Chapter 16 Small RNA Library Construction for High-Throughput Sequencing Jon McGinn and Benjamin Czech Abstract Since their discovery about 20 years ago, small RNAs have been shown to play a critical role in a myriad of biological processes. The greater availability of high-throughput sequencing has been invaluable to furthering our understanding of small RNAs as regulatory molecules. In particular, these sequencing technologies have been crucial in understanding the role of small RNAs in reproductive tissues, where millions of individual sequences are generated. In this context, high-throughput sequencing provides the requisite level of resolution that other procedures, like northern blotting, would not be able to achieve. Here, we describe a protocol for the preparation of small RNA libraries for sequencing using the Solexa/ Illumina technology. Key words Endo-siRNA, miRNAs, piRNAs, Small RNA libraries, Cloning, High-throughput sequencing

1

Introduction Eukaryotes utilize small RNAs to control a variety of biological processes ranging from gene regulation to guarding the genome from viruses and transposons. Nearly 20 years ago, evidence of a regulatory small RNA, lin-4, was uncovered [1, 2]. In the early 2000s, several novel small RNAs were identified [3–5], with multiple papers published describing new types of small RNAs since then. Differences in size, biogenesis, and Argonaute protein binding partners divide these small RNAs into three major classes: microRNAs, small interfering RNAs (siRNAs), and Piwi-interacting RNAs (piRNAs). High-throughput sequencing has proven to be a powerful tool in profiling the entire repertoire of small RNAs in a tissue- or cellspecific context. This technology has been especially useful in reproductive tissues where small RNA populations are extremely complex and has significantly contributed to our understanding of piRNAs as a distinct class of small RNA [6–13]. The protocol described here is for the preparation of small RNA libraries for

Mikiko C. Siomi (ed.), PIWI-Interacting RNAs: Methods and Protocols, Methods in Molecular Biology, vol. 1093, DOI 10.1007/978-1-62703-694-8_16, © Springer Science+Business Media, LLC 2014

195

196

Jon McGinn and Benjamin Czech

sequencing using Solexa/Illumina technology (with 5′ monophosphate and 3′ hydroxyl groups), with modifications to previously reported protocols [4, 14, 15]. While other protocols and kits are available, this protocol describes a cost-effective and easily adaptable method for cloning small RNAs. The protocol can be modified for use on other sequencing platforms (e.g., SOLiD from ABI or 454 from Roche) by substituting the appropriate oligonucleotides and can be used for multiplexed sequencing by adding barcoding primers. It can also be adjusted to enrich for other classes of small RNA by including steps that create the proper termini.

2

Materials RNase contamination could lead to failure of the protocol, therefore it is highly recommended to designate a clean working area and separate reagents to be used only when working with RNA. Also, be sure to follow the proper practices for work with radioactive materials (i.e., wearing the appropriate safety gear, waste disposal, etc.). General equipment, like a vortexer, pipets, tips, or centrifuges, is not listed. Materials used in several steps are only listed once. Materials and reagents can be stored at room temperature unless otherwise specified. The sequences of oligonucleotides are listed in Table 1.

2.1 Preparation of Ladder and Size Selection Markers

1. RNase-free 1.7-mL siliconized low-retention microcentrifuge tubes. 2. Nuclease-free water.

Table 1 Oligonucleotides for library preparation Name

Sequence (5′ → 3′)

oLig3

/5rApp/CTGTAGGCACCATCAAT/3ddC/

oLig5

rArCrArCrUrCrUrUrUrCrCrCrUrArCrArCrGrArCrGrCrUrCrUrUrCrCrGrArUrC

oPCR3

CAAGCAGAAGACGGCATACGATTGATGGTGCCTACAG

oPCR5

AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACG

o19M

rCrGrUrArCrGrGrUrUrUrArArArCrUrUrCrGrA

o24M

rCrGrUrArCrGrGrUrUrUrArArArCrUrUrCrGrArArArUrGrU

o28M

rCrGrUrArCrGrArUrCrCrGrUrUrUrArArArCrCrArUrUrGrUrUrCrArA

Nucleotides are DNA unless preceded by an “r”, which indicates RNA. “oLig3” is a custom oligonucleotide that is preadenylated at the 5′ terminus and blocked at the 3′ terminus by a di-deoxy base (available through Integrated DNA Technology (IDT) under “miRNA cloning linker 1”). All oligonucleotides should be HPLC purified and stored at −20 °C. Underlined sequences correspond to PmeI restriction sites

