjugated secondary antibody (1:150; ZSGB-Bio, Beijing, China, www.zsbio.com) was used. The nuclei were visualized by staining the cells with DAPI (Sigma) for 3 minutes at room temperature. The cells were observed under a fluorescent microscope (DP71, OLYMPUS, China, www.olympusfluoview.com) and photographed (DPController, OLYMPUS, China).

Cloning of Human SIRT6 Total RNA was extracted from human bone marrow cells (Cyagen, Guangzhou, China, www.cyagen.com.cn). Reverse transcription was carried out using M-MuLV reverse transcriptase (Fermentas, Beijing, China, www.thermo.com.cn), and fulllength cDNA for human SIRT6 was obtained by polymerase chain reaction (PCR) using PrimeSTAR Max DNA polymerase (Takara, Dalian, China, www.takara.com.cn) and the primers forward: 50 -CCGGAATTCATGTCGGTGAATTACGC-30 and reverse: 50 - CGCGGATCCCAAAGTGAGACCACGAGAG-30 . EcoRI and BamHI restriction sites (underlined) were incorporated in the primers to facilitate cloning. Purified PCR products were subsequently cloned into a pLVX plasmid (Clontech, Beijing, China, www.clontech.com). The construct was verified by sequencing and designated pLVX-human-SIRT6.

Design and Cloning of shRNA Against Rat SIRT6 A pair of 59-nt long oligonucleotides (50 -GATTCGTGTAAGACG CAGTACGTGTTCAAGAGACACGTACTGCGTCTTACACTTTTTTG-30 and 50 -AATTCAAAAAAGTGTAAGACGCAGTACGTGTCTCTTGAACACGTACT GCGTCTTACACG-30 ), encoding a 19-nt-long short-hairpin RNA (shRNA) against rat SIRT6, was designed. Additional BamHI and EcoRI restriction sites were incorporated in the sequences to facilitate cloning. A BLAST search was performed using the National Center for Biotechnology Information (NCBI) Expressed Sequence Tags database to confirm that the shRNA construct specifically targeted rat Sirt6. A scrambled shRNA sequence (TTCTCCGAACGTGTCACGT), exhibiting no homology to the rat sequence database, was used as a negative control. The oligonucleotides were phosphorylated, annealed, and cloned into the pLVX-shRNA2 vector (Clontech). The resulting vectors, designated pLVX–rat-shSIRT6 and pLVX–rat-shSIRT6–Control, were subsequently verified by sequencing.

Lentiviral Packaging and Cell Infections Human-SIRT6, rat-shSIRT6–Control, and rat-shSIRT6 lentiviral particles were produced by triple transfections of 293T cells (Invitrogen, Carlsbad, CA, www.invitrogen.com) with the vectors pLVX–human-SIRT6, pLVX–rat-shSIRT6–Control, or pLVX– rat-shSIRT6, respectively, along with psPAX2 and pMD2.G. For infection, rBMSCs were incubated with lentiviral particles and polybrene (5 lg/ml) in growth medium. After 6 hours, the infection medium was discarded, and the cells were used for experiments. The expression of SIRT6 was quantified by real-time PCR (RT-PCR) and Western blot analyses. STEM CELLS

Sun, Wu, Fu et al.

MTT Cell Proliferation Assay For cell proliferation assays, rBMSCs were cultured in growth medium in 96-well plates (NEST, Wuxi, China) at an initial density of 6 3 103 cells per square centimeter, and incubated at 37 C under conditions of 5% CO2 for 24, 48, 72, and 96 hours. At each time point, 20 ll of MTT reagent (5.0 mg/ml; Beyotime, China, www.beyotime.com) was added to the plates, followed by further incubation for 4 hours at 37 C. The supernatant was then removed and dimethylsulfoxide was added. Optical density (OD) was measured at 570 nm using a microplate reader (PowerWave XS2, BioTek).

Osteogenic Differentiation Protocol rBMSCs were cultured in growth medium in 6-well or 12-well cell culture plates (NEST, Wuxi, China) at a density of 2 3 104 cells per square centimeter, and incubated for 72 hours at 37 C under conditions of 5% CO2. Subsequently, the cells were cultured in an osteogenic induction medium, which consists of growth medium supplemented with 50 lg/ml L-ascorbate phosphate, 10 mM b-glycerophosphate, and 10 nM dexamethasone. All three supplements were obtained from Sigma. This time point was considered as day 0. Cells were maintained with the addition of fresh osteogenic induction medium every 2 days for 21 days.

1945

Table 1. Primer sequences for real-time quantitative polymerase chain reaction Genes

SIRT6 ALP RUNX2 OCN EF-1a GAPDH

Primer sequence (50 –30 ) (forward/reverse)

CGTGGATGAGGTGATGTG GGCTTATAGGAACCATTGAGA GAAGGAGGCAGGATTGAC ATCAGCAGTAACCACAGTC CCGCACGACAACCGCACCAT CGCTCCGGCCCACAAATCTC CAGGAGGGCAGTAAGGTGG CAGGGGATCTGGGTAGGG CTCCACTTGGTCGTTTTGCTGT AGACTGGGGTGGCAGGTGTT TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG

Product size (bp)

158 141 289 84 165 87

Abbreviations: ALP, alkaline phosphatase; EF-1a, eukaryotic translational elongation factor 1a; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; OCN, osteocalcin; RUNX2, Runt-related transcription factor 2; SIRT6, Sirtuin 6.

hai, China) was added. The plate was visualized and photographed using a light microscope.

Real-Time Quantitative Polymerase Chain Reaction

Cells were cultured in osteogenic induction medium in 12-well plates for 7 days. For alkaline phosphatase (ALP) staining, cells were fixed with 4% paraformaldehyde for 15 minutes. Subsequently, cells were washed twice with PBS and stained with the ALP staining solution, comprising of naphthol AS-MX phosphate and fast red violet LB salt (Sigma). The percentage of ALP-positive cells in each group was calculated. For ALP activity measurement, cells were lysed in RIPA lysis buffer (Beyotime, China), and the lysate (10 ll) was incubated with 90 ll of fresh solution containing p-nitrophenyl phosphate substrate at 37 C for 30–60 minutes. The reaction was stopped by the addition of 0.5 N NaOH (100 ll), and the absorbance was measured at 405 nm using a microplate-reading spectrophotometer (PowerWave XS2, BioTek). Total protein concentration was measured using a BCA Protein Assay Kit (Beyotime, China). The relative ALP activity was expressed as the percentage change in OD per unit time per milligram of the protein; or ALP activity 5 (DOD/ 15 minutes/mg protein) 3 100.

Total RNA was extracted from cultured cells using Trizol (Invitrogen, Carlsbad). First-strand cDNA was transcribed from 1 lg of RNA using M-MuLV reverse transcriptase (Fermentas) according to the manufacturer’s protocol. Quantitative RT-PCR (qRT-PCR) was performed in triplicate using SYBR Premix Ex Taq (Takara, Japan) on an ABI 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, www.appliedbiosystems.com). The thermal cycling conditions included 30 seconds at 95 C, followed by 40 cycles of 95 C for 5 seconds and 60 C for 34 seconds. The primers (Anygene Biological Technology, Wuhan, China, www.anygene.net) for the rat genes were listed in Table 1. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and eukaryotic translation elongation factor 1a (EF-1a) were used as internal control genes (ICGs), and relative gene expression levels were determined using the 22DDCt method with the aid of ABI 7500 Software (Applied Biosystems, Foster City, CA) [19]. Briefly, the mean cycle threshold (Ct) value of the target gene was normalized to that of ICGs to obtain a DCt value, which was further normalized to the control samples to obtain the DDCt value. The value of 22DDCt was used to calculate the relative fold change of gene expression.

