Appl. Radial. hr. Vol. 43, No. I, pp. 923-927, Inr. .I. Radial. Appl. Instrum. Part A Printed in Great Britain. All rights reserved

0883-2889/92 $5.00 + 0.00

1992 Copyright

0

1992 Pergamon

Press Ltd

Site-specific Incorporation of [ 125 IlIododeoxyuridine into DNA NEAL

SCHERBERG*,

ISAC

BLOCH

and

PAUL

GARDNER

The University of Chicago Hospitals and Clinics and the Howard Hughes Research Institute, 5841 S. Maryland Avenue, Chicago, IL 60637, U.S.A. (Received 22 May 1991; in revised form 27 August 1991) A procedure for the incorporation of [‘*‘I]IdU into specific sites in DNA is described. The approach depends upon attachment of radioiododeoxyuridine to a controlled pore glass support which is then used for automated synthesis of an oligomer. The resulting oligomer, 3’[‘251]iododeoxyuridine, is used as a primer during DNA synthesis catalyzed employing thermal cycling. The product formed includes the radioiodonucleotide de&&&d by the l>h of the-oligomer.

Sigma and Peninsula Labs. Carrier-free radioiodine was a product of Amersham Inc. Preparative 5 x 20 cm silica gel G plates for thin layer chromatography (TLC) were obtained from Analtech.

Introduction Iododeoxyuridyl

containing a terminal by the Taq polymerase at a single internal site

nucleotides are readily accepted by

DNA polymerases and the radioiodine-substituted nucleoside has been commonly used to determine DNA synthesis in intact cells (Gautschi et al., 1978). The incorporation of the ‘*‘I-labeled nucleoside has also been investigated from the standpoint of toxicity in cells (Kassis et al., 1987) since decay of the isotope can result in a double strand break in DNA (Krisch and Ley, 1974). In such syntheses, the DNA is

Methods

The synthesis of oligomers was carried out by automated DNA synthesis (Applied BioSystems Model 381). The trityl-protected, 1251-labeled initial nucleoside, trity1[‘251]IdU, was bound to succinylated long-chain alkylamidopropanoic acid controlledpore glass (sLCAAP CPG) provided by Masad Damha (Damha et al., 1990). The reaction contained 5 mg of succinylated beads with 1 PL of triethylamine, 5 mg of DEC and 6 PL of DMAP in 125 PL of anhydrous pyridine and 22 x lo4 Bq of trityl[‘251]IdU. The suspension was stirred for 24 h at 23°C. Excess carboxylic acid groups were blocked by the addition of 20 PL of 35 mg/mL pentachlorophenol in pyridine. Esterification proceeded for 2 h and the bead suspension was transferred with pyridine to the BioSystems column cell (-0.2 mL volume) and dried by suction filtration consecutively from pyridine, dichloromethane and ether. The beads were suspended in piperidine for 5 min and again dried. Approximately 25% of the original radiolabeled nucleoside was associated with the dried controlled pore glass (CPG) inserted in the DNA synthesizer. The sequence of the iodine-substituted oligomer prepared was S’TGCTTGCCAATGAAGAGGGCA”‘IU-3’. It corresponded to a sequence in the first exon of the human gene for thyroxine binding globulin (TBG). The completed oligomer was cleaved from the CPG by injection of 0.18 mL of 30% ammonium hydroxide directly into the reaction cell. After 2 h the solution was recovered and the unit

uniformly labeled due to the random incorporation of the nucleotides in thymidylate positions. The present investigation was undertaken to develop a method to place [‘251]IdU in selected sites in DNA. The approach exploits the widely employed methods of oligomer formation by automated phosphoramidate chemistry (McBride and Caruthers, 1983) and the oligomer-primed enzymatic synthesis of DNA by the polymerase chain reaction (Saiki et al., 1988).