Small RNA Library Construction for High-Throughput Sequencing

197

3. Decade Markers with 10× cleavage reagent (Ambion). Store at −20 °C. 4. [γ-32P]-ATP (6,000 Ci/mmol). 5. T4 Polynucleotide Kinase (PNK) (10,000 U/mL) with 10× T4 PNK Reaction buffer. Store at −20 °C. 6. RNA oligonucleotides o19M and o28M (each at 10 μM) (see Note 1). 7. Illustra MicroSpin G-25 Columns (GE Healthcare Life Sciences). 8. 0.1 mM ethylenediaminetetraacetic acid (0.1 mM EDTA). 2.2 Size Selection of Small RNAs and Gel Purification

1. SE400 Sturdier Vertical Electrophoresis Unit, 18 × 16 cm with 1-mm and 0.75-mm thick spacers, and 1-mm and 0.75-mm thick 15-well combs (Hoefer). Other polyacrylamide gel electrophoresis systems can be used. 2. UreaGel system (National Diagnostics). Other urea-containing, TBE-based gels (19:1 acrylamide:bisacrylamide) can be used. 3. 50 mL Falcon tubes. 4. 10 % ammonium persulfate (10 % APS). Store at 4 °C for up to 6 weeks. 5. N,N,N′,N′-tetramethylethylenediamine (TEMED). 6. 1× TBE (Tris/Borate/EDTA) electrophoresis buffer. 7. Syringe with a 22-gauge 1-in. needle. 8. 2× gel loading buffer (formamide-based with xylene cyanol and bromophenol blue). 9. RNase-free 200 μL gel loading tips. 10. Whatman 3MM Chr paper (GE Healthcare). 11. Adhesive tape. 12. Plastic wrap (Saran). 13. Phosphor screen and phosphorimager to visualize radiolabeled nucleic acids. 14. Printer. 15. Razor blades or scalpels. 16. 400 mM sodium chloride (400 mM NaCl).

2.3 Cleanup of Small RNA Samples

1. Micropore 0.22 μm filter microcentrifuge tubes (Ultrafree-MC; Millipore). 2. GlycoBlue (15 mg/mL dyed glycogen; Ambion). Store at −20 °C. 3. 100 % ethanol. 4. 80 % ethanol.

198

Jon McGinn and Benjamin Czech

2.4 Ligation of 3′ Linker and Gel Purification of Ligated Product

1. oLig3 oligonucleotide (100 μM). 2. Dimethylsulfoxide (DMSO), molecular biology grade. 3. Recombinant RNasin Ribonuclease Inhibitor (40 U/μL; Promega). Store at −20 °C. 4. T4 RNA Ligase 2, truncated K227Q (200,000 U/mL) with 10× T4 RNA Ligase Reaction Buffer, ATP-free (New England BioLabs). Store at −20 °C. Other truncated versions of T4 RNA ligase (from other vendors or homemade) can be used.

2.5 Ligation of 5′ Linker and Gel Purification of Ligated Product

1. oLig5 oligonucleotide (100 μM).

2.6 Reverse Transcription

1. PCR thermal cycler.

2. T4 RNA Ligase (5 U/μL) with 10× T4 RNA Ligase Buffer (Ambion). Store at −20 °C.

2. RNase-free 0.2 mL PCR tubes. 3. oPCR3 primer (100 μM). 4. dNTP mix (10 mM each). Store at −20 °C. 5. SuperScript III Reverse Transcriptase (200 U/μL) with 0.1 M DTT and 5× First-Strand Buffer (Invitrogen). Store at −20 °C.