Alizarin Red and von Kossa Staining

Western Blot Analysis

After osteogenic induction, mineral deposition was assessed by staining with Alizarin-red or von Kossa on day 21. Cells were fixed with 4% paraformaldehyde for 15 minutes at room temperature and then washed with distilled water. A 1% solution of alizarin red was added and incubated for 10–20 minutes at room temperature, followed by rinsing with distilled water. The stain was desorbed with 10% cetylpyridinium chloride (Sigma) for 1 hour. The solution was collected and 200 ll was plated on 96-well plates, and read at 590 nm using a spectrophotometer. The readings were normalized to total protein concentration. For von Kossa staining, 5% silver nitrate solution (Aladdin, Shanghai, China, www.aladdin-reagent.com) was added to the fixed cells and exposed to UV radiation for 1 hour. To remove the nonspecific staining, 2% sodium thiosulfate (Aladdin, Shang-

rBMSCs were infected with four different lentiviral vectors. After 48 hours, cells were lysed in RIPA buffer (Beyotime, China) and centrifuged, and the supernatant was collected to examine SIRT6 protein expression. After treatment with NF-kB inhibitor BAY 11–7082 for 12 hours, the SIRT6-knockdown rBMSCs were lysed in RIPA buffer as mentioned above, and the supernatant was collected to examine the levels of acetyl-NF-jB p65 (Lys310). Protein concentrations were determined using a BCA Protein Assay Kit (Beyotime, China). In total, 40 mg of protein from each sample diluted in loading buffer (Beyotime, China) was boiled for 5 minutes at 95 C, separated by SDS polyacrylamide gel electrophoresis (10% SDS-PAGE, Beyotime, China), and wetly transferred onto a polyvinylidene fluoride membrane using a glycine transfer buffer (192 mM glycine, 25 mM Tris,

ALP Staining and ALP Activity Assay

www.StemCells.com

C AlphaMed Press 2014 V

1946

20% methanol [v/v]) for 2 hours at 200 mA, 4 C. Nonspecific reactivity was blocked using 5% bovine serum albumin in Trisbuffered saline containing Tween-20 (TBST). The blots were incubated with primary antibodies against SIRT6 (1:1000; Proteintech, Wuhan, China) or acetyl-NF-jB p65 (Lys310; 1:1000; Cell Signaling Technology, Shanghai, China, www.cellsignal.com) overnight at 4 C. An anti-b-actin polyclonal antibody (1:2000; Santa Cruz Biotechnology Santa Cruz, CA, www.scbt.com) was used as an internal loading control. Following washing in TBST, a horseradish peroxidase-conjugated secondary antibody (1:5000; Cwbio, Beijing, China, www.cwbiotech.com) was incubated for 1 hour at room temperature to detect bound antibodies. Blots were developed using ECL reagent (Cwbio, Beijing, China) and detected with X-ray film (Kodak, Rochester, NY, www.kodak.com). Protein bands were visualized using LiDE 100 scanner (Canon, Japan, www.canon.com), and quantified by densitometry analysis using Image J software (National Institutes of Health). Western blot experiments were repeated at least three times to confirm the results.

NF-jB Luciferase Assay rBMSCs were cultured in 6-well plates (plating density 3 3 104 cells per square centimeter) for 12 hours. TurboFect transfection reagent (Fermentas, Shanghai, China) was used for cotransfection of cells with 1 lg/ml of the reporter plasmid pNF-jB-luc and the internal control plasmid pRL-TK (Promega, Beijing, China, www.promega.com.cn) at a ratio of 10:1 in serum- and antibiotic-free DMEM (Catalog No. 30022; Hyclone). After 6 hours, the cells were rinsed with PBS and incubated for an additional 6 hours in DMEM containing 10% FBS. Cells were lysed in RIPA buffer, and firefly and Renilla luciferase activities were assessed using a dual-luciferase reporter assay (Beyotime, China) and GloMax 20/20 Luminometer (Promega, Wuhan, China), according to the manufacturers’ instructions. NF-jB inhibitor BAY 11–7082 was bought from Beyotime (China). rBMSCs were treated with BAY 11– 7082 at a concentration of 2 lM. NF-jB transcriptional activity (relative light units of firefly luciferase/relative light units of renilla luciferase, fRLU/rRLU) was expressed as fold induction relative to the control cells.

Preparation of the CCHS and Microstructure Observation Chitosan (average molecular weight of 1.0 3 105 to 1.7 3 105, 75–85% deacetylation degree) was purchased from Sigma. The 25% glutaraldehyde (GA) aqueous solution, Ca(NO3)2, and (NH4)2HPO4 were purchased from Shanghai Pharm. Co. (China, www.pharm-sh.com.cn). Type I collagen was isolated from rat tail tendons according to a previously published method [20]. Briefly, crude collagen fibers were dissolved in 0.02 M acetic acid. The collagen solution was centrifuged to remove insoluble impurities. The supernatant was dialyzed against double distilled water for 1 week, with a solution change every 2 days. Finally, it was frozen at 220 C and lyophilized to obtain a sponge. CCHS was synthesized according to the methods published by Wang and Ma [21, 22], with minor modifications. Briefly, collagen and chitosan were dissolved in 0.5 M acetic acid solution to prepare a blend. This was followed by the drop-wise addition of 1 M Ca(NO3)2 and 0.6 M (NH4)2HPO4 solutions into the blend to produce HA, such that the ratio of collagen: chitosan: HA equaled 4:4:2. The blend was maintained for 20 hours at 30 C to generate an elasC AlphaMed Press 2014 V

Effect of SIRT6 on rBMSCs Osteogenesis

tic composite gel, which was subsequently de-aerated to remove entrapped air bubbles. The gel was injected into a 24well plate (NEST, Wuxi, China), frozen at 220 C for 2 hours, and then lyophilized for 24 hours to obtain a porous scaffold. The CCHS was further cross-linked with 2% GA to improve biostability, washed with PBS (3 minutes 3 15 times), and then lyophilized once again to obtain the GA-treated CCHS. Cells were seeded as follows. Modified rBMSCs were trypsinized and centrifuged, following which the supernatant was removed. The cells were resuspended in growth medium at a density of 2 3 106 cells/ml, and added drop-wise into dry, cylindrical CCHS in a 24-well plate (1 ml/well; NEST, Wuxi, China). The cells were cultured overnight prior to observation. Twelve cell-seeded CCHS scaffolds and six unseeded ones were fixed with 2.5% GA. They were subsequently dehydrated in graded ethanol solutions and sputter-coated with gold/palladium. The microstructure of the scaffolds and cells was observed using scanning electron microscope (SEM, VEGA 3 LMU, TESCAN, Brno, Czech, www.tescan.com) operated at an accelerating voltage of 30 kV using the secondary electron detector. Cells attached to the scaffold upon culturing for 24 hours in vitro were also observed under a fluorescence microscope (Zeiss, Jena, Germany, www.corporate.zeiss.com).

