THE ANATOMICAL RECORD 297:749–757 (2014)
BMP4/Smad Signaling Pathway Induces the Differentiation of Mouse Spermatogonial Stem Cells via Upregulation of Sohlh2 YI LI,1,2† YUECUN ZHANG,3† XIAOLI ZHANG,1 JINHAO SUN,4 AND JING HAO1* 1 Department of Histology and Embryology, School of Medicine, Key Laboratory of the Ministry of Education for Experimental Teratology, Shandong University, Jinan 250012, People’s Republic of China 2 Obstetric Genetic Disease Laboratory, Maternal and Child Health Hospital of Zibo City, Zibo 255029, People’s Republic of China 3 Department of Gynaecology and Obstetrics, Qilu Hospital, Shandong University, Jinan 250012, People’s Republic of China 4 Department of Human Anatomy, School of Medicine, Shandong University, Jinan 250012, People’s Republic of China
ABSTRACT Spermatogonial stem cells (SSCs) capable of self-renewal and differentiation are the foundation for spermatogenesis. Although several factors that govern these processes have been investigated, the underlying molecular mechanisms have not been fully elucidated. Here, we investigated the role of BMP4 in mouse SSC differentiation, and found that SSCs cultured in the presence of BMP4 underwent differentiation, characterized by downregulation of SSC self-renewal markers, Plzf, and upregulation of SSC differentiation marker, c-kit. Smad1/5/8 proteins were phosphorylated during BMP4-induced differentiation. The effects of BMP4 on SSCs were blocked by BMP4 inhibitor (Dorsomorphin). The activation of BMP4/Smad signaling pathway in SSCs increased the expression of Sohlh2, which is involved in the early differentiation of spermatogonia. Knockdown sohlh2 expression by RNA interference abolished the effect of BMP4 on SSC differentiation and the upregulation of c-kit expression. Overall, our results suggest that BMP4 plays an important role during the early differentiation of SSCs via upregulation of C 2014 Wiley Periodicals, Inc. sohlh2. Anat Rec, 297:749–757, 2014. V
Key words: spermatogonial stem cells; differentiation; BMP4; Smad1/5/8; Sohlh2
Grant sponsor: National Natural Science Foundation of China; Grant number: 30871405, 30971653; Grant sponsor: Natural Science Foundation of Shandong Province; Grant number: ZR2009CM018. *Correspondence to: Dr. Jing Hao; Department of Histology and Embryology, School of Medicine, Key Laboratory of the Ministry of Education for Experimental Teratology, Shandong University, 44 Wenhuaxi Road, Jinan, Shandong 250012, People’s Republic of China. E-mail: [email protected] C 2014 WILEY PERIODICALS, INC. V
† Yi Li and Yuecun Zhang contributed equally to this manuscript. Received 21 October 2013; Accepted 10 January 2014. DOI 10.1002/ar.22891 Published online 14 February 2014 in Wiley Online Library (wileyonlinelibrary.com).
750
LI ET AL.
INTRODUCTION Spermatogonial stem cells (SSCs) reside on the basement membrane of seminiferous tubules, and are essential to maintain spermatogenesis. In addition to a capacity for self-renewal, SSCs (As spermatogonia) progress through transit-amplifying intermediates (Apr, Aal, A1–4) into B spermatogonia, which give rise to spermatocytes that proceed through meiosis to generate haploid spermatids and ultimately elongated spermatids ready to be released from the seminiferous epithelium (Aponte et al., 2005; Kanatsu-Shinohara et al., 2008). There is a balance between SSC self-renewal and differentiation, which can maintain the stem cell pool and meet the proliferative demand of the testis to produce millions of sperm each day. Once the balance is destroyed, it will lead to either impaired spermatogenesis or testicular germ cell tumors (Singh et al., 2011). The balance between SSC self-renewal and differentiation is tightly regulated by extrinsic signals from the surrounding microenvironment, called the SSC niche (Caires et al., 2010; Oatley and Brinster, 2012). Testicular Sertoli cells are the main components of the niche which provide both physical supports for the SSCs as well as growth factors, such as glial-derived neurotrophic factor (GDNF) and stem cell factor (SCF) (Oatley et al., 2006, 2011) required for SSC function. Bone morphogenetic protein 4 (BMP4) belongs to transforming growth factor-b (TGF-b) family, and plays an important role in germ cell development (Chen et al., 2004). Evidence shows that BMP4 heterozygous male mice are infertile, with germ cell degeneration, low sperm count and sperm quality (Hu et al., 2004). BMP4 is thought to stimulate SSC differentiation based on the fact that isolated spermatogonia from adult mice cultured in the presence of BMP4 give rise to a lower number of colonies upon spermatogonial stem cell transplantation as compared to cells cultured in the absence of BMP4 (Nagano et al., 2003). Furthermore, isolated spermatogonia from 4-day-old mice cultured in the presence of BMP4 upregulate the expression of the transmembrane tyrosine kinase receptor kit (c-kit) (Pellegrini et al., 2003). Expression of c-kit is known to be low or absent in As, Apr, and early Aal spermatogonia while its expression is prominent from late Aal onwards (SchransStassen et al., 1999). BMP4 signaling is mediated by Smads, the intracellular signal transduction protein. Binding of BMP4 to its receptor results in phosphorylation of Smads 1/5/8 which then oligomerize with Smad4 and as a complex translocate to the nucleus and act as a transcription factor (Larsson and Karlsson, 2005; Pellegrini et al., 2003). Smad family members are expressed in spermatogenic cells (Itman and Loveland, 2008). BMP4 can induce nuclear translocation of Smad1/5/8 in the cultured spermatogonia (Pellegrini et al., 2003). Spermatogenesis- and oogenesis-specific basic helixloop-helix (bHLH) transcription factor 2 (sohlh2) was upregulated dramatically in embryonic stem cells cultured with BMP4 (Hao et al., 2008). Sohlh2 is a germ cell specific transcription factor (Ballow et al., 2006). In mouse testes, sohlh2 is specially expressed in undifferentiated and differentiated spermatogonia (Ballow et al., 2006). Several studies have shown that sohlh2— knockdown leads to block the differentiation of Type A
spermatogonia to Type B spermatogonia, and then causes infertility (Hao et al., 2008; Suzuki et al., 2012; Toyoda et al., 2009). To elucidate the role and underlying mechanism of BMP4 in SSC differentiation, we undertook an in vitro study to investigate the effects of exogenous BMP4 and regulated genes on the cultured mouse SSCs. We showed that BMP4 acted through Smad signaling pathway to induced SSC differentiation, characterized by downregulation of SSC self-renewal markers, promyelocytic leukemia zinc finger protein (Plzf), and upregulation of SSC differentiation marker, c-kit. This effect may be mediated by sohlh2.
MATERIALS AND METHODS Reagents and Animals Chinese Kunming mice were used to establish SSCs and mouse embryonic fibroblast (MEF). Animals were treated in accordance with the NIH Guide for the Care and Use of Laboratory Animals. All the protocols were approved by the Animal Care and Use Committee of Shandong University. BMP4 was from Peprotech (NJ). Cell media and supplements were purchased from Gibco (CA); collagenase IV, mitomycin C, and dorsomorphin(6-[4-(2-piperidin-1-ylethoxy) phenyl]-3-pyridin-4-yl-pyrazolo [1, 5-a] pyrimidine) were purchased from Sigma-Aldrich (MO), dorsomorphin, also known as compound C, selectively inhibits BMP Type I receptors (Yu et al., 2008; Zhou et al., 2001); mouse antimouse Plzf monoclonal antibody was purchased from Calbiochem (Darmstadt, Germany); goat antimouse Oct4 and c-kit polyclonal antibody were obtained from Santa Cruz Biotechnology (CA); rabbit antihuman phosphoralated-Smad1/5/8 (pSmad1/5/8) polyclonal antibody was obtained from Cell Signaling Technology (MA); rabbit antihuman Sohlh2 polyclonal antibody was obtained from Abcam (MA); goat antimouse b-actin polyclonal antibody and FITC-conjugated secondary antibodies were purchased from Zhongshanjinqiao Biotechnology (Beijing, China). E.N.Z.A Total RNA Kit I was purchased from Omega Bio-tek (GA); RT and PCR kits were purchased from Thermo Fisher Scientific (MA).