2.7 PCR Amplification of cDNA

1. oPCR5 primer (100 μM). 2. oPCR3 primer (100 μM). 3. KOD Hot Start DNA Polymerase (1 U/μL) with 10× PCR Buffer, dNTP mix (2 mM each), and 25 mM MgSO4 (EMD/ Novagen). Store at −20 °C. 4. 3 M sodium acetate, pH 4.8 (3 M NaOAc, pH 4.8).

2.8 PmeI Digest and Gel Purification of Amplified cDNA

1. Restriction enzyme PmeI (10,000 U/mL) with 100× BSA and 10× NEBuffer 4 (New England BioLabs). Store at −20 °C. 2. Agarose for DNA recovery. 3. 1× TAE (Tris/Acetate/EDTA) electrophoresis buffer. 4. Ethidium bromide (EtBr) solution (10 mg/mL). Store protected from light. 5. GeneRuler 50 bp DNA Ladder supplied with 6× DNA loading dye (Fermentas). Other 6× loading dyes can be used. Store at 4 °C. 6. Long-wave UV transilluminator. 7. Wizard SV Gel and PCR Clean-up System (Promega). Gel purification kits from other vendors can be used. 8. NanoDrop or other spectrophotometer.

Small RNA Library Construction for High-Throughput Sequencing

3

199

Methods This protocol is used to clone small RNAs with 5′ monophosphate and 3′ hydroxyl groups, similar to other reported protocols [4, 14, 15]. Using a truncated version of T4 RNA ligase 2, small RNAs with 2′-O-methyl groups (like Drosophila endo-siRNAs and piRNAs) can be cloned with efficiencies similar to non-modified RNAs (like miRNAs) [16]. To clone small RNAs with other modifications (e.g., 5′ triphosphate or 3′ phosphate), the starting material can be treated with appropriate enzymes to convert their termini to 5′ monophosphate and 3′ hydroxyl groups. In this protocol (see Fig. 1a), small RNAs of the desired size range are first isolated. Then, the 3′ adapter is ligated to the RNA and the ligation products are purified. The 5′ adapter is ligated next, and the RNA is gel purified again. The RNA is then converted to cDNA by reverse transcription, which then serves as a template for PCR amplification. The size selection markers are removed by PmeI restriction digest (see Note 1), and the library preparation is completed by agarose gel extraction. It is recommended to clone up to eight libraries per gel using a 15-well comb and running samples in every other lane to avoid crosscontamination. If more than eight libraries must be prepared in parallel, it is recommended to use multiple gels to safely accommodate all samples separated by a free or ladder lane. While this protocol is intended for constructing individual libraries, it can easily be adapted for multiplexed sequencing (see Note 2). For the best results, take the necessary precautions to minimize the risk of RNase contamination. Carry out all incubations at room temperature unless otherwise specified.

3.1 Preparation of Ladder and Size Selection Markers

1. Prepare the RNA ladder (Decade Markers) according to the manufacturer’s instructions. Set up the following reaction: 6 μL of nuclease-free water, 1 μL of 10× kinase reaction buffer, 1 μL [γ-32P]-ATP (6,000 Ci/mmol), 1 μL of Decade Marker RNA (100 ng), and 1 μL of T4 polynucleotide kinase in a nuclease-free microcentrifuge tube. Briefly mix and incubate for 1 h at 37 °C. Then add 8 μL of nuclease-free water and 2 μL of 10× cleavage reagent. Incubate for 5 min at room temperature. Then dilute by adding 30 μL of nuclease-free water and 50 μL of 2× gel loading buffer. 2. To prepare the RNA size selection markers (see Note 1), set up the following labeling reaction for the o19M and o28M oligonucleotides in separate nuclease-free microcentrifuge tubes: 14 μL of nuclease-free water, 0.5 μL of 10 μM RNA oligonucleotide (o19M or o28M from Table 1), 2 μL of 10× PNK buffer, 2.5 μL of [γ-32P]-ATP (6,000 Ci/mmol), and 1 μL of PNK.