Experimental Materials

Deoxyuridine, dimethoxytrityl chloride, solvents for chemical reactions and for thin layer chromatography were obtained from Aldrich. Marker compounds to determine the migration positions of iododeoxyuridine and S-O-dimethoxytrityl-2’deoxyiodouridine were obtained respectively from *Author for correspondence. Abbreviations: IdU, Iododeoxyuridine; ItdU, iodotrityldeoxyuridine; LCAAP-CPG, long chain alkylamidopropanoic acid controlled pore glass; DEC, I-(3-dimethylaminopropyl)-3-ethyl carbodiimide; DMAP, 4-dimethylaminopyridine; DMT-CL, dimethoxytrityl chloride; TBE, Tris-borate EDTA buffer. 923

924

NEALSCHERBERG

rinsed once with 0.6mL of ammonium hydroxide. The combined eluate was incubated at 55°C overnight to remove nucleotide protecting groups and then dried in a vacuum centrifuge (Savant). The size and homogeneity of the ‘2SI-oligomer was determined by electrophoresis in a 20% acrylamide gel containing 7 M urea in 0.089 M Tris, 0.089 M boric acid and 0.002 M EDTA, pH 8.1 (TBE). The DNA synthesis by polymerase chain reaction (PCR) was carried out in a standard reaction mixture containing 0. I mM nucleotide triphosphate (Taketa et al., 1989) using the radiolabeled primer and a second primer defining a 438 nucleotide sequence beginning at the 5’ origin of the first exon of TBG. The DNA clone used in this procedure, pGpTBG was inserted in pGEm4Z. The chain reaction consisted of 30 cycles of incubation at 94°C for 60 s, 55°C for 120 s and 72C for 90 s. The products were characterized by electrophoresis in 1% agarose gels buffered with 0.5 x the standard concentration of TBE. The gels were stained for DNA with ethidium bromide and dried in a BioRad vacuum gel drier at 60°C for autoradiography.

Results The preparation of [‘251]IdU was based upon the substitution of iodine into uracil in the presence of 1 M nitric acid (Prusoff, 1959). The product of the reaction was separated by thin layer silica plates and the distribution of labeled compounds determined by exposure of an overlying film. The position of radioiodinated deoxyuridine was identified by comigration with IdU detected by fluorescence. Reactions carried out in excess deoxyuridine (1 pg dU/37 x lo4 Bq I25I) reached maximal incorporation in 5 min at 78°C (Fig. 1). The radio-chemical yield as [‘251]IdU was > 50%. Alternative syntheses including iodination catalyzed by chloramine T to produce replacement into a mercuric intermediate (Baranowska-Kortylewicz er al., 1988) did not provide as efficient recovery of [‘251]IdU. The products of preparative reactions (10 pg dU with 7.4 x lo6 Bq I251in 15 pL) were separated by TLC to facilitate removal of the contaminating radiolabeled compounds. The position of the [‘251]IdU was identified by coincidence with IdU, and was localized in the preparative procedure by brief exposure of an overlying film. The zone of silica was scraped from the plate, transferred to 0.5 cm diameter column (Pasteur pipette) and the [‘251]IdU eluted with 79.5% chloroform, 20% methanol and 0.5% pyridine. For oligomer synthesis the initial nucleoside was bound to activated CPG by ester linkage to the 3’ sugar hydroxyl. To ensure the correct orientation of the iodinated nucleoside in the linkage reaction, the 5’ sugar hydroxyl group must be protected. The 5’ hydroxyl was blocked by reaction with dimethoxytrityl chloride in pyridine (Schaller et al., 1963). As

et al.