In Vivo Evaluation in Animals The bone-forming ability of different cells in scaffolds was assessed in a calvarial defect model in SD rats. Animal handling and surgical procedures were conducted according to the guidelines established by the Animal Care and Use Committee of Wuhan University, People’s Republic of China, and approved by the Ethics Committee at the School of Dentistry. The 2% GA-treated CCHS was immersed in 75% ethanol for 12 hours for sterilization, followed by a solvent exchange in PBS for a total of 6 times. It was then cut into 5 3 5 3 1 mm pieces and transferred into a 96-well polystyrene plate, and seeded with 200 ml of rBMSCs suspension at a density of 5 3 106 cells/ml. Twenty-four hours later, the complex was implanted into the bone defect. Twelve rats with two critical-sized calvarial defects were generated and randomly allocated into the following graft study groups: (1) Blank (n 5 6); (2) CCHS (n 5 6); (3) CCHS–rBMSCs–green fluorescent protein (GFP) (n 5 6); and (4) CCHS–rBMSCs–SIRT6 Overexpression (n 5 6).

Micro-CT Evaluation Animals were euthanized 8 weeks after surgery, and the defect areas were collected. All samples were scanned for bone formation with a mCT50 imaging system (Scanco Medical, Switzerland, www.scanco.ch) with the following scan parameters: 70 kVp X-ray energy setting, 1024 reconstruction matrix, 0.02 mm slice thickness, and a 250-milliseconds integration time. Bone volume per defect (BV; mm3) was recorded as a measure of bone regeneration.

Histological Evaluation Following the micro-CT scan, the samples were fixed with 4% paraformaldehyde for 24 hours at room temperature and then decalcified using 10% EDTA, with a solution change twice a week for 2 weeks, before being embedded in paraffin. Serial sections of 5 mm thickness were cut and mounted on polylysine-coated slides. Hematoxylin and eosin (H&E) and Masson staining were performed separately on consecutive STEM CELLS

Sun, Wu, Fu et al. tissue sections, and images were taken using a microscope. For histomorphometry, three midsagittal Masson’s-stained sections were selected from the Blank, CCHS, CCHS–rBMSCs–GFP, and CCHS–rBMSCs–SIRT6 Overexpression groups. For double immunofluorescence staining of osteocalcin (OCN) and GFP, sections were incubated with a rabbit polyclonal antibody against OCN (1:100; Santa Cruz) and a mouse monoclonal antibody against GFP (1:100; Santa Cruz) overnight at 4 C. Bound primary antibodies were detected using FITCconjugated goat anti-rabbit (1:150; ZSGB-Bio, Beijing, China) and TRITC-conjugated goat anti-mouse (1:150; ZSGB-Bio, Beijing, China) secondary antibodies, following 60 minutes incubation. The sections were then incubated with 1 mg/ml DAPI to visualize the nuclei, mounted using Antifade Mounting Medium (Beyotime, China), and photographed using a fluorescence microscope (DP71, OLYMPUS, China).

Statistical Analyses All experiments were performed at least six times and in triplicate. Data were analyzed with SPSS version 16.0 and GraphPad Prism Version 5.0. Shapiro–Wilk and Kolmogorov–Smirnov tests were used to analyze the data for normal distribution. If the data showed normal distribution, statistical significance of the differences among groups was examined using one-way analysis of variance (ANOVA) and homogeneity of variance tests. A post hoc Tukey’s test (equal variances) or Games-Howell (unequal variances) test was performed when the ANOVA test indicated a significant difference. The nonparametric Kruskal-Wallis test was used when the variables did not show a normal distribution with a post hoc Dunn’s test. The final results were expressed as mean6 standard deviations (SD) of six independent experiments. Values were considered significantly different if p < .05.

RESULTS Endogenous SIRT6 Expression Immunofluorescence staining demonstrated that SIRT6 was localized in nuclei (Fig. 1Aa1–1Aa3). Primary rBMSCs were treated with osteogenic medium to investigate whether SIRT6 plays a relevant role in osteogenic differentiation. Compared with control, rBMSCs grown in osteogenic medium showed a significant upregulation of SIRT6 mRNA levels at days 4 and 7 (Fig. 1F).

SIRT6 Overexpression or Knockdown in rBMSCs We used a lentiviral vector system to efficiently overexpress SIRT6 in primary rBMSCs (rBMSCs–SIRT6-Overexpression) in >95% of the cells, which was quantified by evaluating the ratio of GFP-positive cells to the total cell number (Fig. 1Ee1–1Ee3). In addition, SIRT6 expression was quantitated by real-time PCR and Western blot analyses 48 hours post-infection. SIRT6 mRNA and protein were overexpressed over 19- and 2.5-fold, respectively (Fig. 1G–1I). rBMSCs were infected with lentivirus harboring shRNA targeting SIRT6 (rBMSCs–SIRT6–Knockdown), and the ratio of GFPpositive cells to the total cell number was once again >95% (Fig. 1Dd1–1Dd3). The efficiency of the shRNA-mediated knockdown was confirmed by real time RT-PCR and Western blot analyses. SIRT6 mRNA levels were knocked-down by over 70% 48 hours post-infection, with a concomitant decrease in SIRT6 protein levels (Fig. 1G–1I). Cells infected with GFP-expressing vector pLVX-rat-shSIRT6-Control, empty vector, and wild-type

www.StemCells.com

1947

rBMSCs were designated as rBMSCs–GFP (Fig. 1Bb1–1Bb3), rBMSCs–Knockdown–Control (Fig. 1Cc1–1Cc3), and rBMSCs–WT, respectively. Significant differences were not found among these groups in the follow-up experiments; therefore, only the rBMSCs–Knockdown–Control was selected as the negative control for subsequent experiments.

Effect of SIRT6 on the Proliferation of rBMSCs Growth curves revealed that the expression of SIRT6 shRNA resulted in a significant increase in cell proliferation at 72 and 96 hours following culture in normal growth medium, while SIRT6overexpression inhibited proliferation significantly at the same time points when compared with the control group (Fig. 1J).

SIRT6 is Essential for Normal Osteogenesis of rBMSCs In Vitro SIRT6 knockdown led to a decrease in ALP activity and staining at day 7, compared with the control groups (p < .05; Figs. 1K, 2A–2D, 2M). Absorbance at 590 nm and mineralization nodule area of the SIRT6-knockdown group were 61.8% and 63.5% that of the control group, respectively, at day 21, as assessed by Alizarin red (p < .05; Fig. 2E–2H, 2N) and von Kossa (p < .05; Fig. 2I–2L, 2O) staining.