200

Jon McGinn and Benjamin Czech

Fig. 1 Schematic overview of cloning strategy. (a) Small RNAs are size selected using cloning size selection markers. Extracted small RNAs are ligated with the 3′ linker and the appropriately sized fragments are gel purified. Following 5′ ligation, the appropriately sized fragments are again purified using denaturing PAGE. Properly ligated small RNAs are reverse transcribed and PCR amplified. The cloning size selection markers are removed by PmeI restriction digest followed by agarose gel purification to yield the sequencing-ready small RNA library. (b) Scheme of PAGE for size selection (left), selection of correct fragments following the 3′ ligation (middle), and selection of correct fragments following the 5′ ligation (right) are shown. A fraction of small RNAs does not ligate as indicated

3. Mix and incubate the reactions for 1 h at 37 °C, then heatinactivate the enzyme by incubation at 65 °C for 20 min. 4. Remove unincorporated radiolabeled nucleotides using illustra MicroSpin G-25 columns according to the manufacturer’s

Small RNA Library Construction for High-Throughput Sequencing

201

instructions. In brief, resuspend beads by vortexing, then centrifuge the G-25 columns in the provided collection tubes at 735 × g for 1 min. Discard the collection tubes and transfer the G-25 columns to clean microcentrifuge tubes. Add 30 μL of 0.1 mM EDTA to each heat-inactivated sample. Apply mixture to pre-processed G-25 column and centrifuge at 735 × g for 2 min. The eluate contains radiolabeled markers. 5. Add one volume of 2× gel loading buffer to each labeled size marker. 6. Optional: to ensure the quality of the ladder and size selection markers, run them on a 10 % denaturing polyacrylamide gel using the UreaGel system (see step 2 in Subheading 3.4 for instructions). 3.2 Size Selection of Small RNAs and Gel Purification

1. Start with 10 μg of total RNA for each sample (see Note 3). 2. Mix each RNA sample with one volume of 2× gel loading buffer. Add 0.25 μL of each radiolabeled size marker (typically ~10,000 counts per minute of each size marker) from step 5 in Subheading 3.1 to each sample. Dilute 2 μL of radioactive ladder in 40 μL 1× gel loading buffer. 3. Prepare a 1-mm thick, 12 % denaturing polyacrylamide gel using the UreaGel system according to the manufacturer’s instructions. In brief, clean glass plates, spacers, and comb with water and ethanol, then assemble accordingly. For 50 mL of gel, mix 24 mL of concentrate, 21 mL of diluent, and 5 mL of 10× buffer (all included in the UreaGel system) in a Falcon tube. To start the polymerization reaction, add 400 μL of 10 % APS and 20 μL of TEMED, mix and immediately cast the gel. Insert the comb and allow the gel to polymerize for approximately 30 min. Once polymerized, carefully remove the comb and assemble the gel apparatus for running using 1× TBE running buffer. Make sure to rinse the wells using a syringe to remove residual urea. Pre-run the gel at 400 V for ~30 min. 4. Denature the samples and ladder (from step 2 in Subheading 3.2) by heating for 2 min at 95 °C, and then immediately transfer to ice for 2 min. Briefly centrifuge to collect the sample at the bottom of the tube. 5. Following the pre-run, rinse the wells again using a syringe. Immediately load the samples and ladder using gel loading tips. Run the gel at 400 V until the bromophenol blue dye reaches bottom of the gel (~2 h). 6. Disassemble the gel apparatus, while keeping the gel on one glass plate. 7. Pipet 0.25 μL of radioactive ladder onto four small pieces of Whatman paper. Use adhesive tape to attach the radioactive paper pieces onto the edges of the glass plate. Carefully cover the gel and glass plate with plastic wrap.

202

Jon McGinn and Benjamin Czech

8. Expose the gel to a phosphor screen for approximately 5 min (time depends on the amount of radioactivity used), and then scan the image with a phosphorimager and print the gel image (select actual size or 1:1 scale). 9. Place the printout under the glass plate and use the radioactive Whatman paper pieces to properly align the gel and printout. 10. For each sample, precisely excise the desired gel fragment (19– 28 nt for fly piRNAs) including the size markers using a fresh scalpel or razor blade (see Fig. 1b, left). Make sure to remove the plastic wrap from the gel slice, and then transfer the gel slice to a low-retention microcentrifuge tube. Add 425 μL of 400 mM NaCl, and elute overnight (at least 8 h) with agitation (see Note 4). 11. Re-expose the gel to confirm that the fragments were excised correctly. 3.3 Cleanup of Small RNA Samples