shown (Fig. 2), substitution into the 5’ position was essentially complete after 30min incubation at room temperature. An excess of the trityl reagent was employed in these preparations, estimated to be > 10” times the labeled nucleoside in molar ratio in the analytical reaction. When the trityl chloride concentration was decreased lo-fold the extent of tritylation of the nucleoside was greatly diminished. The product was shown to co-migrate with nonlabeled ItdU and was detritylated by brief exposure to acid. Since the tritylation reaction could be carried out in as little as 50 pL, the product was purified by a sequence including TLC, location by autoradiography and elution of the [“‘I]trityldeoxyuridine with chloroform containing 20% methanol. The recovery of I25I in the final protected nucleoside was > 25% of the starting radioiodine. The formation of the ‘2SI-labeled 22 residue oligonucleotide was carried out by automated chemistry dependent upon condensation of the 3’ functional group of nucleoside phosphoramidates to the 5’ deoxyribose hydroxyl site of the growing oligomer. After completion of the stepwise synthesis, the oligomer was cleaved from the support and deprotected under alkaline conditions (Experimental). The radiolabeled product was shown to consist of a single molecular species of the expected size by electrophoresis in a 20% acrylamide gel containing 7 M urea. Ammonium hydroxide was removed by evaporation and the labeled oligomer was used directly in the PCR reaction (Experimental). As shown (Fig. 3), the radioiodine-containing oligomer was incorporated into a DNA product which corresponded in migration to the ethidium bromide-stained DNA formed by the polymerase chain reaction (lane 1). If no enzyme was added to the reaction there was neither label nor stainable amounts of DNA formed (lane 2). In the presence of polymerase and excess unlabeled oligomer to dilute incorporation, there was stainable DNA but minimal presence of the radioiodine (lane 3).

Discussion The incorporation of iododeoxynucleotides into DNA by enzymatic synthesis results in random substitution throughout the product. We have shown that the position of an iododeoxyuridine can be limited to a single site by an approach which places the iodonucleoside at the 3’ terminus of an oligomer which subsequently serves as a primer in DNA synthesis. Since the amount of ‘251-labeled nucleosides produced was low (x 10m5pmol), preparative methods which include precipitation steps could not be used. Moreover, the acid-sensitive trityl-protecting group was observed to be unstable if exposed to atmospheric moisture at the carrier-free levels employed. However, it was found that the procedures could be modified to small volumes compatible with

_1251tdU

0

5

20

0

60 min

5

Fig. 1

15

30

min

Fig. 2

(A)

1

2

1

3

2

3

Fig. Fig. 1. Time dependence of the radioiodination of deoxyuridine. Aliquots (1 @L) of four radioiodination reactions, composed as described in the text, were spotted directly on the silica TLC at the indicated time of reaction. The plate was developed with ethyl acetate saturated with 0.05 M pH = 6 phosphate buffer. Labeled products other than [“51JIdU were not identified. Fig. 2. The rate of tritylation of [‘251]IdU. The tritylation reaction contained 11.9 mg of DMT-Cl and 0.9 x IO4 Bq of radioactive nucleoside in 100 PL of pyridine. Aliquots (I pL) were spotted for TLC at the indicated times of incubation at 23 C. The silica plates were developed with 5% methanol and 0.5% pyridine in chloroform. Fig. 3. Electrophoretic separation of the [‘251]-oligomer-labeled DNA. The PCR synthesis of DNA was carried out as described in Experimental section. The reactions were complete (lane 1); minus Taq polymerase (lane 2); or supplemented with 0.7 pg of unlabeled primer (lane 3). The product was subjected to electrophoresis in 1% agarose and the DNA was stained with ethidium bromide (panel A), then dried and used for autoradiography (panel B).