SIRT6 Overexpression Enhances Osteogenesis of rBMSCs In Vitro When SIRT6 was overexpressed, we observed an enhancement in ALP activity and staining compared with the control group, after 7 days of culture in osteogenic medium (p < .05; Figs. 1K, 2A–2D, 2M). SIRT6 expression also increased calcium deposition, as assessed by Alizarin red (Fig. 2E–2H) and von Kossa (Fig. 2I– 2L) staining at day 21. Absorbance at 590 nm and bone nodule area of the SIRT6-overexpression group were 1.6 and 1.7 times higher, respectively, than those of the control group at day 21, as assessed by Alizarin red (p < .05; Fig. 2N) and von Kossa (p < .05; Fig. 2O) staining.

Effect of SIRT6 Expression Levels on ALP, RUNX2, and OCN Gene Expression qRT-PCR analysis revealed that SIRT6-overexpression increased ALP and RUNX2 mRNA levels at days 7 and 14 (p < .05; Fig. 2P, 2Q) as well as OCN mRNA levels at days 7 and 14 (p < .05; Fig. 2R). On the other hand, SIRT6 knockdown decreased ALP, RUNX2, and OCN mRNA levels at days 7 and 14 (p < .05; Fig. 2P–2R).

SIRT6 Knockdown Activated NF-jB Pathway We assessed the impact of SIRT6 on NF-jB transcriptional activity using a dual-luciferase reporter assay system. As shown in Figure 3A, silencing of SIRT6 increased the luciferase activity of the NF-jB reporter by 2.2-fold in the SIRT6–Knockdown group. Additionally, the acetylation of lysine 310 of the p65 subunit of NF-jB was also increased (Fig. 3B), confirming that NF-jB is a target of SIRT6 in rBMSCs.

Decreased Osteogenic Differentiation Ability of rBMSCs Could Be Partially Rescued by the Addition of NF-jB Inhibitor To further elucidate the functional connection between SIRT6 and NF-jB signaling in the osteogenic differentiation of C AlphaMed Press 2014 V

1948

Effect of SIRT6 on rBMSCs Osteogenesis

Figure 1. Immunofluorescence staining for Sirtuin 6 (SIRT6) of rat bone marrow mesenchymal stem cells (rBMSCs), lentiviral infection of rBMSCs, SIRT6 expression, MTT, and alkaline phosphatase (ALP) activity. (Aa1–Aa3): DAPI staining, TRITC-conjugated secondary antibody staining, and merge. (Bb1–Ee1): DAPI staining of rBMSCs-green fluorescent protein (GFP), rBMSCs–Knockdown–Control, rBMSCs–SIRT6– Knockdown, and rBMSCs-SIRT6-Overexpression groups. (Bb2–Ee2): GFP-positive cells in rBMSCs-GFP, rBMSCs–Knockdown–Control, rBMSCs– SIRT6–Knockdown, and rBMSCs–SIRT6–Overexpression groups. (Bb3–Ee3): Merge of DAPI staining and GFP-positive cells in rBMSCs-GFP, rBMSCs–Knockdown–Control, rBMSCs–SIRT6–Knockdown, and rBMSCs–SIRT6–Overexpression groups. (F): Endogenous SIRT6 expression during osteogenic process. Upregulation of SIRT6 mRNA was significant at days 4 and 7. (G): SIRT6 expression determined by qRT-PCR in rBMSCs-GFP, rBMSCs–Knockdown–Control, rBMSCs–SIRT6–Knockdown, and rBMSCs–SIRT6–Overexpression groups. (H): SIRT6 protein expression by Western blot in rBMSCs-GFP, rBMSCs–Knockdown–Control, rBMSCs–SIRT6–Knockdown, and rBMSCs–SIRT6–Overexpression groups. (I): Quantification of Western blot by densitometry analysis using Image J software, (J): Effect of SIRT6 on the proliferation ability of rBMSCs in vitro, (K): ALP activity was measured at day 7 in rBMSCs. Scale bar 5 50 lm. * and [diaf] indicate a significant difference from the control group (*, p < .05, [diaf], p < .01). Abbreviations: ALP, alkaline phosphatase; DAPI, 4’,6-diamidino-2-phenylindole; EF-1a, eukaryotic translational elongation factor 1a; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFP, green fluorescent protein; OD, optical density; rBMSCs, rat bone marrow mesenchymal stem cells; SIRT6, Sirtuin 6; TRITC, tetramethylrhodamine isothiocyanate.

rBMSCs, we examined the effect of NF-jB inhibition on osteogenesis in SIRT6-knockdown rBMSCs. Upon treatment of SIRT6–Knockdown rBMSCs with the NF-jB inhibitor BAY 11– 7082 for 12 hours, NF-jB transcriptional activity and the C AlphaMed Press 2014 V

expression of acetyl-NF-jB p65 (Lys310) showed a significant decrease when compared with the rBMSCs–SIRT6–Knockdown cells without the inhibitor (Fig. 3A, 3B). In addition, inhibition of NF-jB activity partially reversed the decrease in osteogenic STEM CELLS

Sun, Wu, Fu et al.

1949

Figure 2. Sirtuin 6 (SIRT6)-overexpression enhanced the rat bone marrow mesenchymal stem cells (rBMSCs) osteogenic differentiation, while SIRT6–knockdown was on the contrary. (A–D): Alkaline phosphatase (ALP) staining of the cultured rBMSCs in rBMSCs-green fluorescent protein (GFP), rBMSCs–Knockdown–Control, rBMSCs–SIRT6–Knockdown, and rBMSCs–SIRT6–Overexpression groups (left to right). (E–H): Alizarin red staining of the cultured rBMSCs in rBMSCs–GFP, rBMSCs–Knockdown–Control, rBMSCs–SIRT6–Knockdown, and rBMSCs–SIRT6–Overexpression groups (left to right). (I-L): von Kossa staining of mineralization nodules in rBMSCs–GFP, rBMSCs–Knockdown–Control, rBMSCs–SIRT6–Knockdown, and rBMSCs–SIRT6–Overexpression groups (left to right). (M): The percentage of ALP-positive cells area. (N): Alizarin red absorbance at 590 nm staining area, (O): Mineralized matrix areas. (P–R): ALP, RUNX2, and osteocalcin mRNA expression during osteogenic differentiation. The histogram shows the relative quantification of gene expression in rBMSCs–GFP, rBMSCs–Knockdown–Control, rBMSCs–SIRT6–Knockdown, and rBMSCs–SIRT6–Overexpression groups (left to right) and is presented as fold changes compared with control group at days 0, 4, 7, and 14. * and [diaf] indicate a significant difference from the control group (*p < .05, [diaf], p < .01). Scale bar 5 200 lm. Abbreviations: ALP, alkaline phosphatase; EF-1a, eukaryotic translational elongation factor 1a; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFP, green fluorescent protein; OCN, osteocalcin; rBMSCs, rat bone marrow mesenchymal stem cells; SIRT6, Sirtuin 6.

differentiation ability of rBMSCs, which was indicated by the expression of osteogenesis-related genes (Fig. 3C) at days 7 and 14, ALP activity and staining (Fig. 3D–3I) at day 7, and Alizarin red staining (Fig. 3J–3N) at day 21.

www.StemCells.com

Adhesion of rBMSCs on the Scaffold The morphology of the composite scaffold was examined by SEM. As shown in Supporting Information Figure S1A and S1B, CCHS exhibited a spongy appearance and high porosity