1. Centrifuge the samples for 1 min at 20,000 × g and transfer the supernatant of each sample to a Micropore 0.22 μm filter microcentrifuge tube (see Note 5). Then, centrifuge the samples for 2 min at 13,000 × g. For each sample, transfer the flowthrough containing the eluted RNAs to a low-retention microcentrifuge tube, and add 1.2 mL of 100 % ethanol and 1 μL of GlycoBlue. Incubate the samples at −20 °C for at least 2 h. 2. Precipitate the samples by centrifugation for 30 min at 20,000 × g at 4 °C. Wash each pellet with 500 μL of ice-cold 80 % ethanol by centrifugation for 5 min at 20,000 × g at 4 °C. Discard the supernatant and air-dry each pellet for 5 min. Resuspend the RNA pellets in 12 μL nuclease-free water by gently flicking each tube several times (do not pipet up and down as pellets are easily lost).

3.4 Ligation of 3 ′ Linker and Gel Purification of Ligation Product

1. Mix the size selected small RNAs with 2 μL of DMSO, 2 μL of 10× ATP-free T4 RNA ligase buffer, 1 μL of RNase Inhibitor, 1 μL of 100 μM oLig3 linker (Table 1), and 2 μL of T4 RNA ligase 2, truncated K227Q (see Note 6). Briefly centrifuge to collect the sample at the bottom of the tube. Incubate the reaction at room temperature for 2 h (optional: incubate overnight at 16 °C). 2. Prepare a 0.75-mm thick, 10 % denaturing polyacrylamide gel using the UreaGel system. For 50 mL of gel, mix 20 mL of concentrate, 25 mL of diluent, and 5 mL of 10× buffer (all included in the UreaGel system) in a Falcon tube. Add 400 μL of 10 % APS and 20 μL of TEMED, mix and immediately cast the gel. Once polymerized, clean each well and pre-run the gel as previously described in step 3 in Subheading 3.2.

Small RNA Library Construction for High-Throughput Sequencing

203

3. Dilute 1 μL of radioactive ladder in 40 μL 1× gel loading buffer. Add one volume of 2× gel loading buffer to each sample. Next, denature the 3′-ligated small RNAs and ladder by heating for 2 min at 95 °C, and then immediately cool on ice for 2 min. Briefly centrifuge to collect the sample at the bottom of the tube. 4. Following the pre-run, rinse the wells again using a syringe. Immediately load the samples and ladder using gel loading tips. Run the gel at 400 V until the bromophenol blue dye travels three-quarters of the length of the gel (~1.5 h). 5. Disassemble the gel apparatus, while keeping the gel on one glass plate. 6. Pipet 0.25 μL of radioactive ladder onto four small pieces of Whatman paper. Use adhesive tape to attach the radioactive paper pieces onto the edges of the glass plate. Carefully cover the gel and glass plate with plastic wrap. 7. Expose the gel to a phosphor screen for approximately 10 min (time depends on the amount of radioactivity used), and then scan the image with a phosphorimager and print the gel image (select actual size or 1:1 scale). 8. Place the printout under the glass plate and use the radioactive Whatman paper pieces to properly align the gel and printout. 9. For each sample, precisely excise the desired gel fragment (37– 46 nt for fly piRNAs) including the size markers using a fresh scalpel or razor blade (see Fig. 1b, middle). Make sure to remove the plastic wrap from the gel slice, and then transfer the gel slice into a low-retention microcentrifuge tube. Add 425 μL of 400 mM NaCl, and elute overnight (at least 8 h) with agitation (see Note 4). 10. Re-expose the gel to confirm that the fragments were excised correctly. 11. Cleanup the RNA samples using the instructions from Subheading 3.3. 3.5 Ligation of 5 ′ Linker and Gel Purification of Ligation Product