SSC Culture The testes from 4 to 6-day-old Kunming mice were washed with icecold calcium/magnesium free Hanks Balanced Salt Solution (HBSS) containing 100 U/mL penicillin and 100 lg/mL streptomycin, and the tunica albuginea was removed. The tissues were rinsed again with HBSS, minced, then treated with 1 mg/mL collagenase Type IV and 1 mg/ mL DNase I (Sigma-Aldrich, MO) for 15 min at 37 C with gentle agitation in Dulbecco’s Modified Eagle’s Medium (DMEM). The samples were centrifuged at 300g for 10 sec, and the supernatant was discarded. Collected specimens were then treated with 0.25% trypsin–EDTA (Gibco, CA) and 1 mg/mL DNaseI for another 5 min at 37 C, and pipetted up and down with a 1 mL pipette to disperse the testicular cells. Subsequently, DMEM medium with 10% (v/v) fetal bovine serum (FBS) was added to terminate the digestion. Cells were centrifuged at 600g for 5 min. The pellet was re-suspended in a-MEM supplemented with 2.5%
751
BMP4/SMAD SIGNALING IN THE SSC DIFFERENTIATION
TABLE 1. Quantitative Real-time PCR primer sequence and product size Gene G3PDH sohlh2 oct4 plzf c-kit Dazl
Primer sequence sense antisense sense antisense sense antisense sense antisense sense antisense sense antisense
Product size(bp)
ACCACAGTCCATGCCCATCAC TCCACCACCCTGTTGCTGTA TCAAGGGGAGGAAGAGCGAT TGTAACCTGGGCCATAATGG AGACCACCATCTGTCGCTTC CTCATTGTTGTCGGCTTCCT AGGAGGGATGGGGGACT GCTTCAACAGGAGGCGA AGCAAATGTCACAACAACCT CCTCGTATTCAACAACCAAA ATACCTCCGGCTTATACAACTGT GACTTCTTTTGCGGGCCATTT
(v/v) FBS, 2 mM L-glutamine, 13 noncanonical amino acid, 0.5% mercaptoethanol, 0.01 mM sodium pyruvate, 100 lg/mL transferrin, 25 lg/mL insulin, 10 lg/ mL putrescine, 0.1 lg/mL GDNF, 20 lg/mL EGF,100 U/mL penicillin and 100 lg/mL streptomycin (Gibco, CA) and plated on 0.2% (w/v) gelatin coated 24-well tissue culture dishes at a density of 2 3 105 cells/cm2. After culture for 24 and 48 hr, respectively, floating cells were collected and transferred to the new dishes. On day 4 of culture, floating cells were cultured in a new dish with MEF feeder cells. Then SSCs which formed colonies were passaged and cultured without GDNF and EGF. SSCs were divided into three groups: Con group (no additives), BMP4 group (50 ng/mL BMP4), BMP4 1 inhibitor group (50 ng/mL BMP4 1 2 mM dorsomorphin). The cells in three groups were subsequently cultured for the indicated periods of time.
MEF Culture Day 13.5 dpc pregnant mice were sacrificed by cervical dislocation. The fetuses were dissected out. The heads, tails, limbs, and internal organs were discarded. The remains were washed in PBS and transferred a new dish. The tissues were finely minced, and digested by 0.25% (w/v) trypsin/0.02% (w/v) EDTA for 15 min at 37 C with pipetting and agitation to dissociate cells thoroughly. The cells were pelleted by centrifuge and resuspended in warm DMEM supplemented with 10% (v/v) FBS and100 U/mL penicillin and 100 lg/mL streptomycin to adjust cell concentration, and plated in culture dish precoated with 0.2% gelatin. The fibroblasts were passaged 2–3 times, and then inactivated with 10 lg/mL of mitomycin C and use as feeders to replate SSCs.
Immunofluorescent Staining SSCs on days 2 and 7 of culture in three groups were taken out and washed in cold PBS, fixed in methanol:acetic acid (3:1) for 15 min, then washed in PBS again. Then the cells were preblocked with 10% (v/v) normal goat or rabbit serum according to the origination of the secondary antibody in 0.01 M PBS containing 0.3% Triton X-100 at RT for 1 hr. Primary antibodies raised against Plzf, Oct4, pSmad1/5/8, Sohlh2, and c-kit at a 1:100 dilution were used for incubation, respectively, at 4 C overnight. Then FITC-conjugated anti-IgG were used for immunofluorescence staining. Control staining
450 104 104 141 122 138
for each primary antibody was performed with nonspecific IgG (Boster, Wuhan, China) instead of primary antibodies. All cells were counterstained with DAPI and finally sealed with antifade mounting media and examined with Olympus U-LH100HG (Olympus, Tokyo, Japan).
Quantitative Real-Time PCR Analysis (qRT-PCR) Total RNA of SSCs in three groups was extracted from 106 cells using an RNAiso kit (Omega Bio-tek, GA), according to the manufacturer’s instructions. Firststrand cDNA was synthesized from a 1 lg aliquot of the total RNA samples using Thermo RT-PCR system according to the manufacturer’s instructions. Endogenous mRNA levels were measured by real-time PCR analysis based on SYBR Green detection with the Epp-6300 real-time PCR machine (Eppendorf, Hamburg, Germany). Briefly, quantitative real-time PCR was performed in a 12-lL reaction mixture containing 5 lM forward/reverse primers, 13 SYBR GREEN reaction mix (Toyobo, Osaka, Japan), and 1 lL template. The reaction was performed with preliminary denaturation for 10 min at 95 C to activate Taq DNA polymerase, followed by 40 cycles of denature at 95 C for 15 s, annealing at 50–55 C for 30 s, and extension at 63 C for 1 min. Each experiment was performed in triplet and repeated twice. G3PDH was used as internal control amplified in the same PCR assay. The real-time PCR primers used were shown in Table 1.
Western Blot SSCs on day 2 of culture in three groups were harvested, washed in cold PBS, and homogenized at 4 C in lysis buffer containing 10 mM Hepes pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 0.1 mM EGTA, 0.5 mM DTT, 10 mM b-glycerophosphate, 0.1 mM sodium vanadate and a protease inhibitor cocktail (Sigma-Aldrich, MO). After 15 min of incubation on ice, cell debris was removed by centrifugation at 15,000g for 20 min at 4 C. Protein (10 mg) in the supernatant was run on a 10% SDS–polyacrylamide gel, and then transferred to polyvinylidene fluoride membranes (Millipore Corp, MA). After blocking with 5% (w/v) fat-free milk for 1 hr at room temperature, the membranes were probed with anti-pSmad1/5/8 antibody (or anti-Sohlh2 antibody) overnight at 4 C, followed
752
LI ET AL.
TABLE 2. siRNA sequence SiRNA sohlh2 siRNA (1) sohlh2 siRNA (2) sohlh2 siRNA (3) Nonspecific siRNA
Sequence sense antisense sense antisense sense antisense sense antisense
by incubation with peroxidase-conjugated antirabbit (or antigoat) IgG antibody for 1 hr at room temperature. The interaction was monitored with an electrochemiluminescence kit (Amersham Life Sciences Inc., IL, USA). Anti-b-actin antibody was used to monitor the loading amount.
FACS
AAACAUAGCCUUUAAGUCUUUCAGG CCUGAAAGACUUAAAGGCUAUGUUU UAUACAGAUCCUCAAUAGAGCUCUC GAGAGCUCUAUUGAGGAUCUGUAUA AAUCCACGAAAGAUGCUGGCUGAGG CCUCAGCCAGCAUCUUUCGUGGAUU CUUGUAUGGGCAGAUUGCCUU GGCAAUCUGCCCAUACAAGUU
Densitometric evaluation of Western blotting results was conducted using the Quantity One software with b-actin as internal controls. Data were presented as the mean 6 standard deviation (SD) of three separate experiments. Comparisons among groups were conducted using one-way analysis of variance (ANOVA). The results were considered statistically significant at P < 0.05.
Approximately 3–5 3 106 single cells were fixed with 1% paraformaldehyde for 30 min, washed three times with PBS, and centrifuged for collection of SSCs. After permeabilization by 0.2% Triton X100 for 10 min, the cells were blocked and stained with mouse antimouse Plzf antibody (1:100) at 4 C overnight after thoroughly mixing. After being washed with PBS, the fluorescentlabeled second antibody (1:100) was added for an incubation of 2 h at 4 C, washed again with PBS, re-suspended and detected by flow cytometry (FACSAria, Becton Dickinson) with blank and negative control groups. The experiments were conducted in triplicate.
Morphological observation showed that the dozens cells gathered to form typical colonies after 6–7 days culture. SSCs in culture showed unique morphologic appearance. They were round with large nuclei, high nuclear-to-cytoplasmic ratio (Fig. 1A). SSC colonies were positive for both Plzf and Oct4, while feeder cells (MEFs) were all negative (Fig. 1B,C). FACS results showed that more than 90% cultured cells were Plzf positive (Fig. 1D).
siRNA Transfection
BMP4 Promotes the SSC Differentiation
For sohlh2 knockdown, siRNA specific to mouse sohlh2 (GenBank accession no. NM-002467) was synthesized by Invitrogen Corporation (Invitrogen, Carlsbad). The siRNA oligonucleotide sequences were shown in Table 2. Sohlh2 siRNA and negative control siRNA were dissolved in nuclease-free water at 10 lM. SSCs were transfected with sohlh2 siRNA and negative control siRNA using LipofectamineTM 2000 (Invitrogen, Carlsbad) at a final concentration of 50 nM in accordance with the manufacturer’s instruction. At 5 hr posttransfection, cells were divided into four groups: siCon group, BMP4 1 siCon group, siSohlh2 group, BMP4 1 siSohlh2 group. After 48 hr culture, SSCs in four groups were collected to prepare mRNA for examination of gene expression.