C AlphaMed Press 2014 V

1950

Effect of SIRT6 on rBMSCs Osteogenesis

Figure 3. The effect of nuclear factor-jB (NF-jB) signaling on rat bone marrow mesenchymal stem cells (rBMSCs). (A): NF-jB transcriptional activity in rBMSCs–green fluorescent protein (GFP), rBMSCs–Knockdown–Control, rBMSCs–Sirtuin 6 (SIRT6)–Knockdown, and rBMSCs–SIRT6–Knockdown 1 BAY 11–7082 groups. (B): Acetyl-NF-jB p65 (Lys310) and p65 protein expression by Western blot in rBMSCs–GFP, rBMSCs–Knockdown–Control, rBMSCs–SIRT6–Knockdown, and rBMSCs–SIRT6–Knockdown 1 BAY 11–7082 groups. (C): Alkaline phosphatase (ALP), RUNX2, and osteocalcin mRNA expression by qRT-PCR in rBMSCs–GFP, rBMSCs–Knockdown–Control, rBMSCs– SIRT6–Knockdown, and rBMSCs–SIRT6–Knockdown 1 BAY 11–7082 groups. (D): ALP activity in rBMSCs–GFP, rBMSCs–Knockdown–Control, rBMSCs–SIRT6–Knockdown, and rBMSCs–SIRT6–Knockdown 1 BAY 11–7082 groups. (E–I): ALP staining positive cells in rBMSCs–GFP, rBMSCs–Knockdown–Control, rBMSCs–SIRT6–Knockdown, and rBMSCs–SIRT6–Knockdown 1 BAY 11–7082 groups. (J–N): Alizarin red staining in rBMSCs–GFP, rBMSCs–Knockdown–Control, rBMSCs–SIRT6–Knockdown, and rBMSCs–SIRT6–Knockdown 1 BAY 11–7082 groups. *indicates a significant difference between rBMSCs–SIRT6–Knockdown and rBMSCs–SIRT6–Knockdown 1 BAY 11–7082 groups. [trif] indicates a significant difference between control and rBMSCs–SIRT6–Knockdown 1 BAY 11–7082 groups. Scale bar 5 200 lm. Abbreviations: ALP, alkaline phosphatase; EF-1a, eukaryotic translational elongation factor 1a; fRLU, relative light units of firefly luciferase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFP, green fluorescent protein; NF-kB, nuclear factor-jB; OD, optical density; rBMSCs, rat bone marrow mesenchymal stem cells; rRLU, relative light units of renilla luciferase; SIRT6, Sirtuin 6.

C AlphaMed Press 2014 V

STEM CELLS

Sun, Wu, Fu et al. throughout the cross-section. The pores were interconnected with a pore size of approximately 80 lm. SEM revealed that rBMSCs seeded on the scaffolds after 24 hours grew into the scaffolds and displayed polygon morphology (Supporting Information Fig. S1C, S1D). Fluorescence microscopy revealed that rBMSCs–GFP and rBMSCs–SIRT6– Overexpression cells could be clearly seen to be uniformly distributed in the CHHS and were of a spindle shape (Supporting Information Fig. S1E, S1F).

Micro-CT Measurement The morphology of new bone formation was reconstructed using micro-CT 8 weeks after implantation into the skull. Representative photographs of each group are shown in Figure 4. From coronal to sagittal, micro-CT showed that the CCHS– rBMSCs–SIRT6 Overexpression group displayed more bone growth in the skull defect compared with the CCHS–rBMSCs– GFP group at 8 weeks post-operation (Fig. 4C, 4D, 4G, 4H). There was almost no bone formation in the blank group (Fig. 4A, 4E) and some bone formation in the CCHS group (Fig. 4B, 4F). Quantification of the mineralized areas in skull bone defects showed a significant increase in calcified tissues in the defects filled with CCHS–rBMSCs–SIRT6 Overexpression constructs compared with the defects filled with CCHS or CCHS– rBMSCs–GFP constructs (p < .05, Fig. 4Y).

Histological Analysis of Bone Regeneration Representative histological photographs of each group are shown in Figure 4. Sections were stained with H&E (Fig. 4I– 4L, 4Q–4T) and Masson (Fig. 4M–4P, 4U–4X), respectively. Under the light microscope, the bone formation area in the rBMSCs–SIRT6 Overexpression group was 1.8 times greater than that in the CCHS–rBMSC–GFP group after 8 weeks (p < .05, Fig. 4Z). The CCHS group had increased formation of new bone compared with the blank group. There was almost no new bone formation and only a thin mucous membrane layer observed in the blank group.

Presence of Transplanted Cells in the Newly Formed Bone The direct participation of donor cells in new bone formation was examined by double immunofluorescence staining for OCN and GFP (Fig. 5). GFP-positive cells were not found in the blank (Fig. 5Aa1–5Aa4) and CCHS (Fig. 5Bb1–5Bb4) groups. GFPpositive donor cells were clearly detected in new bone formation in the CCHS–rBMSCs–GFP (Fig. 5Cc1–5Cc4) and CCHS– rBMSCs–SIRT6 Overexpression (Fig. 5Dd1–5Dd4) groups. The merged image showed that GFP-positive donor cells colocalized with osteocytes expressing OCN (Fig. 5Cc4, 5Dd4).

DISCUSSION Bone tissue engineering, which involves the culture of seed cells within an appropriate scaffold material under conditions that optimize bone formation, is a promising approach to overcoming the disadvantages of using autologous, allogeneic, or synthetic bone grafts to treat large bone defects [23]. Adult stem cells harboring modifications in potent osteogenic genes have improved fracture repair and boosted bone forma-