1. Mix the 3′-ligated small RNAs (12 μL) with 2 μL of DMSO, 2 μL of 10× T4 RNA ligase buffer, 1 μL of RNase inhibitor, 1 μL of 100 μM oLig5 linker (Table 1), and 2 μL of T4 RNA ligase (see Note 6). Briefly centrifuge to collect the sample at the bottom of the tube. Incubate the reaction at 37 °C for 2 h. 2. Prepare a 0.75-mm thick, 8 % denaturing polyacrylamide gel using the UreaGel system. For 50 mL of gel, mix 16 mL of concentrate, 29 mL of diluent, and 5 mL of 10× buffer (all included in the UreaGel system) in a Falcon tube. Add 400 μL of 10 % APS and 20 μL of TEMED, mix and immediately cast the gel. Once polymerized, clean each well and pre-run the gel as previously described in step 3 in Subheading 3.2.

204

Jon McGinn and Benjamin Czech

3. Dilute 0.5 μL of radioactive ladder in 40 μL 1× gel loading buffer and add one volume of 2× gel loading buffer to each sample. Next, denature the RNA samples and ladder by heating for 2 min at 95 °C, and then cool on ice for 2 min. Briefly centrifuge to collect the sample at the bottom of the tube. 4. Following the pre-run, rinse the wells again using a syringe. Immediately load the samples and ladder using gel loading tips. Run the gel at 400 V until the bromophenol blue dye travels three-quarters of the length of the gel (~1 h). 5. Disassemble the gel apparatus, while keeping the gel on one glass plate. 6. Pipet 0.25 μL of radioactive ladder onto four small pieces of Whatman paper. Use adhesive tape to attach the radioactive paper pieces onto the edges of the glass plate. Carefully cover the gel and glass plate with plastic wrap. 7. Expose the gel to a phosphor screen for approximately 20 min (time depends on amount of radioactivity used), and then scan the image with a phosphorimager and print the gel image (select actual size or 1:1 scale). 8. Place the printout under the glass plate and use the radioactive Whatman paper pieces to properly align the gel and printout. 9. For each sample, precisely excise the desired gel fragment (69– 78 nt for fly piRNAs) including the size markers using a fresh scalpel or razor blade (see Fig. 1b, right). Make sure to remove the plastic wrap from the gel slice, and then transfer the gel slice into a low-retention microcentrifuge tube. Add 425 μL of 400 mM NaCl, and elute overnight (at least 8 h) with agitation (see Note 4). 10. Re-expose the gel to confirm that the fragments were excised correctly. 11. Cleanup the RNA samples using the instructions from Subheading 3.3, but resuspend the pellet with 11 μL of nuclease-free water. 3.6 Reverse Transcription

1. Mix 11 μL of ligated RNAs, 1 μL of 10 mM dNTP mix, and 1 μL of 100 μM oPCR3 primer (Table 1) in a PCR tube. 2. Incubate for 3 min at 65 °C, then immediately transfer the reaction mixture to ice for 5 min. 3. Add 4 μL of 5× First-Strand Buffer, 1 μL of 0.1 M DTT, 1 μL of RNase inhibitor, and 1 μL of SuperScript III reverse transcriptase to the mixture. 4. Mix and briefly centrifuge to collect the sample at the bottom of the tube. 5. Incubate for 60 min at 50 °C, then at 70 °C for 15 min, then at 4 °C until use in the next step.

Small RNA Library Construction for High-Throughput Sequencing

3.7 PCR Amplification of cDNA

205

1. Set up a reaction mixture with a total volume of 100 μL in a PCR tube containing 2.5 μL of cDNA (from Subheading 3.6), 1 μL of 100 μM oPCR5 (Table 1), 1 μL of 100 μM oPCR3 (Table 1), 10 μL of 10× PCR buffer, 10 μL of 2 mM dNTP mix, 6 μL of MgSO4 (25 mM), 1 μL of KOD Polymerase, and 68.5 μL of nuclease-free water. 2. Mix and briefly centrifuge to collect the sample at the bottom of the tube. 3. Place the tubes in a thermal cycler and run the following PCR program: 95 °C for 2 min followed by five cycles of: 95 °C for 15 s 54 °C for 30 s 72 °C for 15 s Run an additional 17 cycles of (see Note 7): 95 °C for 15 s 60 °C for 30 s 72 °C for 15 s followed by: 72 °C for 2 min 4 °C forever 4. Transfer the PCR mixture to a microcentrifuge tube, add 170 μL of nuclease-free water, 30 μL of 3 M NaOAc (pH 4.8), and three volumes of 100 % ethanol (900 μL), and mix. 5. Incubate at −20 °C for 30 min. 6. Centrifuge at 20,000 × g for 30 min at 4 °C. 7. Decant supernatant and wash pellet with 500 μL of ice-cold 80 % ethanol. 8. Remove all ethanol, air-dry pellet, and then resuspend the pellet in 23.7 μL of nuclease-free water.