To test the effects of BMP4 on the differentiation of mouse SSCs, SSCs in vitro culture were divided into three groups: Con group (no additives), BMP4 group (50 ng/mL BMP4), BMP4 1 inhibitor group (50 ng/mL BMP4 1 2 mM dorsomorphin). The expression levels of ckit and Plzf were assayed using immunofluorescent staining and qRT-PCR. The mRNA and protein expression of c-kit increased significantly, while Plzf decreased significantly after treatment with BMP4 for 48 and 168 hr, respectively (Fig. 2A–C). The results of immunofluorescent staining showed that expression of c-kit in the BMP4 group was significantly greater than either in the Con group or the BMP4 1 inhibitor group (P < 0.05), and c-kit positive cells were mainly observed in the periphery of SSC colonies (Fig. 2A,B). The expression of Plzf in the BMP4 group was significantly less than both the Con group and the BMP4 1 inhibitor group (P < 0.05), and that the Plzf positive cells were mainly located in the center of SSC colonies (Fig. 2A,B). There was no significant difference between the Con group and the BMP4 1 inhibitor group in either Plzf or c-kit expression. The qRT-PCR results showed that the mRNA expression of c-kit was significantly upregulated, while Plzf was significantly downregulated after treatment with BMP4 for 48 or 168 hr (Fig. 2C). The BMP4 signaling-specific inhibitor, dorsomorphin, abolished the effects of BMP4 on both the protein and mRNA expression of c-kit and Plzf.
Statistical Analysis Immunofluorescent intensity was measured using Image J Software. Each slide (n 5 3) was split into four equal-sized partitions. At least 10 immunostained SSC colonies in each partition were randomly selected to measure the gray values. The gray values were divides by the area of the colony. The intensity of immunostaining was reported as the mean of measured SSCs gray value minus background gray value. The background gray value was measured at a cell-free area of the slice.
RESULTS SSC Characterization
BMP4/SMAD SIGNALING IN THE SSC DIFFERENTIATION
753
Fig. 1. SSC characterization. (A) Dozens of SSCs formed typical colonies on the MEFs after 6–7 days culture. The cells in the colonies were positive for Plzf (B) and Oct4 immunostaining (C) Plzf and Oct4 were labeled with FITC (green) and cell nuclei were counterstained by DAPI (blue). Scale bars indicate 20 lm. (D) A representative FACS scatter plot showing Plzf positive cells (fraction II; 90.7%) and negative cells (fraction I; 5.2%). Nonspecific IgG served as a negative control.
BMP4 Functions Through the Smad Signaling Pathway and Upregulates the Expression of Sohlh2 in SSCs
sion was abolished by dorsomorphin, suggesting BMP4 promotes sohlh2 expression in SSCs.
Smad1/5/8, the signaling pathway of BMP4 in the SSC differentiation, were assayed using immunofluorescent staining and Western blotting. A significant increase of pSmad1/5/8 was observed in the BMP4 group when compared with the Con group (P < 0.05, Fig. 3A,B,D,E). Dorsomorphin repressed the increase in pSmad1/5/8 induced by BMP4 treatments. Thus, these results indicate that the effects of BMP4 on SSC activity are mediated by the Smad1/5/8. The mRNA and protein expression of sohlh2 were significantly upregulated in these culture conditions when 50ng/mL BMP4 was present for either 24 or 48 hr (P < 0.05, Fig. 3). The effects of BMP4 on Sohlh2 expres-
Sohlh2 Mediates SSC Differentiation Induced by BMP4/Smad Signaling Pathway To test whether BMP4/Smad pathway signals sohlh2 to induce SSC differentiation, the expression of sohlh2 was knocked down by siRNAs that specifically targeted the mouse sohlh2 mRNA. As shown in Figure 4A, sohlh2 mRNA expression in SSCs was significantly reduced (P < 0.05) in the sohlh2 siRNA transfected group compared to the negative control siRNA group, indicating sohlh2 gene expression was efficiently knocked down. Transfection with sohlh2 siRNA (2) reduced sohlh2 mRNA levels by 60%, so sohlh2 siRNA (2) was chosen for the
754
LI ET AL.
Fig. 2. BMP4 induces in vitro differentiation of SSCs. (A) Immunofluorescence analysis for c-kit and Plzf expression in three groups after 2 days culture. C-kit and Plzf were labeled with FITC (green) and cell nuclei were counterstained by DAPI (blue). Scale bars indicate 20 lm. (B) Semiquantitative analysis of the immunofluorescence results. (C) Quantitative real-time PCR analysis for c-kit and Plzf mRNA levels in three groups after 2 and 7 days culture. The expression level of Con group was set as 1 and compared with that of other groups.G3PDH
served as the internal control. The protein and mRNA levels of c-kit were significantly induced, while Plzf protein and mRNA levels were significantly reduced by the BMP4 treatments when compared with the Con group. BMP4 inhibitor, dorsomorphin, abolished the effects of BMP4 on the expression of c-kit and Plzf. Data are presented as mean 6 SD from three independent experiments. Statistically significant differences in comparison to the Con group are indicated by *P < 0.05 or **P < 0.01.
further experiments. Knockdown of sohlh2 expression increased Plzf-positive SSCs and blocked SSC differentiation induced by BMP4 (Fig. 4B–D). Sohlh2 knockdown induced Plzf and oct4 expression, while reduced c-kit and c-kit downstream gene (Dazl) expression (Fig. 4D), suggesting that sohlh2 plays an important role during SSC differentiation. Importantly, the stimulating effects of BMP4/Smad signaling pathway on c-kit and Dazl expression was significantly reduced in the BMP4 1 siSohlh2 group compared with the BMP4 1 siCon (Fig. 4D), suggesting that sohlh2 is required for c-kit upregulation stimulated by BMP4/Smad signaling pathway.
sis by regulating a series of cellular processes including cell proliferation, adhesion, migration, differentiation, and apoptosis (Fei and Chen, 2010; Haramis et al., 2004; Massague and Chen, 2000; Shi and Massague, 2003). It has been confirmed that this pathway has diverse functions in the different kinds of stem cells. It has been shown to promote self-renewal of mouse embryonic stem cells but repress proliferation of skin and intestinal stem cells (Haramis et al., 2004; He et al., 2004; Qi et al., 2004; Wagner, 2007; Ying et al., 2003; Zhang et al., 2013). BMP4 when added to cultures of SSCs reduces the maintenance of these stem cells, suggesting that this factor enhances stem cell differentiation (Nagano et al., 2003). In addition, BMP4 has been found to induce c-kit expression in c-kit negative spermatogonia (Pellegrini et al., 2003). It has been demonstrated that Bmp4 promotes rat SSC differentiation (Carlomaqno et al., 2010). Consistently, our results
DISCUSSION The BMP4 signaling pathway plays multiple critical roles during embryogenesis as well as in tissue homeosta-
BMP4/SMAD SIGNALING IN THE SSC DIFFERENTIATION
Fig. 3. BMP4 functions through the Smad signaling pathway and upregulates the expression of sohlh2 in SSCs. (A) Immunofluorescence analysis for pSmad1/5/8 and Sohlh2 expression in Con, BMP4, and BMP4 1 inhibitor groups. pSmad1/5/8 and Sohlh2 were labeled with FITC (green) and cell nuclei were counterstained by DAPI (blue). The nuclear levels of pSmad1/5/8 and Sohlh2 were higher in BMP4 group than that of Con group. Scale bars indicate 20 lm. (B) Semiquantitative analysis of the immunofluorescence results. The protein levels of pSmad1/5/8 and Sohlh2 were significantly upregulated by BMP treatment when compared with the Con group. (C) Quantitative real-time PCR analysis for sohlh2 mRNA levels in three groups. The expression level of Con group was set as 1 and compared with that of
755
other groups. G3PDH served as the internal control. The mRNA levels of sohlh2 were significantly induced by BMP4 treatment when compared with the Con group. BMP4 inhibitor, dorsomorphin, abolished the effects of BMP4 on Sohlh2 expression. (D) Western-blotting analysis for pSmad1/5/8, and Sohlh2 protein levels in three groups after 48 hr culture. b-actin was used as the loading control. (E) Semiquantitative densitometry analysis of Western-blotting results. b-actin served as the internal control. The expression of pSmad1/5/8 and Sohlh2 were significantly induced by BMP treatment when compared with the Con group. Data are presented as mean 6 SD from three independent experiments. Statistically significant differences in comparison to the Con group are indicated by *P < 0.05 or **P < 0.01.
756
LI ET AL.
