Virus Research 208 (2015) 30–38

Contents lists available at ScienceDirect

Virus Research journal homepage: www.elsevier.com/locate/virusres

Small RNA profiles of wild-type and silencing suppressor-deficient tomato spotted wilt virus infected Nicotiana benthamiana Paolo Margaria a,b,1 , Laura Miozzi a,1 , Cristina Rosa b , Michael J. Axtell c , Hanu R. Pappu d , Massimo Turina a,∗ a

Istituto per la Protezione Sostenibile delle Piante, CNR, Strada delle Cacce 73, 10135 Torino, Italy Department of Plant Pathology and Environmental Microbiology, Pennsylvania State University, University Park, PA 16802, USA c Department of Biology, and The Huck Institutes of the Life Sciences, Pennsylvania State University, University Park, PA 16802, USA d Department of Plant Pathology, Washington State University, PO Box 646430, Pullman, WA 99164, USA b

a r t i c l e

i n f o

Article history: Received 9 March 2015 Received in revised form 25 May 2015 Accepted 25 May 2015 Available online 3 June 2015 Keywords: Tospovirus RNA interference Silencing suppressor

a b s t r a c t Tospoviruses are plant-infecting viruses belonging to the family Bunyaviridae. We used a collection of wild-type, phylogenetically distinct tomato spotted wilt virus isolates and related silencing-suppressor defective mutants to study the effects on the small RNA (sRNA) accumulation during infection of Nicotiana benthamiana. Our data showed that absence of a functional silencing suppressor determined a marked increase of the total amount of viral sRNAs (vsRNAs), and specifically of the 21 nt class. We observed a common under-representation of vsRNAs mapping to the intergenic region of S and M genomic segments, and preferential mapping of the reads against the viral sense open reading frames, with the exception of the NSs gene. The NSs-mutant strains showed enrichment of NSm-derived vsRNA compared to the expected amount based on gene size. Analysis of 5 terminal nucleotide preference evidenced a significant enrichment in U for the 21 nt- and in A for 24 nt-long endogenous sRNAs in all the samples. Hotspot analysis revealed a common abundant accumulation of reads at the 5 end of the L segment, mostly in the antiviral sense, for the NSs-defective isolates, suggesting that absence of the silencing suppressor can influence preferential targeting of the viral genome. © 2015 Elsevier B.V. All rights reserved.

1. Introduction Tospoviruses (genus Tospovirus) are the only plant-infecting viruses in the family Bunyaviridae (King et al., 2012). Annual losses due to tospovirus infections are estimated to be over $1 billion worldwide, with significant losses in yield and quality of vegetable and ornamental crops (Pappu et al., 2009). The type species of the genus, Tomato spotted wilt virus, is the most widely spread, with a host range of more than 1000 plant species, including important crops such as pepper, potato, tobacco, tomato and numerous ornamental species (Scholthof et al., 2011). Tospovirus virions are surrounded by an envelope of hostderived lipids and contain a tripartite genome composed of three single-stranded RNA (ssRNA) molecules designated large (L), medium (M), and small (S). The L genomic segment encodes the RNA-dependent RNA polymerase (RdRp) in the viral antisense

∗ Corresponding author. Tel.: +39 0113977923. E-mail address: [email protected] (M. Turina). 1 First and second author equally contributed to the paper. http://dx.doi.org/10.1016/j.virusres.2015.05.021 0168-1702/© 2015 Elsevier B.V. All rights reserved.

strand (Goldbach and Peters, 1996). The M and S segments possess ambisense gene arrangement: in the viral antisense strand, they encode the glycoprotein precursor (Gn/Gc) and the nucleocapsid protein (N), respectively, while in the viral sense they encode the NSm movement protein and NSs non-structural protein, respectively (Goldbach and Peters, 1996). Both M and S segment possess an intergenic region (IGR) between the viral sense and antisense open reading frames (ORF), with a putative role in transcription termination and translation of subgenomic RNAs (Goldbach and Peters, 1996; Geerts-Dimitriadou et al., 2012). Most eukaryotic organisms possess a common mechanism for sequence-specific gene expression regulation, known as RNAinterference (RNAi) or gene silencing (Fire et al., 1998). RNAi is triggered by the presence of double-stranded RNA (dsRNA) or self-complementary RNA structures, and results in the specific degradation of the target mRNA, or in the inhibition of its translation (Hull, 2014). RNAi acts against molecular parasites, including transposons, transgenes, and viruses, and has also a role in regulating the expression of endogenous genes (Hannon, 2002; Voinnet, 2006; Bologna and Voinnet, 2014). The mechanism of action involves the initial processing of the dsRNAs into small