www.StemCells.com

1951

tion in vivo [24]. However, we are still a long way from understanding the complex regulatory mechanism of osteogenesis. Sirtuins are members of the Sir2 (silent information regulator 2) family, and include a group of class III deacetylases consisting of seven sirtuins (SIRT1–7) that share homology with yeast Sir2. Among them, SIRT1, SIRT3, and SIRT6 are induced under conditions of caloric restriction and are considered anti-aging molecules [25]. All sirtuins consist of an enzymatic core for intrinsic catalytic activity and in some instances a C-terminal extension (CTE) [26, 27]. However, SIRT6 comprises a unique small splayed domain, a more general large domain, the Rossmann fold, and a stable single helix replacing the conserved NAD1 binding loop of sirtuins [28]. These unique structures are crucial to the screening of potential activators of SIRT6 [26]. Conditional knockout of SIRT1 resulted in decreased bone mass due to increased resorption and reduced bone formation in mice [14]. Similarly, mice homozygous for SIRT6 deletion are osteoporotic with a 30% loss in bone mineral density, and possibly exhibit defects in glucose homeostasis and fat metabolism [29–31], suggesting a protective role for SIRT6 against metabolic diseases. SIRT6 overexpression has a protective role against the metabolic pathologies caused by diet-induced obesity in mice [29]. Studies have demonstrated that there is a close inverse correlation between obesity and bone mass [32, 33]. SIRT6 is also involved in the direct regulation of proliferation and differentiation of chondrocytes through Indian hedgehog (Ihh) signaling [34]. These results suggest that SIRT6 plays important roles in regulating mammalian longevity and its activation may have a potentially beneficial effect on age-related osteoporosis [29]. In this study, we demonstrated that SIRT6 plays an important role in osteogenesis in vitro and that its overexpression promoted bone formation in vivo. Immunofluorescence staining performed in this study revealed that SIRT6 was localized within the nucleus, which is consistent with the observations of Michishita et al. [35] that SIRT6 is mainly expressed within the nucleus of normal human fibroblasts. CTE is responsible for proper nuclear localization of SIRT6 and its mutation results in cytoplasmic transfer of SIRT6 [36]. To study the role of SIRT6 in rBMSCs during osteogenesis, endogenous SIRT6 expression was detected and found to be significantly upregulated at days 4 and 7 after osteogenic induction. SIRT6 overexpression and knockdown rBMSCs were then constructed, and subjected to osteogenic induction. SIRT6-knockdown cells exhibited increased proliferation, which is consistent with the previous observation that MEFs with SIRT6 deletion exhibit increased proliferation and even form tumors when implanted into SCID mice [37]. This can be attributed to the inhibitory effect of SIRT6 on the expression of ribosomal genes through corepression of c-Myc and suppression of cancer metabolism [37]. ALP and RUNX2 are regarded as early and key osteogenesis-related genes [38, 39]. SIRT1 is also mainly localized within the nucleus [35] and can be activated by the phytoestrogen resveratrol to enhance osteogenic differentiation of MSCs through deacetylation of RUNX2 [40]. SIRT1 can also promote osteogenic differentiation of mouse MSCs by deacetylating b-catenin to increase its nuclear accumulation [41]. Additionally, resveratrol promotes osteogenesis of human MSCs by increasing RUNX2 promoter activity mediated by the SIRT1/Forkhead box O3 (FOXO3A) biological axis, which is C AlphaMed Press 2014 V

1952

Effect of SIRT6 on rBMSCs Osteogenesis

Figure 4. Micro-CT and histological assessment of in vivo bone formation. (A–D), coronal; (E–H), sagittal; (A, E), Blank; (B, F), collagen/chitosan/hydroxyapatite scaffold (CCHS) constructs. (C, G): CCHS with rat bone marrow mesenchymal stem cells (rBMSCs)–green fluorescent protein (GFP) constructs; (D, H), CCHS with rBMSCs–Sirtuin 6 (SIRT6)–Overexpression constructs. HE staining (I–L, Q–T) and Masson staining (M–P, U–X). From left to right: Blank, CHHS constructs, CCHS–rBMSCs–GFP constructs, and CCHS–rBMSCs– SIRT6–Overexpression constructs (Scale bar 5 200 lm [I–X]). (Y): Quantification of new bone formation volume by Micro-CT. (Z): Quantification of new bone formation area by Masson staining. [diaf] indicates a significant difference between two groups (p < .01). Abbreviations: CCHS, collagen/chitosan/hydroxyapatite scaffold; GFP, green fluorescent protein; rBMSCs, rat bone marrow mesenchymal stem cells; SIRT6, Sirtuin 6.

C AlphaMed Press 2014 V

STEM CELLS

Sun, Wu, Fu et al.

1953

Figure 5. Double immunofluorescence staining for osteocalcin (OCN) plus green fluorescent protein (GFP) analysis in tissue sections in Blank (Aa1–Aa4), CHHS constructs (Bb1–Bb4), collagen/chitosan/hydroxyapatite scaffold (CCHS)–rat bone marrow mesenchymal stem cells (rBMSCs)–GFP constructs (Cc1–Cc4), and CCHS–rBMSCs–Sirtuin 6 (SIRT6)–Overexpression constructs (Dd1–Dd4). (Aa1–Dd1): DAPI staining for nuclei. (Aa2–Dd2): immunofluorescence staining for OCN in the same section by FITC–conjugated goat anti-rabbit secondary antibody. (Aa3–Dd3): Immunofluorescence staining for GFP in the same section by TRITC-conjugated goat anti-mouse secondary antibody. (Aa4–Dd4): Overlay images of Aa1–Aa3, Bb1–Bb3, Cc1–Cc3, and Dd1–Dd3. Arrows show location of OCN- and GFP-positive cells, which represent the donor cells. Scale bar 5 50 lm.

associated with longevity [42, 43]. Interestingly, by forming a complex with nuclear respiratory factor 1 and FOXO3A on the SIRT6 promoter, SIRT1 can upregulate SIRT6 expression [44]. The similarities between SIRT1 and SIRT6 in localization and function [43] indicate that SIRT6 may have the same roles in regulating RUNX2 or b-catenin. In this study, not only ALP and RUNX2 but also OCN, the most specific osteogenic differentiation marker that was subsequently characterized [45], was significantly upregulated in the rBMSCs–SIRT6– Overexpression group and downregulated in the rBMSCs–SIRT6–Knockdown group. The next question that we addressed was how SIRT6 promotes osteogenesis. Studies have indicated that SIRT6 suppresses certain NF-jB target genes by modifying the

www.StemCells.com

chromatin structures of their promoter regions [46]. However, wild-type SIRT6 overexpression does not change the transcriptional activity of NF-jB in human embryonic kidney 293 cells [47]. This discrepancy could be due to the use of different cell types in these studies. In this study, SIRT6 knockdown in the rBMSCs activated NF-jB transcriptional activity and increased acetyl-NF-jB p65. Additionally, the impaired osteogenic differentiation of these rBMSCs could be partially rescued by the addition of NF-jB inhibitor. These results highlight the fact that SIRT6 modulates the function of rBMSCs in vitro. NF-jB signaling was first discovered by Sen and Baltimore, and plays important roles in regulating both innate and adaptive immunity [48, 49]. Older rodents have elevated nuclear expression of NF-jB components p52 and p65 compared with the young C AlphaMed Press 2014 V

Effect of SIRT6 on rBMSCs Osteogenesis

1954

ones [50]. In addition, the transcriptional activity of NF-jB correlates positively with aging in the major lymphoid tissues and bone marrow [51]. Proinflammatory cytokines such as IL1b and tumor necrosis factor alpha (TNFa) can also result in excessive activation of NF-jB signaling which leads to excessive inflammation, which in turn works against the healing process in the host [52]. Dysregulation of NF-jB target gene expression results in severe erosive colitis, and may be responsible for the death of mice harboring SIRT6 deletion [53], underscoring the importance of strictly regulating NF-jB signaling. It has been demonstrated that acetylation of lysine 310 is essential for p65 transcriptional activity, and functions by increasing DNA binding of NF-jB and decreasing its interaction with IjBa [52, 54]. SIRT6 overexpression can suppress the production of IL-1b and TNFa involved in the pathogenesis of collagen-induced arthritis as well as excessive osteoclast activity, a hallmark feature of age-related osteoporosis [55]. To sum up, it is reasonable to speculate that SIRT6 attenuates hyperactive NF-jB signaling, brought about by aging and autoimmune diseases, through inhibition of p65 acetylation. SIRT6 could therefore be investigated as a potential therapeutic target for age-related osteoporosis. As NF-jB inhibitor only partially rescues the reduced osteogenic ability of rBMSCs, additional experiments are needed to elucidate other signal pathways involved in this process, such as RUNX2, Wnt, and Ihh. The in vivo bone repair abilities of modified rBMSCs harboring SIRT6 overexpression or GFP constructs were examined by combining them with the use of CCHS to repair a criticalsized defect in rat skull. The micro- or nanosized HA present in this scaffold has been shown to promote differentiation of rBMSCs into osteoblasts [56]. Chitosan has been used as a carrier for drug delivery, wound healing material, and in cartilage and bone tissue engineering [57–59]. Type I collagen and HA are the main components of bone and the most commonly used biomaterials in bone tissue engineering due to their biocompatibility [60]. CCHS has been regarded as a promising scaffold for bone regeneration [21]. In this study, CCHS was used as a carrier for modified rBMSCs, and GFP was used for tracing the growth of the transplanted cells. The transplanted cells could either directly differentiate into osteocytes to produce bone matrix, or indirectly increase bone formation through the production of factors that promote osteogenic differentiation