Fig. 4. Sohlh2 mediates the SSC differentiation induced by BMP4 treatment. (A) Sohlh2 mRNA levels in SSCs were significantly reduced by sohlh2 specific siRNA but not by the negative control siRNA when compared with the control group. The transfection of sohlh2 siRNA (2) reduced sohlh2 mRNA levels in SSCs by 60%. (B) Immunofluorescence analysis for Plzf expression in four groups (1, siCon; 2, siSohlh2; 3, BMP4 1 siCon; 4, BMP4 1 siSohlh2). Plzf were labeled with FITC (green) and cell nuclei were counterstained by DAPI (blue). Scale bars indicate 20 lm. (C) Relative quantification of Plzf-positive cells in four groups. Knockdown of sohlh2 increased Plzf-positive SSCs and blocked
SSC differentiation induced by BMP4. (D) Quantitative real-time PCR analysis for sohlh2, c-kit, dazl, plzf, and oct4 mRNA levels in four groups (1, siCon; 2, siSohlh2; 3, BMP4 1 siCon; 4, BMP4 1 siSohlh2). The expression level of siCon group was set as 1 and compared with that of other groups, as well as the quantitative comparison among groups. G3PDH served as the internal control. Data are presented as mean 6 SD from three independent experiments. Statistically significant differences in comparison to the siCon group are indicated by *P < 0.05 or **P < 0.01. Black triangle indicates significant difference (P < 0.05) when the BMP4 1 siSohlh2 group compared with the BMP4 1 siCon group.
confirmed that exogenous BMP4 enhanced the differentiation of mouse SSCs in culture as illustrated by an upregulation of c-kit, and downregulation of Plzf. We also observed that BMP4 treatment resulted in greater sustained levels of intracellular pSmad1/5/8 when compared with the control group, suggesting that BMP4 activate Smad signaling pathway to induce SSC differentiation. It is consistent with other results that BMP4 increases the phosphorylation of Smad1/5/8 in rat SSCs and mouse spermatogonia (Carlomaqno et al., 2010; Pellegrini et al., 2003). We also found that dorsomorphin blocked BMP4-mediated Smad1/5/8 phosphorylation and SSC differentiation. Dorsomorphin selectively inhibits BMP Type I receptors (Yu et al., 2008; Zhou et al., 2001). These results indicate that BMP4 bind to receptors on SSCs to induce SSC differentiation directly. Sohlh2 plays a critical role in spermatogonial differentiation. The effects of Sohlh2 on SSC differentiation have not been reported. In this study, we demonstrated that sohlh2 in SSCs was upregulated by BMP4 at the mRNA and protein levels. Knockdown of sohlh2 increased SSC self-renewal and abolished SSC differen-
tiation induced by BMP4. Our results indicate sohlh2 may be a new target gene of the BMP4 signaling pathway and play a role in SSC differentiation. Further studies are necessary to address whether sohlh2 is the direct target gene of BMP4/Smad signaling pathway. The SCF/c-kit signaling pathway play a key role in the differentiation of Type A spermatogonia (Kierszenbaum, 2006; Ohta et al., 2003; Zhang et al., 2011). Recent studies have shown that c-kit is a direct target gene of sohlh2 (Barrios et al., 2012). The expression of ckit in spermatogonia is downregulated in sohlh2 – knockout mice (Hao et al., 2008; Suzuki et al., 2012; Toyoda et al., 2009). Sohlh2 can bind to the promoter region of c-kit to regulate its expression. In the present study, we found BMP4 promoted SSC differentiation possibly via upregulation of the expression of sohlh2 and ckit. Knockdown of sohlh2 by RNA interference repressed c-kit expression induced by BMP4. These results suggest that BMP4/Smad signaling pathway may function through sohlh2 to upregulate the expression of c-kit. In summary, the findings of this study demonstrated that activation of the BMP4/Smad signaling pathway
BMP4/SMAD SIGNALING IN THE SSC DIFFERENTIATION
promoted mouse SSC differentiation, possibly via upregulation of sohlh2 expression, thus contributing to its downstream gene expression of c-kit. Our results suggest that BMP4/Smad signaling pathway plays a critical role in controlling SSC differentiation. Identification of the effects of BMP4/Smad signaling on male infertility is worthy of investigation in the future studies.
LITERATURE CITED Aponte PM, van Bragt MP, de Rooij DG, et al. 2005. Spermatogonial stem cells: Characteristics and experimental possibilities. APMIS 113:727–742. Ballow DJ, Xin Y, Choi Y, et al. 2006. Sohlh2 is a germ cell-specific bHLH transcription factor. Gene Exp Pattern 6:1014–1018. Barrios F, Filipponi D, Campolo F, et al. 2012. SOHLH1 and SOHLH2 control kit expression during postnatal male germ cell development. J Cell Sci 125:1455–1464. Caires K, Broady J, McLean D. 2010. Maintaining the male germline: Regulation of spermatogonial stem cells. J Endocrinol 205:133–145. Carlomaqno G, van Braqt MP, Korver CM, et al. 2010. BMP4induced differentiation of a rat spermatogonial stem cell line causes changes in its cell adhesion properties. Biol Reprod. 83: 742–749. Chen D, Zhao M, Mundy GR. 2004. Bone morphogenetic proteins. Growth Factors 22:233–241. Fei T, Chen YG. 2010. Regulation of embryonic stem cell selfrenewal and differentiation by TGF-beta family signaling. Sci China Life Sci 53:497–503. Hao J, Yamamoto M, Richardson TE, et al. 2008. Sohlh2 knockout mice are male-sterile because of degeneration of differentiating type A spermatogonia. Stem Cells 26:1587–1597. Haramis AP, Begthel H, van den Born M, et al. 2004. De novo crypt formation and juvenile polyposis on BMP inhibition in mouse intestine. Science 303:1684–1686. He XC, Zhang J, Tong WG, et al. 2004. BMP signaling inhibits intestinal stem cell self-renewal through suppression of Wntcatenin signaling. Nat Genet 36:1117–1121. Hu J, Chen YX, Wang D, et al. 2004. Developmental expression and function of Bmp4 in spermatogenesis and in maintaining epididymal integrity. Dev Biol 276:158–171. Itman C, Loveland KL. 2008. SMAD expression in the testis: An insight into BMP regulation of spermatogenesis. Dev Dyn 237:97–111. Kanatsu-Shinohara M, Takehashi M, et al. 2008. Brief history, pitfalls, and prospects of mammalian spermatogonial stem cell research. Cold Spring Harb Symp Quant Biol 73:17–23. Kierszenbaum AL. 2006. Tyrosine protein kinases and spermatogenesis: Truncation matters. Mol Reprod Dev 73:399–403. Larsson J, Karlsson S. 2005. The role of Smad signaling in hematopoiesis. Oncogene 24:5676–5692.
757
Massague J, Chen YG. 2000. Controlling TGF-beta signaling. Genes Dev 14:627–644. Nagano M, Ryu BY, Brinster CJ, et al. 2003. Maintenance of mouse male germ line stem cells in vitro. Biol Reprod 68:2207–2214. Oatley JM, Avarbock MR, Telaranta AI, et al. 2006. Identifying genes important for spermatogonial stem cell self-renewal and survival. Proc Natl Acad Sci USA 103:9524–9529. Oatley JM, Brinster RL. 2012. The germline stem cell niche unit in mammalian testes. Physiol Rev 92:577–595. Oatley MJ, Racicot KE, Oatley JM. 2011. Sertoli cells dictate spermatogonial stem cell niches in the mouse testis. Biol Reprod 84: 639–645. Ohta H, Tohda A, Nishimune Y. 2003. Proliferation and differentiation of spermatogonial stem cells in the w/wv mutant mouse testis. Biol Reprod 69:1815–1821. Pellegrini M, Grimaldi P, Rossi P, et al. 2003. Developmental expression of BMP4/ALK3/SMAD5 signaling pathway in the mouse testis: A potential role of BMP4 in spermatogonia differentiation. J Cell Sci 116:3363–3372. Qi X, Li TG, Hao J, Hu J, et al. 2004. BMP4 supports self-renewal of embryonic stem cells by inhibiting mitogen-activated protein kinase pathways. Proc Natl Acad Sci USA 101:6027–6032. Schrans-Stassen BH, van de Kant HJ, de Rooij DG, et al. 1999. Differential expression of c-kit in mouse undifferentiated and differentiating type A spermatogonia. Endocrinology 140:5894–5900. Shi Y, Massague J. 2003. Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell 113:685–700. Singh SR, Burnicka-Turek O, Chauhan C, et al. 2011. Spermatogonial stem cells, infertility and testicular cancer. J Cell Mol Med 15:468–483. Suzuki H, Ahn HW, Chu T, et al. 2012. SOHLH1 and SOHLH2 coordinate spermatogonial differentiation. Dev Biol 361:301–312. Toyoda S, Miyazaki T, Miyazaki S, et al. 2009. Sohlh2 affects differentiation of KIT positive oocytes and spermatogonia. Dev Biol 325:238–248. Wagner TU. 2007. Bone morphogenetic protein signaling in stem cells—One signal, many consequences. FEBS J 274:2968–2976. Ying QL, Nichols J, Chambers I, et al. 2003. BMP induction of Id proteins suppresses differentiation and sustains embryonic stem cell self-renewal in collaboration with STAT3. Cell 115:281–292. Yu PB, Hong CC, Sachidanandan C, et al. 2008. Dorsomorphin inhibits BMP signals required for embryogenesis and iron metabolism. Nat Chem Biol 4:33–41. Zhang J, Fei T, Li Z, et al. 2013. BMP induces Cochlin expression to facilitate self-renewal and suppress neural differentiation of mouse embryonic stem cells. J Biol Chem 288:8053–8060. Zhang L, Tang J, Haines CJ, et al. 2011. c-kit and its related genes in spermatogonial differentiation. Spermatogenesis 1:186–194. Zhou G, Myers R, Li Y, et al. 2001. Role of AMP-activated protein kinase in mechanism of metformin action. J Clin Invest 108: 1167–1174.