925

Single-site ‘251-labeling of DNA rapid separation by thin layer chromatography on silica plates. The desired products i.e., iododeoxyuridine and S-tritylated iododeoxyuridine were formed in preparative reactions driven by 200 and 3 x 106-fold, respectively, excess reagent compared to the lz51 species. Since both TLCs are developed in 30 min or less, and the localization and recovery steps also require less than an hour, the radioiodinated tritylated product for ligation as the initial nucleotide could be prepared in a single day. The placement of a radioiodinated nucleoside at a specific site in DNA is potentially of value for the investigation of the radiosensitivity of the bioactivity of DNA. As will be described in the following report (Scherberg, 1992) the single-site iodonucleoside in DNA can also be exploited to detect sequence differences in model DNAs based upon the chemical labilization of the pyrimidine 5 position. For such investigations the site selected for insertion of the “‘1-nucleoside is limited only by the requirement that it contains a thymidylate. However, since deoxycytidine is readily iodinated (Scherberg and Refetoff, 1974), it is probable that any position in double-stranded DNA could be labeled by the approach described. While the procedure has been developed specifically for insertion of labeled nucleosides as a radioactive compound, the described technique could also provide a method to incorporate modified nucleosides for the purpose of incorporating nonradioactive signals into unique sites in DNA.

927

References Baranowska-Kortylewicz J., Kinsey B. M., Layne W. W. and Kassis A. I. (1988) Radioiododemercuration: a simple synthesis of S-[‘23~‘25~‘271]iodo-2’-deoxyuridine. Appl. Radial. Isot. 39, 335.

Damha M. J., Giannaris P. A. and Zabarylo S. V. (1990) An improved procedure for derivatization of controlled-pore glass beads for solid-phase oligonucleotide synthesis. Nucl. Acid Rex 18, 3813. Gautschi J. R., Burkhalter M. and Baumann E. A. (1978) Comparative utilization of bromodeoxyuridine and iododeoxyuridine triphospates for mammalian DNA replication in vitro. Biochim. Biophys. Acta 518, 31. Kassis A. I., Sastry K. S. and Adelstein S. J. (1987) Kinetics of uptake. retention. and radiotoxicitv of ‘251UdR in mammalian cells. Radial. Res. 189, 78.Krisch R. E. and Ley R. D. (1974) Induction of lethality and DNA breakage by the decay of iodine-125 in bacteriophage T4. Int. J. Radiat. Biol. 25, 21. McBride L. J. and Caruthers M. H. (1983) An investigation of several deoxyoligonucleoside phosporamidites useful for synthesizing deoxyoligonucleotides. Tetrahedron Left. 24, 245.

Prusoff W. H. (1959) Synthesis and biological activity of iododeoxyuridine an analogue of thymidine. Biochim. Biophys. Acta 32, 295.

Saiki R. K., Gelfgand D. H., Stoffel S., Scharf S. J., Higuchi R., Horn G. T., Mullis K. B. and Erlich H. A. (1988) Primer-directed enzymatic amplification of DNA with thermostable DNA polymerase. Science 239, 481. Schaller H., Weimann G., Lerch B. and Khorana H. G. (1963) Studies on Polynucleotides XXIV. The stepwise synthesis of specific deoxyribopolynuclotides (4). Protected derivatives of deoxyribonucleosides and new synthesis of deoxyribonucleside-3’phosphatides. J. Am. Chem. Sot. 85, 3821. Scherberg N. (1992) Differential elimination of radioiodine from single- and double-stranded ‘25I-DNA. Appl. Radial. Isot. 43, 929.

Acknowledgements-This work has been supported by The University of Chicago Hospital Clinical Laboratories (and by an award from- the The University of Chicago Technologv Center. Plasmid DNA containinr! the TBG sequence-was provided by Onno Janssen of ;he Thyroid Study Unit.

Scherberg N. and Refetoff S. (1974) The preparation of carrier-free iodine isotope-substituted cytosine nucleotides. Biochim. Biophys. Acta 348, 446. Taketa K., Mori Y., Sobieszczyk S., Seo H., Dick M., Watson F., Flink I. L., Seino S., Bell G. and Refetoff S. (1989) Sequence of the variant thyroxine-binding globulin of Australian aboriginies J. Clin. Invest. 83, 1344.

Site-specific incorporation of [125I]iododeoxyuridine into DNA.

A procedure for the incorporation of [125I]IdU into specific sites in DNA is described. The approach depends upon attachment of radioiododeoxyuridine ...
487KB Sizes 0 Downloads 0 Views