REFERENCES 1 Chien KR, Karsenty G. Longevity and lineages: Toward the integrative biology of degenerative diseases in heart, muscle, and bone. Cell 2005;120:533–544. 2 Jilka RL. Osteoblast progenitor fate and age-related bone loss. J Musculoskelet Neuronal Interact 2002;2:581–583. 3 Kanfi Y, Naiman S, Amir G et al. The sirtuin SIRT6 regulates lifespan in male mice. Nature 2012;483:218–221. 4 Mostoslavsky R, Chua KF, Lombard DB et al. Genomic instability and aging-like phenotype in the absence of mammalian SIRT6. Cell 2006;124:315–329. 5 Michishita E, McCord RA, Berber E et al. SIRT6 is a histone H3 lysine 9 deacetylase C AlphaMed Press 2014 V

of host cells [61, 62]. The detection of GFP in the osteocytes showed that modified rBMSCs directly enhance bone defect repair by generating bone matrix. However, GFP expression was not detectable in some OCN-positive cells, suggesting that the new bone was formed through the collective action of both exogenous and endogenous cells. Further studies are required for confirming whether SIRT6-overexpressing cells promote bone defect repair through a paracrine effect on the progenitor cells of the host; moreover, the mechanism of such a repair process needs to be elucidated.

CONCLUSIONS We have demonstrated that SIRT6 is expressed in rBMSCs, which is a novel finding. We show by in vitro experiments that SIRT6 modulates the function of rBMSCs partially by suppressing NF-jB signaling. Moreover, SIRT6-overexpressing rBMSCs combined with the use of CCHS promote calvarial defect repair in rats. SIRT6 could therefore be investigated as a potential therapeutic target for age-related osteoporosis. Additional experiments are required to address the effect of SIRT6 on other developmental pathways in BMSCs.

ACKNOWLEDGMENTS This work was supported by the National Natural Science Foundation of China (grants 81070852 and 81171010) and the Fundamental Research Fund for the Central Universities. (2012304020204).

AUTHORS CONTRIBUTIONS H.S.: conception and design, data analysis and interpretation, manuscript writing; Y.W.: conception and design, collection and assembly of data, manuscript writing; D.F. and Y.L.: provision of study material; C.H.: conception and design, financial support, provision of study material, final approval of manuscript. H.S. and Y.W. contributed equally to this article.

DISCLOSURE

OF

POTENTIAL CONFLICTS

OF INTEREST

The authors indicate no potential conflicts of interest.

that modulates telomeric chromatin. Nature 2008;452:492–496. 6 Xiao C, Wang RH, Lahusen TJ et al. Progression of chronic liver inflammation and fibrosis driven by activation of c-JUN signaling in Sirt6 mutant mice. J Biol Chem 2012; 287:41903–41913. 7 Larsen SA, Kassem M, Rattan SI. Glucose metabolite glyoxal induces senescence in telomerase-immortalized human mesenchymal stem cells. Chem Cent J 2012;6:18. 8 Mao Z, Hine C, Tian X et al. SIRT6 promotes DNA repair under stress by activating PARP1. Science 2011;332:1443–1446. 9 Kaidi A, Weinert BT, Choudhary C et al. Human SIRT6 promotes DNA end resection through CtIP deacetylation. Science 2010; 329:1348–1353.

10 Mahlknecht U, Ho AD, Voelter-Mahlknecht S. Chromosomal organization and fluorescence in situ hybridization of the human Sirtuin 6 gene. Int J Oncol 2006;28:447–456. 11 Novack DV. Role of NF-jB in the skeleton. Cell Res 2011;21:169–182. 12 Chang J, Wang Z, Tang E et al. Inhibition of osteoblastic bone formation by nuclear factor-jB. Nat Med 2009;15:682–689. 13 Vaira S, Alhawagri M, Anwisye I et al. RelA/p65 promotes osteoclast differentiation by blocking a RANKL-induced apoptotic JNK pathway in mice. J Clin Invest 2008;118: 2088–2097. 14 Edwards JR, Perrien DS, Fleming N et al. Silent information regulator (Sir)T1 inhibits NF-jB signaling to maintain normal skeletal remodeling. J Bone Miner Res 2013;28:960– 969.

STEM CELLS

Sun, Wu, Fu et al.

1955

15 Kawahara TL, Michishita E, Adler AS et al. SIRT6 links histone H3 lysine 9 deacetylation to NF-jB-dependent gene expression and organismal life span. Cell 2009;136:62– 74. 16 Yu SS, Cai Y, Ye JT et al. Sirtuin 6 protects cardiomyocytes from hypertrophy in vitro via inhibition of NF-jB-dependent transcriptional activity. Br J Pharmacol 2013;168: 117–128. 17 Baohua Y, Li L. Effects of SIRT6 silencing on collagen metabolism in human dermal fibroblasts. Cell Biol Int 2012;36:105–108. 18 Cai B, Li J, Wang J et al. microRNA-124 regulates cardiomyocyte differentiation of bone marrow-derived mesenchymal stem cells via targeting STAT3 signaling. Stem Cells 2012;30:1746–1755. 19 Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001;25:402–408. 20 Rajan N, Habermehl J, Cote MF et al. Preparation of ready-to-use, storable and reconstituted type I collagen from rat tail tendon for tissue engineering applications. Nat Protoc 2006;1:2753–2758. 21 Wang X, Tan Y, Zhang B et al. Synthesis and evaluation of collagen-chitosanhydroxyapatite nanocomposites for bone grafting. J Biomed Mater Res A 2009;89:1079–1087. 22 Ma L, Gao C, Mao Z et al. Collagen/chitosan porous scaffolds with improved biostability for skin tissue engineering. Biomaterials 2003;24:4833–4841. 23 Chimutengwende-Gordon M, Khan WS. Advances in the use of stem cells and tissue engineering applications in bone repair. Curr Stem Cell Res Ther 2012;7:122–126. 24 Kimelman N, Pelled G, Helm GA et al. Review: Gene- and stem cell-based therapeutics for bone regeneration and repair. Tissue Eng 2007;13:1135–1150. 25 Kitada M, Kume S, Takeda-Watanabe A et al. Sirtuins and renal diseases: Relationship with aging and diabetic nephropathy. Clin Sci (Lond) 2013;124:153–164. 26 Gertler AA, Cohen HY. SIRT6, a protein with many faces. Biogerontology 2013;14:629–639. 27 Tennen RI, Bua DJ, Wright WE et al. SIRT6 is required for maintenance of telomere position effect in human cells. Nat Commun 2011;2:433. 28 Pan PW, Feldman JL, Devries MK et al. Structure and biochemical functions of SIRT6. J Biol Chem 2011;286:14575–14587. 29 Kanfi Y, Peshti V, Gil R et al. SIRT6 protects against pathological damage caused by dietinduced obesity. Aging Cell 2010;9:162–173. 30 Xiao C, Kim HS, Lahusen T et al. SIRT6 deficiency results in severe hypoglycemia by enhancing both basal and insulin-stimulated glucose uptake in mice. J Biol Chem 2010; 285:36776–36784. 31 Zhong L, D’Urso A, Toiber D et al. The histone deacetylase Sirt6 regulates glucose homeostasis via Hif1alpha. Cell 2010;140:280–293.