BMP4/Smad Signaling Pathway Induces the Differentiation of Mouse Spermatogonial Stem Cells via Upregulation of Sohlh2 YI LI,1,2† YUECUN ZHANG,3† XIAOLI ZHANG,1 JINHAO SUN,4 AND JING HAO1* 1 Department of Histology and Embryology, School of Medicine, Key Laboratory of the Ministry of Education for Experimental Teratology, Shandong University, Jinan 250012, People’s Republic of China 2 Obstetric Genetic Disease Laboratory, Maternal and Child Health Hospital of Zibo City, Zibo 255029, People’s Republic of China 3 Department of Gynaecology and Obstetrics, Qilu Hospital, Shandong University, Jinan 250012, People’s Republic of China 4 Department of Human Anatomy, School of Medicine, Shandong University, Jinan 250012, People’s Republic of China
ABSTRACT Spermatogonial stem cells (SSCs) capable of self-renewal and differentiation are the foundation for spermatogenesis. Although several factors that govern these processes have been investigated, the underlying molecular mechanisms have not been fully elucidated. Here, we investigated the role of BMP4 in mouse SSC differentiation, and found that SSCs cultured in the presence of BMP4 underwent differentiation, characterized by downregulation of SSC self-renewal markers, Plzf, and upregulation of SSC differentiation marker, c-kit. Smad1/5/8 proteins were phosphorylated during BMP4-induced differentiation. The effects of BMP4 on SSCs were blocked by BMP4 inhibitor (Dorsomorphin). The activation of BMP4/Smad signaling pathway in SSCs increased the expression of Sohlh2, which is involved in the early differentiation of spermatogonia. Knockdown sohlh2 expression by RNA interference abolished the effect of BMP4 on SSC differentiation and the upregulation of c-kit expression. Overall, our results suggest that BMP4 plays an important role during the early differentiation of SSCs via upregulation of C 2014 Wiley Periodicals, Inc. sohlh2. Anat Rec, 297:749–757, 2014. V
Key words: spermatogonial stem cells; differentiation; BMP4; Smad1/5/8; Sohlh2
Grant sponsor: National Natural Science Foundation of China; Grant number: 30871405, 30971653; Grant sponsor: Natural Science Foundation of Shandong Province; Grant number: ZR2009CM018. *Correspondence to: Dr. Jing Hao; Department of Histology and Embryology, School of Medicine, Key Laboratory of the Ministry of Education for Experimental Teratology, Shandong University, 44 Wenhuaxi Road, Jinan, Shandong 250012, People’s Republic of China. E-mail: [email protected] C 2014 WILEY PERIODICALS, INC. V
† Yi Li and Yuecun Zhang contributed equally to this manuscript. Received 21 October 2013; Accepted 10 January 2014. DOI 10.1002/ar.22891 Published online 14 February 2014 in Wiley Online Library (wileyonlinelibrary.com).
750
LI ET AL.
INTRODUCTION Spermatogonial stem cells (SSCs) reside on the basement membrane of seminiferous tubules, and are essential to maintain spermatogenesis. In addition to a capacity for self-renewal, SSCs (As spermatogonia) progress through transit-amplifying intermediates (Apr, Aal, A1–4) into B spermatogonia, which give rise to spermatocytes that proceed through meiosis to generate haploid spermatids and ultimately elongated spermatids ready to be released from the seminiferous epithelium (Aponte et al., 2005; Kanatsu-Shinohara et al., 2008). There is a balance between SSC self-renewal and differentiation, which can maintain the stem cell pool and meet the proliferative demand of the testis to produce millions of sperm each day. Once the balance is destroyed, it will lead to either impaired spermatogenesis or testicular germ cell tumors (Singh et al., 2011). The balance between SSC self-renewal and differentiation is tightly regulated by extrinsic signals from the surrounding microenvironment, called the SSC niche (Caires et al., 2010; Oatley and Brinster, 2012). Testicular Sertoli cells are the main components of the niche which provide both physical supports for the SSCs as well as growth factors, such as glial-derived neurotrophic factor (GDNF) and stem cell factor (SCF) (Oatley et al., 2006, 2011) required for SSC function. Bone morphogenetic protein 4 (BMP4) belongs to transforming growth factor-b (TGF-b) family, and plays an important role in germ cell development (Chen et al., 2004). Evidence shows that BMP4 heterozygous male mice are infertile, with germ cell degeneration, low sperm count and sperm quality (Hu et al., 2004). BMP4 is thought to stimulate SSC differentiation based on the fact that isolated spermatogonia from adult mice cultured in the presence of BMP4 give rise to a lower number of colonies upon spermatogonial stem cell transplantation as compared to cells cultured in the absence of BMP4 (Nagano et al., 2003). Furthermore, isolated spermatogonia from 4-day-old mice cultured in the presence of BMP4 upregulate the expression of the transmembrane tyrosine kinase receptor kit (c-kit) (Pellegrini et al., 2003). Expression of c-kit is known to be low or absent in As, Apr, and early Aal spermatogonia while its expression is prominent from late Aal onwards (SchransStassen et al., 1999). BMP4 signaling is mediated by Smads, the intracellular signal transduction protein. Binding of BMP4 to its receptor results in phosphorylation of Smads 1/5/8 which then oligomerize with Smad4 and as a complex translocate to the nucleus and act as a transcription factor (Larsson and Karlsson, 2005; Pellegrini et al., 2003). Smad family members are expressed in spermatogenic cells (Itman and Loveland, 2008). BMP4 can induce nuclear translocation of Smad1/5/8 in the cultured spermatogonia (Pellegrini et al., 2003). Spermatogenesis- and oogenesis-specific basic helixloop-helix (bHLH) transcription factor 2 (sohlh2) was upregulated dramatically in embryonic stem cells cultured with BMP4 (Hao et al., 2008). Sohlh2 is a germ cell specific transcription factor (Ballow et al., 2006). In mouse testes, sohlh2 is specially expressed in undifferentiated and differentiated spermatogonia (Ballow et al., 2006). Several studies have shown that sohlh2— knockdown leads to block the differentiation of Type A
spermatogonia to Type B spermatogonia, and then causes infertility (Hao et al., 2008; Suzuki et al., 2012; Toyoda et al., 2009). To elucidate the role and underlying mechanism of BMP4 in SSC differentiation, we undertook an in vitro study to investigate the effects of exogenous BMP4 and regulated genes on the cultured mouse SSCs. We showed that BMP4 acted through Smad signaling pathway to induced SSC differentiation, characterized by downregulation of SSC self-renewal markers, promyelocytic leukemia zinc finger protein (Plzf), and upregulation of SSC differentiation marker, c-kit. This effect may be mediated by sohlh2.
MATERIALS AND METHODS Reagents and Animals Chinese Kunming mice were used to establish SSCs and mouse embryonic fibroblast (MEF). Animals were treated in accordance with the NIH Guide for the Care and Use of Laboratory Animals. All the protocols were approved by the Animal Care and Use Committee of Shandong University. BMP4 was from Peprotech (NJ). Cell media and supplements were purchased from Gibco (CA); collagenase IV, mitomycin C, and dorsomorphin(6-[4-(2-piperidin-1-ylethoxy) phenyl]-3-pyridin-4-yl-pyrazolo [1, 5-a] pyrimidine) were purchased from Sigma-Aldrich (MO), dorsomorphin, also known as compound C, selectively inhibits BMP Type I receptors (Yu et al., 2008; Zhou et al., 2001); mouse antimouse Plzf monoclonal antibody was purchased from Calbiochem (Darmstadt, Germany); goat antimouse Oct4 and c-kit polyclonal antibody were obtained from Santa Cruz Biotechnology (CA); rabbit antihuman phosphoralated-Smad1/5/8 (pSmad1/5/8) polyclonal antibody was obtained from Cell Signaling Technology (MA); rabbit antihuman Sohlh2 polyclonal antibody was obtained from Abcam (MA); goat antimouse b-actin polyclonal antibody and FITC-conjugated secondary antibodies were purchased from Zhongshanjinqiao Biotechnology (Beijing, China). E.N.Z.A Total RNA Kit I was purchased from Omega Bio-tek (GA); RT and PCR kits were purchased from Thermo Fisher Scientific (MA).