P. Margaria et al. / Virus Research 208 (2015) 30–38

RNAs (sRNAs) of approximately 21–24 nucleotides by Dicer-like (DCL) enzymes (Meister and Tuschl, 2004). Upon incorporation of one of the two strands into the RNA-induced silencing complex (RISC), the sRNAs serve to guide Argonaute (AGO) (Meister, 2013) to specifically recognize and degrade the target mRNA with sequence complementarity (post-transcriptional gene silencing, PTGS), or to perform histone modifications and DNA methylation of the specific gene target (transcriptional gene silencing, TGS) (Pattanayak et al., 2013). Plant viruses have evolved proteins, called gene silencing suppressors (Voinnet, 2005; Pumplin and Voinnet, 2013; Qu and Morris, 2005), that counteract anti-viral RNAi by targeting different steps of the silencing pathway, for instance by binding to the dsRNA, sequestering sRNAs, or interfering with AGO or DCL functions (Roth et al., 2004; Incarbone and Dunoyer, 2013). The NSs of tomato spotted wilt virus (TSWV) has been shown to suppress the antiviral RNAi mechanism in plants and insects (Takeda et al., 2002; Bucher et al., 2003; Garcia et al., 2006), and its affinity to long and small double-stranded RNA molecules has been demonstrated (Schnettler et al., 2010). Next generation sequencing and analysis of virus-derived sRNAs (vsRNAs), has greatly contributed to understanding the pathogenesis of plant-infecting viruses (Adams et al., 2009; Hagen et al., 2011). Inside the genus Tospovirus, the analysis of vsRNA profiles of a TSWV strain infecting Nicotiana benthamiana and tomato (Solanum lycopersicum) found significant differences in vsRNA abundance between the experimental and commercial host (Mitter et al., 2013). The overall quantitative differences did not result in qualitative differential allocation of vsRNAs, as the profile of vsRNAs matching different genomic segments, or ORFs within each segment, did not differ significantly between the two hosts (Mitter et al., 2013). We recently described a collection of wild-type (WT) TSWV isolates, and their directly derived NSs-defective strains, which lack silencing suppression activity (Margaria et al., 2007, 2014). In this study, we used two phylogenetically distinct WT isolates and their derived mutants to study the vsRNA profiles in N. benthamiana. The significant differences between the sRNA profiles associated to the absence of the silencing suppressor are discussed. 2. Materials and methods 2.1. Tospovirus isolates in study and their maintenance Four tospovirus isolates from the PLAVIT (Plant Viruses Italy) collection (http://www.wfcc.info/ccinfo/index.php/collection/by id/1057) were considered in this study: p105 (WT), p105RBMar (NSs-defective), p202/3WT (WT) and p202/3RB (NSs-defective). Isolates p105 and p202/3WT were originally collected in pepper fields in Ligury, Northern Italy, and Sicily, Southern Italy, respectively. They belong to different evolutionary clades and their full-length genome sequence has been characterized (Margaria et al., 2007, 2015). The NSs-mutant strains were generated in greenhouse conditions by single-passage mechanical inoculation, and have been previously characterized in detail (Margaria et al., 2014). About three to four weeks post-germination, N. benthamiana plants were rub-inoculated with WT and mutant TSWV strains, using virus-infected tissue stored in liquid nitrogen. Inoculated plants were maintained in an insect-proof greenhouse at temperatures of 22–25/16–20 ◦ C (day-night) with a 16/8 h light/dark photoperiod, and monitored for symptom development. Early after systemic infections, leaves were used to inoculate a batch of eight N. benthamiana plants for each isolate in study. 2.2. RNA extraction and sRNA sequencing Two systemically infected leaves from each plant were sampled, frozen in liquid nitrogen and stored at −80 ◦ C, taking care to