32 Chang CS, Chang YF, Wang MW et al. Inverse relationship between central obesity and osteoporosis in osteoporotic drug naive elderly females: The Tianliao Old People (TOP) Study. J Clin Densitom 2013;16:204– 211. 33 Zhao LJ, Liu YJ, Liu PY et al. Relationship of obesity with osteoporosis. J Clin Endocrinol Metab 2007;92:1640–1646. 34 Piao J, Tsuji K, Ochi H et al. Sirt6 regulates postnatal growth plate differentiation and proliferation via Ihh signaling. Sci Rep 2013;3:3022. 35 Michishita E, Park JY, Burneskis JM et al. Evolutionarily conserved and nonconserved cellular localizations and functions of human SIRT proteins. Mol Biol Cell 2005;16:4623–4635. 36 Tennen RI, Berber E, Chua KF. Functional dissection of SIRT6: Identification of domains that regulate histone deacetylase activity and chromatin localization. Mech Ageing Dev 2010;131:185–192. 37 Sebastian C, Zwaans BM, Silberman DM et al. The histone deacetylase SIRT6 is a tumor suppressor that controls cancer metabolism. Cell 2012;151:1185–1199. 38 Schneider RK, Puellen A, Kramann R et al. The osteogenic differentiation of adult bone marrow and perinatal umbilical mesenchymal stem cells and matrix remodelling in three-dimensional collagen scaffolds. Biomaterials 2010;31:467–480. 39 Huang DM, Hsiao JK, Chen YC et al. The promotion of human mesenchymal stem cell proliferation by superparamagnetic iron oxide nanoparticles. Biomaterials 2009;30:3645–3651. 40 Shakibaei M, Shayan P, Busch F et al. Resveratrol mediated modulation of Sirt-1/ Runx2 promotes osteogenic differentiation of mesenchymal stem cells: Potential role of Runx2 deacetylation. PLoS One 2012;7: e35712. 41 Simic P, Zainabadi K, Bell E et al. SIRT1 regulates differentiation of mesenchymal stem cells by deacetylating beta-catenin. EMBO Mol Med 2013;5:430–440. 42 Tseng PC, Hou SM, Chen RJ et al. Resveratrol promotes osteogenesis of human mesenchymal stem cells by upregulating RUNX2 gene expression via the SIRT1/ FOXO3A axis. J Bone Miner Res 2011;26: 2552–2563. 43 Bosch-Presegue L, Vaquero A. The dual role of sirtuins in cancer. Genes Cancer 2011; 2:648–662. 44 Kim HS, Xiao C, Wang RH et al. Hepaticspecific disruption of SIRT6 in mice results in fatty liver formation due to enhanced glycolysis and triglyceride synthesis. Cell Metab 2010;12:224–236. 45 Bosch-Marce M, Okuyama H, Wesley JB et al. Effects of aging and hypoxia-inducible factor-1 activity on angiogenic cell mobilization and recovery of perfusion after limb ischemia. Circ Res 2007;101:1310–1318. 46 Salminen A, Kaarniranta K. NF-jB signaling in the aging process. J Clin Immunol 2009;29:397–405.

47 Grimley R, Polyakova O, Vamathevan J et al. Over expression of wild type or a catalytically dead mutant of Sirtuin 6 does not influence NFjB responses. PLoS One 2012;7: e39847. 48 Sen R, Baltimore D. Multiple nuclear factors interact with the immunoglobulin enhancer sequences. Cell 1986;46:705–716. 49 Caamano J, Hunter CA. NF-jB family of transcription factors: Central regulators of innate and adaptive immune functions. Clin Microbiol Rev 2002;15:414–429. 50 Helenius M, Kyrylenko S, Vehvilainen P et al. Characterization of aging-associated upregulation of constitutive nuclear factor-jB binding activity. Antioxid Redox Signal 2001; 3:147–156. 51 Spencer NF, Poynter ME, Im SY et al. Constitutive activation of NF-jB in an animal model of aging. Int Immunol 1997;9:1581– 1588. 52 Xu X, Woo CH, Steere RR et al. EVI1 acts as an inducible negative-feedback regulator of NF-jB by inhibiting p65 acetylation. J Immunol 2012;188:6371–6380. 53 Beauharnois JM, Bolivar BE, Welch JT. Sirtuin 6: A review of biological effects and potential therapeutic properties. Mol Biosyst 2013;9:1789–1806. 54 Chen LF, Mu Y, Greene WC. Acetylation of RelA at discrete sites regulates distinct nuclear functions of NF-jB. EMBO J 2002;21: 6539–6548. 55 Lee HS, Ka SO, Lee SM et al. Overexpression of sirtuin 6 suppresses inflammatory responses and bone destruction in mice with collagen-induced arthritis. Arthritis Rheum 2013;65:1776–1785. 56 Huang Y, Zhou G, Zheng L et al. Micro-/ nano- sized hydroxyapatite directs differentiation of rat bone marrow derived mesenchymal stem cells towards an osteoblast lineage. Nanoscale 2012;4:2484–2490. 57 Frohbergh ME, Katsman A, Botta GP et al. Electrospun hydroxyapatite-containing chitosan nanofibers crosslinked with genipin for bone tissue engineering. Biomaterials 2012;33:9167–9178. 58 Suh JK, Matthew HW. Application of chitosan-based polysaccharide biomaterials in cartilage tissue engineering: A review. Biomaterials 2000;21:2589–2598. 59 Bhardwaj N, Kundu SC. Chondrogenic differentiation of rat MSCs on porous scaffolds of silk fibroin/chitosan blends. Biomaterials 2012;33:2848–2857. 60 Burg KJ, Porter S, Kellam JF. Biomaterial developments for bone tissue engineering. Biomaterials 2000;21:2347–2359. 61 Wang L, Liu Y, Kalajzic Z et al. Heterogeneity of engrafted bone-lining cells after systemic and local transplantation. Blood 2005; 106:3650–3657. 62 Li F, Wang X, Niyibizi C. Bone marrow stromal cells contribute to bone formation following infusion into femoral cavities of a mouse model of osteogenesis imperfecta. Bone 2010;47:546–555.

See www.StemCells.com for supporting information available online. www.StemCells.com

C AlphaMed Press 2014 V