SSC Culture The testes from 4 to 6-day-old Kunming mice were washed with icecold calcium/magnesium free Hanks Balanced Salt Solution (HBSS) containing 100 U/mL penicillin and 100 lg/mL streptomycin, and the tunica albuginea was removed. The tissues were rinsed again with HBSS, minced, then treated with 1 mg/mL collagenase Type IV and 1 mg/ mL DNase I (Sigma-Aldrich, MO) for 15 min at 37 C with gentle agitation in Dulbecco’s Modified Eagle’s Medium (DMEM). The samples were centrifuged at 300g for 10 sec, and the supernatant was discarded. Collected specimens were then treated with 0.25% trypsin–EDTA (Gibco, CA) and 1 mg/mL DNaseI for another 5 min at 37 C, and pipetted up and down with a 1 mL pipette to disperse the testicular cells. Subsequently, DMEM medium with 10% (v/v) fetal bovine serum (FBS) was added to terminate the digestion. Cells were centrifuged at 600g for 5 min. The pellet was re-suspended in a-MEM supplemented with 2.5%
751
BMP4/SMAD SIGNALING IN THE SSC DIFFERENTIATION
TABLE 1. Quantitative Real-time PCR primer sequence and product size Gene G3PDH sohlh2 oct4 plzf c-kit Dazl
Primer sequence sense antisense sense antisense sense antisense sense antisense sense antisense sense antisense
Product size(bp)
ACCACAGTCCATGCCCATCAC TCCACCACCCTGTTGCTGTA TCAAGGGGAGGAAGAGCGAT TGTAACCTGGGCCATAATGG AGACCACCATCTGTCGCTTC CTCATTGTTGTCGGCTTCCT AGGAGGGATGGGGGACT GCTTCAACAGGAGGCGA AGCAAATGTCACAACAACCT CCTCGTATTCAACAACCAAA ATACCTCCGGCTTATACAACTGT GACTTCTTTTGCGGGCCATTT
(v/v) FBS, 2 mM L-glutamine, 13 noncanonical amino acid, 0.5% mercaptoethanol, 0.01 mM sodium pyruvate, 100 lg/mL transferrin, 25 lg/mL insulin, 10 lg/ mL putrescine, 0.1 lg/mL GDNF, 20 lg/mL EGF,100 U/mL penicillin and 100 lg/mL streptomycin (Gibco, CA) and plated on 0.2% (w/v) gelatin coated 24-well tissue culture dishes at a density of 2 3 105 cells/cm2. After culture for 24 and 48 hr, respectively, floating cells were collected and transferred to the new dishes. On day 4 of culture, floating cells were cultured in a new dish with MEF feeder cells. Then SSCs which formed colonies were passaged and cultured without GDNF and EGF. SSCs were divided into three groups: Con group (no additives), BMP4 group (50 ng/mL BMP4), BMP4 1 inhibitor group (50 ng/mL BMP4 1 2 mM dorsomorphin). The cells in three groups were subsequently cultured for the indicated periods of time.
MEF Culture Day 13.5 dpc pregnant mice were sacrificed by cervical dislocation. The fetuses were dissected out. The heads, tails, limbs, and internal organs were discarded. The remains were washed in PBS and transferred a new dish. The tissues were finely minced, and digested by 0.25% (w/v) trypsin/0.02% (w/v) EDTA for 15 min at 37 C with pipetting and agitation to dissociate cells thoroughly. The cells were pelleted by centrifuge and resuspended in warm DMEM supplemented with 10% (v/v) FBS and100 U/mL penicillin and 100 lg/mL streptomycin to adjust cell concentration, and plated in culture dish precoated with 0.2% gelatin. The fibroblasts were passaged 2–3 times, and then inactivated with 10 lg/mL of mitomycin C and use as feeders to replate SSCs.
Immunofluorescent Staining SSCs on days 2 and 7 of culture in three groups were taken out and washed in cold PBS, fixed in methanol:acetic acid (3:1) for 15 min, then washed in PBS again. Then the cells were preblocked with 10% (v/v) normal goat or rabbit serum according to the origination of the secondary antibody in 0.01 M PBS containing 0.3% Triton X-100 at RT for 1 hr. Primary antibodies raised against Plzf, Oct4, pSmad1/5/8, Sohlh2, and c-kit at a 1:100 dilution were used for incubation, respectively, at 4 C overnight. Then FITC-conjugated anti-IgG were used for immunofluorescence staining. Control staining
450 104 104 141 122 138
for each primary antibody was performed with nonspecific IgG (Boster, Wuhan, China) instead of primary antibodies. All cells were counterstained with DAPI and finally sealed with antifade mounting media and examined with Olympus U-LH100HG (Olympus, Tokyo, Japan).
Quantitative Real-Time PCR Analysis (qRT-PCR) Total RNA of SSCs in three groups was extracted from 106 cells using an RNAiso kit (Omega Bio-tek, GA), according to the manufacturer’s instructions. Firststrand cDNA was synthesized from a 1 lg aliquot of the total RNA samples using Thermo RT-PCR system according to the manufacturer’s instructions. Endogenous mRNA levels were measured by real-time PCR analysis based on SYBR Green detection with the Epp-6300 real-time PCR machine (Eppendorf, Hamburg, Germany). Briefly, quantitative real-time PCR was performed in a 12-lL reaction mixture containing 5 lM forward/reverse primers, 13 SYBR GREEN reaction mix (Toyobo, Osaka, Japan), and 1 lL template. The reaction was performed with preliminary denaturation for 10 min at 95 C to activate Taq DNA polymerase, followed by 40 cycles of denature at 95 C for 15 s, annealing at 50–55 C for 30 s, and extension at 63 C for 1 min. Each experiment was performed in triplet and repeated twice. G3PDH was used as internal control amplified in the same PCR assay. The real-time PCR primers used were shown in Table 1.
Western Blot SSCs on day 2 of culture in three groups were harvested, washed in cold PBS, and homogenized at 4 C in lysis buffer containing 10 mM Hepes pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 0.1 mM EGTA, 0.5 mM DTT, 10 mM b-glycerophosphate, 0.1 mM sodium vanadate and a protease inhibitor cocktail (Sigma-Aldrich, MO). After 15 min of incubation on ice, cell debris was removed by centrifugation at 15,000g for 20 min at 4 C. Protein (10 mg) in the supernatant was run on a 10% SDS–polyacrylamide gel, and then transferred to polyvinylidene fluoride membranes (Millipore Corp, MA). After blocking with 5% (w/v) fat-free milk for 1 hr at room temperature, the membranes were probed with anti-pSmad1/5/8 antibody (or anti-Sohlh2 antibody) overnight at 4 C, followed
752
LI ET AL.
TABLE 2. siRNA sequence SiRNA sohlh2 siRNA (1) sohlh2 siRNA (2) sohlh2 siRNA (3) Nonspecific siRNA
Sequence sense antisense sense antisense sense antisense sense antisense
by incubation with peroxidase-conjugated antirabbit (or antigoat) IgG antibody for 1 hr at room temperature. The interaction was monitored with an electrochemiluminescence kit (Amersham Life Sciences Inc., IL, USA). Anti-b-actin antibody was used to monitor the loading amount.
FACS
AAACAUAGCCUUUAAGUCUUUCAGG CCUGAAAGACUUAAAGGCUAUGUUU UAUACAGAUCCUCAAUAGAGCUCUC GAGAGCUCUAUUGAGGAUCUGUAUA AAUCCACGAAAGAUGCUGGCUGAGG CCUCAGCCAGCAUCUUUCGUGGAUU CUUGUAUGGGCAGAUUGCCUU GGCAAUCUGCCCAUACAAGUU
Densitometric evaluation of Western blotting results was conducted using the Quantity One software with b-actin as internal controls. Data were presented as the mean 6 standard deviation (SD) of three separate experiments. Comparisons among groups were conducted using one-way analysis of variance (ANOVA). The results were considered statistically significant at P < 0.05.
Approximately 3–5 3 106 single cells were fixed with 1% paraformaldehyde for 30 min, washed three times with PBS, and centrifuged for collection of SSCs. After permeabilization by 0.2% Triton X100 for 10 min, the cells were blocked and stained with mouse antimouse Plzf antibody (1:100) at 4 C overnight after thoroughly mixing. After being washed with PBS, the fluorescentlabeled second antibody (1:100) was added for an incubation of 2 h at 4 C, washed again with PBS, re-suspended and detected by flow cytometry (FACSAria, Becton Dickinson) with blank and negative control groups. The experiments were conducted in triplicate.
Morphological observation showed that the dozens cells gathered to form typical colonies after 6–7 days culture. SSCs in culture showed unique morphologic appearance. They were round with large nuclei, high nuclear-to-cytoplasmic ratio (Fig. 1A). SSC colonies were positive for both Plzf and Oct4, while feeder cells (MEFs) were all negative (Fig. 1B,C). FACS results showed that more than 90% cultured cells were Plzf positive (Fig. 1D).
siRNA Transfection
BMP4 Promotes the SSC Differentiation
For sohlh2 knockdown, siRNA specific to mouse sohlh2 (GenBank accession no. NM-002467) was synthesized by Invitrogen Corporation (Invitrogen, Carlsbad). The siRNA oligonucleotide sequences were shown in Table 2. Sohlh2 siRNA and negative control siRNA were dissolved in nuclease-free water at 10 lM. SSCs were transfected with sohlh2 siRNA and negative control siRNA using LipofectamineTM 2000 (Invitrogen, Carlsbad) at a final concentration of 50 nM in accordance with the manufacturer’s instruction. At 5 hr posttransfection, cells were divided into four groups: siCon group, BMP4 1 siCon group, siSohlh2 group, BMP4 1 siSohlh2 group. After 48 hr culture, SSCs in four groups were collected to prepare mRNA for examination of gene expression.