31

preserve a portion of each leaf for virus titer quantification by ELISA assays (Mautino et al., 2012). We selected leaf tissue samples for RNA extraction from three different plants (out of the eight tested by ELISA), which did not show statistically significant differences in virus titer either at the intra- or inter-isolate level. Total RNA was extracted using the Direct-zol RNA prep kit (Zymoresearch, Irvine, CA, USA). For this purpose, four ml of 2.3 mm diameter silica beads (Biospec, Bartlesville, OK, USA) were added to 15 ml conical tubes and leaf samples were ground using a bead beater homogenizer Fast-Prep® -24 instrument (MP Biomedicals, Santa Ana, CA, USA), taking care not to overheat the sample. Four ml of Trizol reagent were then added to each tube and samples were frozen in liquid nitrogen, and ground again. Tubes were centrifuged for 5 min at 8000 rpm and supernatant was carefully transferred to new tubes. A further centrifugation step for 1 min at 14,000 rpm was performed to pellet residual debris and supernatant transferred to new tubes. An equal volume of 100% ethanol was added to each sample, which was further processed following the manufacturer’s protocol. RNA was quantified using a NanoDrop 2000 spectrophotometer (Thermoscientific, Waltham, MA, USA) and the quality of the total RNA preparation was assessed by testing RIN (RNA Integrity Number) and 28S/18S ratio using the Agilent RNA 6000 nano Reagents preparation kit with an Agilent 2100 Bioanalyzer (Agilent Technologies, Waldbronn, Germany). Twenty micrograms of total RNA for each sample were sent to BGI (Guangzhou, China) for sRNA purification, library synthesis, and sequencing by Illumina technologies with a single-end library read length of 50 bp. 2.3. Bioinformatic analysis Raw data were filtered using an in-house BGI method, and only the reads with no more than four bases with quality value lower than 10, and no more than six bases with quality value lower than 13, were considered for further analysis. Adapter sequences (5 adapter sequence: TTCAGAGTTCTACAGTCCGACGATC, 3 adapter sequence: TCGTATGCCGTCTTCTGCTTG) were removed using a custom BGI script, allowing four mismatches. Trimmed reads were aligned against the viral genomic sequences deposited in GenBank (see below) using butter (version 0.2.5) (Axtell, 2014), allowing zero mismatches. The sequences of the three genomic segments of isolate p105 (Genbank accessions KJ575620 for the L segment, KJ575620 for the M segment, DQ376178 for the S segment), were used for the analysis of the WT and the derived mutant strain p105RBMar. The following Genbank accessions were used for isolate p202/3WT (KJ575619 for the L segment, HQ830188 for the M segment, HQ830187 for the S segment), and p202/3RB (KJ575619 for the L segment, HQ830185 for the M segment, HQ830186 for the S segment). Alignment against plant host genome was also performed using butter (version 0.2.5) (Axtell, 2014), using N. benthamiana genome version 0.5 (Naim et al., 2012) allowing zero mismatches. Reads size and distribution along the viral genome were determined using samtools (version 1.0) (Li et al., 2009) and custom perl scripts. Prediction of base-pairing probability was performed using the RNAfold Webserver (Gruber et al., 2008). 3. Results and discussion 3.1. Absence of the silencing suppressor increases the total amount of 21 nt sRNAs in infected N. benthamiana Sequence Read Archive (SRA) accession numbers for the four sequenced samples are detailed in Table 1. The number of total sRNA reads was similar among samples infected with the four TSWV isolates (Table 1). Only reads that were mapping to the viral or host genome without mismatches were further considered in the

32

P. Margaria et al. / Virus Research 208 (2015) 30–38

Table 1 Summary of small RNA data. Virus isolate

Silencing suppressor

SRA accession

Reads Total

Mapping viral genome Absolute

Mapping host genome %

Absolute

%

p105 p105RBMar

Wild-type Mutant

SRR1819883 SRR1819885

11,303,268 11,295,853

1,096,505 3,405,030

9.7 30.1

8,841,718 6,634,689

78.2 58.7

p202/3WT p202/3RB

Wild-type Mutant

SRR1820114 SRR1821205

11,559,590 13,280,414

962,179 3,130,448

8.3 23.6

8,925,995 8,500,858

77.2 64.0

to the corresponding WT strain, showing that absence of a functional silencing suppressor specifically affects the accumulation of this specific class of sRNAs.