3.8 PmeI Digest and Gel Purification of Amplified cDNA

1. Set up a 30 μL restriction digest by mixing 23.7 μL of DNA (from step 8 in Subheading 3.7) with 3 μL of 10× NEBuffer 4, 0.3 μL of BSA, and 3 μL of PmeI restriction enzyme. 2. Mix and briefly centrifuge to collect the sample at the bottom of the tube. 3. Incubate for 3 h at 37 °C. 4. Mix each sample with 6 μL of 6× DNA loading dye. 5. Prepare a 2 % TAE agarose gel containing 500 ng/mL of EtBr. 6. Load all samples (in every other lane to avoid crosscontamination) and 5 μL of 50 bp ladder. 7. Run the gel at constant 100 V for ~45 min.

206

Jon McGinn and Benjamin Czech

8. View the gel with a long-wave UV source. Excise the correct DNA band (~108–117 nt when starting with 19–28 nt sized small RNAs) with a clean razor blade or scalpel and transfer the gel slice to a microcentrifuge tube. To avoid contamination, use a fresh razor blade or scalpel for each sample. 9. Cleanup the sample using Promega PCR purification kit according to the manufacturer’s instructions. Elute each library with 30 μL nuclease-free water. 9. Measure the DNA concentration by NanoDrop or another suitable spectrophotometer. 10. Dilute the samples to 10 nM and sequence on the appropriate platform (see Note 2) or store at −20 °C.

4

Notes 1. The length of the RNA size selection markers can be varied depending on the desired cloning range. For libraries comprised of Drosophila piRNAs, typically 19- and 28 nt size markers are used. As murine piRNAs are slightly longer, a cloning range of 19–33 nt is recommended. For miRNA libraries, size selection of 19–24 nt is appropriate. Important: Oligonucleotides must contain a PmeI recognition sequence for later removal of converted cloning markers. While we use PmeI in this protocol, it is also possible to substitute other restriction endonucleases (preferentially 8-base cutters) and make the necessary adjustments in the sequences of the size selection markers. It is recommended to use an octanucleotide-recognizing restriction endonuclease to minimize degradation of the small RNA pools within the library. 2. As sequencing technologies improve and provide more reads per run, the protocol can easily be adapted for multiplexing using custom or Illumina-provided adapters and barcoding primers. 3. Several protocols exist to obtain total RNAs (e.g., TRIzol reagent; Invitrogen). Other methods that extract small RNAs (e.g., mirVANA; Ambion) can be used as well. It is also possible to use RNAs from immunoprecipitates (e.g., immunoprecipitation of Aubergine-bound piRNAs) as starting material. However, most column-based kits remove RNAs smaller than 200 bp and are therefore not suitable for small RNA cloning. RNA concentration should be determined using a NanoDrop or another suitable spectrophotometer. Ensure the highest possible quality of the RNA starting material by Bioanalyzer (Agilent) or PAGE stained with EtBr. Optionally, rRNAs (especially Drosophila 2S rRNA) can be depleted by several available kits or other reported methods (e.g., RNaseH digest) prior to size selection or before 3′ ligation.