To test the effects of BMP4 on the differentiation of mouse SSCs, SSCs in vitro culture were divided into three groups: Con group (no additives), BMP4 group (50 ng/mL BMP4), BMP4 1 inhibitor group (50 ng/mL BMP4 1 2 mM dorsomorphin). The expression levels of ckit and Plzf were assayed using immunofluorescent staining and qRT-PCR. The mRNA and protein expression of c-kit increased significantly, while Plzf decreased significantly after treatment with BMP4 for 48 and 168 hr, respectively (Fig. 2A–C). The results of immunofluorescent staining showed that expression of c-kit in the BMP4 group was significantly greater than either in the Con group or the BMP4 1 inhibitor group (P < 0.05), and c-kit positive cells were mainly observed in the periphery of SSC colonies (Fig. 2A,B). The expression of Plzf in the BMP4 group was significantly less than both the Con group and the BMP4 1 inhibitor group (P < 0.05), and that the Plzf positive cells were mainly located in the center of SSC colonies (Fig. 2A,B). There was no significant difference between the Con group and the BMP4 1 inhibitor group in either Plzf or c-kit expression. The qRT-PCR results showed that the mRNA expression of c-kit was significantly upregulated, while Plzf was significantly downregulated after treatment with BMP4 for 48 or 168 hr (Fig. 2C). The BMP4 signaling-specific inhibitor, dorsomorphin, abolished the effects of BMP4 on both the protein and mRNA expression of c-kit and Plzf.
Statistical Analysis Immunofluorescent intensity was measured using Image J Software. Each slide (n 5 3) was split into four equal-sized partitions. At least 10 immunostained SSC colonies in each partition were randomly selected to measure the gray values. The gray values were divides by the area of the colony. The intensity of immunostaining was reported as the mean of measured SSCs gray value minus background gray value. The background gray value was measured at a cell-free area of the slice.
RESULTS SSC Characterization
BMP4/SMAD SIGNALING IN THE SSC DIFFERENTIATION
753
Fig. 1. SSC characterization. (A) Dozens of SSCs formed typical colonies on the MEFs after 6–7 days culture. The cells in the colonies were positive for Plzf (B) and Oct4 immunostaining (C) Plzf and Oct4 were labeled with FITC (green) and cell nuclei were counterstained by DAPI (blue). Scale bars indicate 20 lm. (D) A representative FACS scatter plot showing Plzf positive cells (fraction II; 90.7%) and negative cells (fraction I; 5.2%). Nonspecific IgG served as a negative control.
BMP4 Functions Through the Smad Signaling Pathway and Upregulates the Expression of Sohlh2 in SSCs
sion was abolished by dorsomorphin, suggesting BMP4 promotes sohlh2 expression in SSCs.
Smad1/5/8, the signaling pathway of BMP4 in the SSC differentiation, were assayed using immunofluorescent staining and Western blotting. A significant increase of pSmad1/5/8 was observed in the BMP4 group when compared with the Con group (P < 0.05, Fig. 3A,B,D,E). Dorsomorphin repressed the increase in pSmad1/5/8 induced by BMP4 treatments. Thus, these results indicate that the effects of BMP4 on SSC activity are mediated by the Smad1/5/8. The mRNA and protein expression of sohlh2 were significantly upregulated in these culture conditions when 50ng/mL BMP4 was present for either 24 or 48 hr (P < 0.05, Fig. 3). The effects of BMP4 on Sohlh2 expres-
Sohlh2 Mediates SSC Differentiation Induced by BMP4/Smad Signaling Pathway To test whether BMP4/Smad pathway signals sohlh2 to induce SSC differentiation, the expression of sohlh2 was knocked down by siRNAs that specifically targeted the mouse sohlh2 mRNA. As shown in Figure 4A, sohlh2 mRNA expression in SSCs was significantly reduced (P < 0.05) in the sohlh2 siRNA transfected group compared to the negative control siRNA group, indicating sohlh2 gene expression was efficiently knocked down. Transfection with sohlh2 siRNA (2) reduced sohlh2 mRNA levels by 60%, so sohlh2 siRNA (2) was chosen for the
754
LI ET AL.
Fig. 2. BMP4 induces in vitro differentiation of SSCs. (A) Immunofluorescence analysis for c-kit and Plzf expression in three groups after 2 days culture. C-kit and Plzf were labeled with FITC (green) and cell nuclei were counterstained by DAPI (blue). Scale bars indicate 20 lm. (B) Semiquantitative analysis of the immunofluorescence results. (C) Quantitative real-time PCR analysis for c-kit and Plzf mRNA levels in three groups after 2 and 7 days culture. The expression level of Con group was set as 1 and compared with that of other groups.G3PDH
served as the internal control. The protein and mRNA levels of c-kit were significantly induced, while Plzf protein and mRNA levels were significantly reduced by the BMP4 treatments when compared with the Con group. BMP4 inhibitor, dorsomorphin, abolished the effects of BMP4 on the expression of c-kit and Plzf. Data are presented as mean 6 SD from three independent experiments. Statistically significant differences in comparison to the Con group are indicated by *P < 0.05 or **P < 0.01.
further experiments. Knockdown of sohlh2 expression increased Plzf-positive SSCs and blocked SSC differentiation induced by BMP4 (Fig. 4B–D). Sohlh2 knockdown induced Plzf and oct4 expression, while reduced c-kit and c-kit downstream gene (Dazl) expression (Fig. 4D), suggesting that sohlh2 plays an important role during SSC differentiation. Importantly, the stimulating effects of BMP4/Smad signaling pathway on c-kit and Dazl expression was significantly reduced in the BMP4 1 siSohlh2 group compared with the BMP4 1 siCon (Fig. 4D), suggesting that sohlh2 is required for c-kit upregulation stimulated by BMP4/Smad signaling pathway.
sis by regulating a series of cellular processes including cell proliferation, adhesion, migration, differentiation, and apoptosis (Fei and Chen, 2010; Haramis et al., 2004; Massague and Chen, 2000; Shi and Massague, 2003). It has been confirmed that this pathway has diverse functions in the different kinds of stem cells. It has been shown to promote self-renewal of mouse embryonic stem cells but repress proliferation of skin and intestinal stem cells (Haramis et al., 2004; He et al., 2004; Qi et al., 2004; Wagner, 2007; Ying et al., 2003; Zhang et al., 2013). BMP4 when added to cultures of SSCs reduces the maintenance of these stem cells, suggesting that this factor enhances stem cell differentiation (Nagano et al., 2003). In addition, BMP4 has been found to induce c-kit expression in c-kit negative spermatogonia (Pellegrini et al., 2003). It has been demonstrated that Bmp4 promotes rat SSC differentiation (Carlomaqno et al., 2010). Consistently, our results
DISCUSSION The BMP4 signaling pathway plays multiple critical roles during embryogenesis as well as in tissue homeosta-
BMP4/SMAD SIGNALING IN THE SSC DIFFERENTIATION
Fig. 3. BMP4 functions through the Smad signaling pathway and upregulates the expression of sohlh2 in SSCs. (A) Immunofluorescence analysis for pSmad1/5/8 and Sohlh2 expression in Con, BMP4, and BMP4 1 inhibitor groups. pSmad1/5/8 and Sohlh2 were labeled with FITC (green) and cell nuclei were counterstained by DAPI (blue). The nuclear levels of pSmad1/5/8 and Sohlh2 were higher in BMP4 group than that of Con group. Scale bars indicate 20 lm. (B) Semiquantitative analysis of the immunofluorescence results. The protein levels of pSmad1/5/8 and Sohlh2 were significantly upregulated by BMP treatment when compared with the Con group. (C) Quantitative real-time PCR analysis for sohlh2 mRNA levels in three groups. The expression level of Con group was set as 1 and compared with that of
755
other groups. G3PDH served as the internal control. The mRNA levels of sohlh2 were significantly induced by BMP4 treatment when compared with the Con group. BMP4 inhibitor, dorsomorphin, abolished the effects of BMP4 on Sohlh2 expression. (D) Western-blotting analysis for pSmad1/5/8, and Sohlh2 protein levels in three groups after 48 hr culture. b-actin was used as the loading control. (E) Semiquantitative densitometry analysis of Western-blotting results. b-actin served as the internal control. The expression of pSmad1/5/8 and Sohlh2 were significantly induced by BMP treatment when compared with the Con group. Data are presented as mean 6 SD from three independent experiments. Statistically significant differences in comparison to the Con group are indicated by *P < 0.05 or **P < 0.01.
756
LI ET AL.