3.2. Absence of a functional silencing suppressor increases amount of vsRNAs in infected N. benthamiana We then proceeded to align the total sRNAs to the N. benthamiana and viral genomes respectively: a strong difference in the relative percentage of sRNAs mapping to the plant versus the viral genome was observed between WT and mutant viruses. In p105 and p202/3WT infected samples, most sRNAs aligned to the N. benthamiana genome (78.2 and 77.2%, respectively), while only a small number (9.7 and 8.3%) aligned to the viral genome (Table 1). In comparison, plants infected with the p105RBMar and p202/3RB NSs-defective isolates had a reduced percentage of endogenous N. benthamiana reads and an increased percentage, around three times higher, of vsRNAs (30.1 and 23.6%, respectively) (Table 1). These data show that the NSs-defective isolates either cause reduced accumulation of endogenous N. benthamiana sRNAs or increased accumulation of virus-derived sRNAs (or both). We noted that the overall ratio of vsRNAs was significantly higher compared to previous findings, where only 0.02% of the total reads were reported to align to the TSWV genome (Mitter et al., 2013). But while the TSWV isolate used by Mitter & co-authors induced mild yellow spots symptoms on N. benthamiana (Mitter et al., 2013), our isolates elicited leaf curling, and in the case of p105, plant necrosis 12 days p.i. (Margaria et al., 2014). Beside virulence, the experimental conditions, like growth parameters and sampling time, might also have played a role in determining such difference. Further, absence of the complete genome sequence for the isolate used in the previous work, and zero mismatch mapping against a distinct reference genome, might have contributed to the low read counts.

3.3. Abundance of N. benthamiana endogenous sRNA length-classes is similar in WT and mutant TSWV isolates

Fig. 1. Size distributions of small RNAs in the TSWV-infected N. benthamiana libraries. (A) Total sRNAs; (B) endogenous N. benthamiana sRNAs; (C) viral sRNAs. See Table 1 for specific treatments.

analysis. Most sRNAs from TSWV-infected samples were 21–24 nt in length (Fig. 1A). Both WT isolates showed higher abundance of 24 nt sRNAs (a size typical for sRNAs of host origin), followed by 21, 22 and 23 nt sRNAs (Fig. 1A). This result is in agreement with previous reports in N. benthamiana and tomato infected by a TSWV WT strain (Mitter et al., 2013), as well as in sRNA libraries derived from other virus/host combinations (Yang et al., 2011; Hamera et al., 2012; Xu et al., 2012; Yan et al., 2010). For both NSs-mutant strains, an increased accumulation of 21 nt reads was observed compared

Among the subset of sRNAs matching the N. benthamiana genome, we observed a relatively high proportion of 24 nt sRNAs, and a similar distribution of sRNA size classes between each WT/mutant pair (Fig. 1B). The predominance of endogenous 24 nt sRNAs in N. benthamiana infected by TSWV was previously reported (Mitter et al., 2013). Since non-infected N. benthamiana plants were not included neither in our analysis nor in a previous work (Mitter et al., 2013), it is not possible to determine if the high level of endogenous 24 nt sRNAs was caused by TSWV infection or is constitutive in N. benthamiana. Previous authors observed a higher abundance of endogenous 24 nt sRNAs versus 21/22 nt sRNAs in many un-infected plants, including N. benthamiana (Pantaleo et al., 2010). However, other authors reported contrasting results: as an example, Lin and co-workers showed a peak of 22 nt sRNAs in mock-inoculated N. benthamiana, and an increase of 30–40%

P. Margaria et al. / Virus Research 208 (2015) 30–38

33

Table 2 vsRNA alignment distributions among individual viral genomic segments. Segment