Small RNA Library Construction for High-Throughput Sequencing

207

4. Use of dializers for fragment recovery instead of overnight elution is possible. In brief, insert the gel slice and 450 μL of RNase-free water into a dialyzer tube (D-Tube Dialyzer Midi, MWCO 3.5 kDa; Novagen). Position the dialyzer in an appropriate gel box, and add 1× TAE to allow current flow. Run for 18 min at 100 V, then reverse the poles and run for 2 min to pull samples off the dialysis tubing walls. Transfer all RNasefree water (containing the eluted RNAs) from the dialyzer tube to a fresh RNase-free microcentrifuge tube. Add 1 μL GlycoBlue and 3 volumes of 100 % ethanol. Mix and incubate at −20 °C for at least 2 h. Continue the precipitation as described above (spin, wash, and resuspend). 5. It is recommended to save the gel pieces after transferring the supernatant to a spin column in case of failure or loss of the sample. Store gel slices at −20 °C. To recover RNA from the gel slices, add 425 μL of 400 mM NaCl and incubate at room temperature with agitation for at least 8 h. Then follow the steps outlined in Subheading 3.3 to clean up the samples. 6. T4 RNA ligase 2, truncated K227Q is optimized to ligate the pre-adenylated 5′ terminus of a nucleic acid (RNA or DNA; here the oLig3 linker) with the 3′ hydroxyl terminus of a small RNA (regardless of the presence of additional 3′ end modifications like 2′-O-methyl groups) [15, 16]. In contrast, T4 RNA ligase catalyzes the formation of a phosphodiester bond using a 5′ mono-phosphorylated RNA and a nucleic acid with 3′ hydroxyl end as templates [17]. 7. The appropriate number of cycles varies depending on the starting material and loss during the cloning procedure. To avoid over-amplification, it is recommended to use the fewest number of cycles possible.

Acknowledgments We thank past and current members of the Hannon laboratory that helped improve this protocol, especially Alexei Aravin, Julius Brennecke, and Colin Malone. References 1. Lee RC, Feinbaum RL, Ambros V (1993) The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75:843–854 2. Wightman B, Ha I, Ruvkun G (1993) Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell 75:855–862

3. Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T (2001) Identification of novel genes coding for small expressed RNAs. Science 294:853–858 4. Lau NC, Lim LP, Weinstein EG, Bartel DP (2001) An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294:858–862

208

Jon McGinn and Benjamin Czech

5. Lee RC, Ambros V (2001) An extensive class of small RNAs in Caenorhabditis elegans. Science 294:862–864 6. Aravin A et al (2006) A novel class of small RNAs bind to MILI protein in mouse testes. Nature 442:203–207 7. Girard A, Sachidanandam R, Hannon GJ, Carmell MA (2006) A germline-specific class of small RNAs binds mammalian Piwi proteins. Nature 442:199–202 8. Grivna ST, Beyret E, Wang Z, Lin H (2006) A novel class of small RNAs in mouse spermatogenic cells. Genes Dev 20:1709–1714 9. Lau NC et al (2006) Characterization of the piRNA complex from rat testes. Science 313:363–367 10. Ruby JG et al (2006) Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans. Cell 127:1193–1207 11. Brennecke J et al (2007) Discrete small RNAgenerating loci as master regulators of transposon activity in Drosophila. Cell 128:1089–1103

12. Gunawardane LS et al (2007) A slicer-mediated mechanism for repeat-associated siRNA 5′ end formation in Drosophila. Science 315: 1587–1590 13. Houwing S et al (2007) A role for Piwi and piRNAs in germ cell maintenance and transposon silencing in Zebrafish. Cell 129:69–82 14. Pfeffer S, Lagos-Quintana M, Tuschl T (2005) Cloning of small RNA molecules. Curr Protoc Mol Biol Chapter 26, Unit 26.4, edited by Frederick M. Ausubel … [et al.] 15. Hafner M et al (2008) Identification of microRNAs and other small regulatory RNAs using cDNA library sequencing. Methods 44:3–12 16. Zhuang F, Fuchs RT, Robb GB (2012) Small RNA expression profiling by high-throughput sequencing: implications of enzymatic manipulation. J Nucleic Acids 2012:360358 17. Silber R, Malathi VG, Hurwitz J (1972) Purification and properties of bacteriophage T4-induced RNA ligase. Proc Natl Acad Sci U S A 69:3009–3013