Fig. 4. Sohlh2 mediates the SSC differentiation induced by BMP4 treatment. (A) Sohlh2 mRNA levels in SSCs were significantly reduced by sohlh2 specific siRNA but not by the negative control siRNA when compared with the control group. The transfection of sohlh2 siRNA (2) reduced sohlh2 mRNA levels in SSCs by 60%. (B) Immunofluorescence analysis for Plzf expression in four groups (1, siCon; 2, siSohlh2; 3, BMP4 1 siCon; 4, BMP4 1 siSohlh2). Plzf were labeled with FITC (green) and cell nuclei were counterstained by DAPI (blue). Scale bars indicate 20 lm. (C) Relative quantification of Plzf-positive cells in four groups. Knockdown of sohlh2 increased Plzf-positive SSCs and blocked
SSC differentiation induced by BMP4. (D) Quantitative real-time PCR analysis for sohlh2, c-kit, dazl, plzf, and oct4 mRNA levels in four groups (1, siCon; 2, siSohlh2; 3, BMP4 1 siCon; 4, BMP4 1 siSohlh2). The expression level of siCon group was set as 1 and compared with that of other groups, as well as the quantitative comparison among groups. G3PDH served as the internal control. Data are presented as mean 6 SD from three independent experiments. Statistically significant differences in comparison to the siCon group are indicated by *P < 0.05 or **P < 0.01. Black triangle indicates significant difference (P < 0.05) when the BMP4 1 siSohlh2 group compared with the BMP4 1 siCon group.
confirmed that exogenous BMP4 enhanced the differentiation of mouse SSCs in culture as illustrated by an upregulation of c-kit, and downregulation of Plzf. We also observed that BMP4 treatment resulted in greater sustained levels of intracellular pSmad1/5/8 when compared with the control group, suggesting that BMP4 activate Smad signaling pathway to induce SSC differentiation. It is consistent with other results that BMP4 increases the phosphorylation of Smad1/5/8 in rat SSCs and mouse spermatogonia (Carlomaqno et al., 2010; Pellegrini et al., 2003). We also found that dorsomorphin blocked BMP4-mediated Smad1/5/8 phosphorylation and SSC differentiation. Dorsomorphin selectively inhibits BMP Type I receptors (Yu et al., 2008; Zhou et al., 2001). These results indicate that BMP4 bind to receptors on SSCs to induce SSC differentiation directly. Sohlh2 plays a critical role in spermatogonial differentiation. The effects of Sohlh2 on SSC differentiation have not been reported. In this study, we demonstrated that sohlh2 in SSCs was upregulated by BMP4 at the mRNA and protein levels. Knockdown of sohlh2 increased SSC self-renewal and abolished SSC differen-
tiation induced by BMP4. Our results indicate sohlh2 may be a new target gene of the BMP4 signaling pathway and play a role in SSC differentiation. Further studies are necessary to address whether sohlh2 is the direct target gene of BMP4/Smad signaling pathway. The SCF/c-kit signaling pathway play a key role in the differentiation of Type A spermatogonia (Kierszenbaum, 2006; Ohta et al., 2003; Zhang et al., 2011). Recent studies have shown that c-kit is a direct target gene of sohlh2 (Barrios et al., 2012). The expression of ckit in spermatogonia is downregulated in sohlh2 – knockout mice (Hao et al., 2008; Suzuki et al., 2012; Toyoda et al., 2009). Sohlh2 can bind to the promoter region of c-kit to regulate its expression. In the present study, we found BMP4 promoted SSC differentiation possibly via upregulation of the expression of sohlh2 and ckit. Knockdown of sohlh2 by RNA interference repressed c-kit expression induced by BMP4. These results suggest that BMP4/Smad signaling pathway may function through sohlh2 to upregulate the expression of c-kit. In summary, the findings of this study demonstrated that activation of the BMP4/Smad signaling pathway
BMP4/SMAD SIGNALING IN THE SSC DIFFERENTIATION
promoted mouse SSC differentiation, possibly via upregulation of sohlh2 expression, thus contributing to its downstream gene expression of c-kit. Our results suggest that BMP4/Smad signaling pathway plays a critical role in controlling SSC differentiation. Identification of the effects of BMP4/Smad signaling on male infertility is worthy of investigation in the future studies.
LITERATURE CITED Aponte PM, van Bragt MP, de Rooij DG, et al. 2005. Spermatogonial stem cells: Characteristics and experimental possibilities. APMIS 113:727–742. Ballow DJ, Xin Y, Choi Y, et al. 2006. Sohlh2 is a germ cell-specific bHLH transcription factor. Gene Exp Pattern 6:1014–1018. Barrios F, Filipponi D, Campolo F, et al. 2012. SOHLH1 and SOHLH2 control kit expression during postnatal male germ cell development. J Cell Sci 125:1455–1464. Caires K, Broady J, McLean D. 2010. Maintaining the male germline: Regulation of spermatogonial stem cells. J Endocrinol 205:133–145. Carlomaqno G, van Braqt MP, Korver CM, et al. 2010. BMP4induced differentiation of a rat spermatogonial stem cell line causes changes in its cell adhesion properties. Biol Reprod. 83: 742–749. Chen D, Zhao M, Mundy GR. 2004. Bone morphogenetic proteins. Growth Factors 22:233–241. Fei T, Chen YG. 2010. Regulation of embryonic stem cell selfrenewal and differentiation by TGF-beta family signaling. Sci China Life Sci 53:497–503. Hao J, Yamamoto M, Richardson TE, et al. 2008. Sohlh2 knockout mice are male-sterile because of degeneration of differentiating type A spermatogonia. Stem Cells 26:1587–1597. Haramis AP, Begthel H, van den Born M, et al. 2004. De novo crypt formation and juvenile polyposis on BMP inhibition in mouse intestine. Science 303:1684–1686. He XC, Zhang J, Tong WG, et al. 2004. BMP signaling inhibits intestinal stem cell self-renewal through suppression of Wntcatenin signaling. Nat Genet 36:1117–1121. Hu J, Chen YX, Wang D, et al. 2004. Developmental expression and function of Bmp4 in spermatogenesis and in maintaining epididymal integrity. Dev Biol 276:158–171. Itman C, Loveland KL. 2008. SMAD expression in the testis: An insight into BMP regulation of spermatogenesis. Dev Dyn 237:97–111. Kanatsu-Shinohara M, Takehashi M, et al. 2008. Brief history, pitfalls, and prospects of mammalian spermatogonial stem cell research. Cold Spring Harb Symp Quant Biol 73:17–23. Kierszenbaum AL. 2006. Tyrosine protein kinases and spermatogenesis: Truncation matters. Mol Reprod Dev 73:399–403. Larsson J, Karlsson S. 2005. The role of Smad signaling in hematopoiesis. Oncogene 24:5676–5692.
757
Massague J, Chen YG. 2000. Controlling TGF-beta signaling. Genes Dev 14:627–644. Nagano M, Ryu BY, Brinster CJ, et al. 2003. Maintenance of mouse male germ line stem cells in vitro. Biol Reprod 68:2207–2214. Oatley JM, Avarbock MR, Telaranta AI, et al. 2006. Identifying genes important for spermatogonial stem cell self-renewal and survival. Proc Natl Acad Sci USA 103:9524–9529. Oatley JM, Brinster RL. 2012. The germline stem cell niche unit in mammalian testes. Physiol Rev 92:577–595. Oatley MJ, Racicot KE, Oatley JM. 2011. Sertoli cells dictate spermatogonial stem cell niches in the mouse testis. Biol Reprod 84: 639–645. Ohta H, Tohda A, Nishimune Y. 2003. Proliferation and differentiation of spermatogonial stem cells in the w/wv mutant mouse testis. Biol Reprod 69:1815–1821. Pellegrini M, Grimaldi P, Rossi P, et al. 2003. Developmental expression of BMP4/ALK3/SMAD5 signaling pathway in the mouse testis: A potential role of BMP4 in spermatogonia differentiation. J Cell Sci 116:3363–3372. Qi X, Li TG, Hao J, Hu J, et al. 2004. BMP4 supports self-renewal of embryonic stem cells by inhibiting mitogen-activated protein kinase pathways. Proc Natl Acad Sci USA 101:6027–6032. Schrans-Stassen BH, van de Kant HJ, de Rooij DG, et al. 1999. Differential expression of c-kit in mouse undifferentiated and differentiating type A spermatogonia. Endocrinology 140:5894–5900. Shi Y, Massague J. 2003. Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell 113:685–700. Singh SR, Burnicka-Turek O, Chauhan C, et al. 2011. Spermatogonial stem cells, infertility and testicular cancer. J Cell Mol Med 15:468–483. Suzuki H, Ahn HW, Chu T, et al. 2012. SOHLH1 and SOHLH2 coordinate spermatogonial differentiation. Dev Biol 361:301–312. Toyoda S, Miyazaki T, Miyazaki S, et al. 2009. Sohlh2 affects differentiation of KIT positive oocytes and spermatogonia. Dev Biol 325:238–248. Wagner TU. 2007. Bone morphogenetic protein signaling in stem cells—One signal, many consequences. FEBS J 274:2968–2976. Ying QL, Nichols J, Chambers I, et al. 2003. BMP induction of Id proteins suppresses differentiation and sustains embryonic stem cell self-renewal in collaboration with STAT3. Cell 115:281–292. Yu PB, Hong CC, Sachidanandan C, et al. 2008. Dorsomorphin inhibits BMP signals required for embryogenesis and iron metabolism. Nat Chem Biol 4:33–41. Zhang J, Fei T, Li Z, et al. 2013. BMP induces Cochlin expression to facilitate self-renewal and suppress neural differentiation of mouse embryonic stem cells. J Biol Chem 288:8053–8060. Zhang L, Tang J, Haines CJ, et al. 2011. c-kit and its related genes in spermatogonial differentiation. Spermatogenesis 1:186–194. Zhou G, Myers R, Li Y, et al. 2001. Role of AMP-activated protein kinase in mechanism of metformin action. J Clin Invest 108: 1167–1174.