L M S

Size

8913 4756 2927

Expected %

53.7 28.7 17.6

p105

p105RBMar

Actual number of reads

Actual % reads

Actual number of reads

Actual % reads

722,005 112,374 262,148

65.8 10.2 23.9

1,269,408 1,449,691 685,933

37.3 42.6 20.1

p202/3WT

L M S

8913 4824 2962

53.7 28.7 17.6

p202/3RB

Actual number of reads

Actual % reads

Actual number of reads

Actual % reads

588,112 322,714 51,365

61.1 33.5 5.3

1,409,710 517,975 1,202,765

45.0 16.5 38.4

in endogenous 24 nt sRNAs following inoculation with bamboo mosaic virus (Lin et al., 2010). A recent paper described the accumulation of a new class of endogenous 21 nt sRNAs, designated as virus-activated smallinterfering RNAs (vasiRNAs), in Arabidopsis thaliana infected by different viruses (Cao et al., 2014). Production of vasiRNAs was apparent in plants infected with silencing suppressor-deficient cucumber mosaic virus (2b mutant), and in plants infected with turnip mosaic virus-GFP (Cao et al., 2014). We did not observe notable changes in the abundance of 21 nt endogenous sRNAs in N. benthamiana plants infected by the mutant isolates compared to WT strains (Fig. 1B). A possible explanation could be that in A. thaliana the generation of vasiRNAs requires the presence of Dicerlike 4 (DCL4) and of RNA-dependent RNA polymerase 1 (RDR1). RDR1 is known to be inactive in N. benthamiana (Yang et al., 2004), possibly rendering this host unable to produce endogenous vasiRNAs following infection. Alternatively TSWV NSs may not target vasiRNA as the 2b protein from CMV does, and therefore a difference cannot be observed between the two treatments. 3.4. Functional silencing suppressor preferentially inhibits accumulation of 21nt vsRNAs in N. benthamiana N. benthamiana samples infected with each of the TSWV isolates showed a prevalence of 21 and 22 nt vsRNAs and a very low level of 24 nt vsRNAs (Fig. 1C). However, the proportion of 21 nt sRNAs in p105-infected plants was much less than that in p105RBMar infected plants, and the same vsRNA profile was observed for p202/3WT compared to p202/3RB (Fig. 1C). The predominance of 21–22 nt vsRNAs is well known in virus-infected plants and further suggests the involvement of different DCLs in vsRNA generation (Blevins et al., 2006; Deleris et al., 2006; Donaire et al., 2009). In Arabidopsis thaliana, antiviral immunity is generally conferred by DCL4, DCL2, and DCL3 targeting the viral genomes in a hierarchical manner, and producing vsRNAs of 21, 22 and 24 nt, respectively (Blevins et al., 2006; Deleris et al., 2006; Bouche et al., 2006). Our results suggest that DCL4 and DCL2 play a major role in TSWV infections. In this respect, the selective effect on 21nt sRNAs in NSs-defective TSWV strains could imply that NSs specifically interacts with DCL4 activity. The abundance of 22 nt vsRNAs was lower in the NSs-defective isolates than the WT ones (Fig. 1C), suggesting that absence of the silencing suppressor does not favor the accumulation of this class of sRNAs. Interestingly, the two WT strains showed a different peak for the accumulation of vsRNA of different sizes: in fact, p105 showed the peak for the 22 nt class, while p202/3WT had the peak for the 21 nt class. Previous analysis of an American TSWV isolate showed the peak at 21 nt (Mitter et al., 2013). These results suggest that WT isolates of the same viral species with a functional silencing suppressor can be differentially processed in the same host, possibly suggesting a differential involvement of the various DCL forms.

This isolate-specific processing was further evident when analyzing vsRNA allocation against the genomic segments, as discussed in the next section. VsRNAs of 24 nt in size represented a small proportion of all vsRNAs for all the isolates used in our experiment (Fig. 1C). The low overall relevance of 24 nt sRNAs is similar to previous observations in N. benthamiana viral infections, such as with bamboo mosaic virus (Lin et al., 2010) and rice stripe virus (Xu et al., 2012). 3.5. Allocation of vsRNAs to each genomic segment is isolate-specific Discrepancies between the predicted (based simply on genomic segment length) and observed percentages of vsRNA accumulation have been observed previously in TSWV infected hosts (Mitter et al., 2013), as well as in other multi-segmented viruses, such as rice stripe virus infecting rice and N. benthamiana (Xu et al., 2012; Yan et al., 2010). In our study, we also confirmed that vsRNAs allocation was not proportional to genome segment lengths; moreover, allocation to each of the segments was isolate specific (Table 2). This is quite surprising, considering that each WT and NSs-defective isolate combination consists of isolates that are almost identical in sequence, as the mutant was derived by single-passage mechanical inoculation, and as also revealed by genome sequencing (Margaria et al., 2014). When comparing instead the two WT isolates, differential processing might have been derived from distinct secondary structure folding of the genomic segments: the two isolates have in fact been classified in two distinct evolutionary groups by phylogenetic analysis (Margaria et al., 2015). Prediction of secondary structures using the RNAfold Web Server revealed differential base pair-pairing probabilities between the two WT isolates (not shown, and Suppl. Fig. 1), possibly determining in part the observed differential mapping against the genomic segments. We noticed that lack of NSs decreased the allocation of vsRNAs to the L segment for both WT/mutant comparisons, whereas for the M and S segment the variation was isolate specific, irrespective of the presence/absence of NSs, with a higher targeting against the M segment for p105RBMar and against the S segment for p202/3RB (Table 2). Relative abundance of the respective genomic segments should be taken into account in this comparison, because the expected ratio used in our (and other authors) study is based on equal molar concentrations of the different genomic segments during infection. However, data from literature on TSWV and other tospovirus infections show that the L segment is generally much less abundant than the M and S segment (de Oliveira Resende et al., 1991). Furthermore, accumulation of defective interfering (DI) RNAs (particularly from the L segment for tospoviruses) could also account for some of the differences observed, since DI RNAs have been shown to be potent inducers of silencing and at the same time resistant to inhibition by the silencing machinery (Havelda et al., 2005).

34

P. Margaria et al. / Virus Research 208 (2015) 30–38

Table 3 21–22 nt vsRNA alignments to genes encoded by dicistronic genomic segments. Virus isolate

ORFs Gn/Gc Total

NSm %

Total

Gn/Gc

NSm

*

%

% expected based on size

N Total

NSs %

Total

N

NSs **

%

% expected based on size

p105 p105RBMar

62,236 716,243

73.9 56.3

21,994 555,300

26.1 43.7

78.9 78.9

21.1 21.1

68,201 223,008

34.6 36.1

129,177 395,193

65.4 63.9

35.7 35.7

64.3 64.3

p202/3WT p202/3RB

167,597 235,671

73.4 53.2

60,632 207,436

26.6 46.8

78.9 78.9

21.1 21.1

10,072 330,854

31.4 31.1

21,962 733,227

68.6 68.9

35.7 35.7

64.3 64.3

* **

The value was calculated as percentage of the whole ‘Gn/Gc + NSm’ artificial ORF. The value was calculated as percentage of the whole ‘N + NSs’ artificial ORF.

Fig. 2. Percentage of TSWV antisense and sense viral small RNAs with respect to the genes encoded by the L, M and S genomic segments. See Table 1 for specific treatments.

3.6. NSm vsRNAs are enriched in mutant TSWV isolates Given that both M and S segment are bi-cistronic in tospoviruses, and that specific subgenomic RNAs are expressed for each encoded ORF, we next tested if different ORFs from the same genomic segment were differentially targeted by the anti-viral silencing machinery. In this context, the TSWV isolates did not show specific targeting to either N or NSs regions in the S genomic segment (Table 3). In fact, taking into account that the NSs gene is almost twice the length of the N gene, all the isolates showed a percentage accumulation two times higher for the NSs gene (Table 3). The same behavior was previously observed for TSWV in both N. benthamiana and tomato hosts (Mitter et al., 2013). Instead, a different behavior was observed for the M segment ORFs between WT and mutant isolates. In the case of the WT isolates, vsRNAs reads mapping the Gn/Gc gene were around four times more abundant than the ones mapping the NSm gene, in agreement with their relative gene size and previously reported data (Mitter et al., 2013); instead, an enrichment in NSm-mapping vsRNAs was observed for the mutant isolates: both p105RBMar and p202/3RB had in fact a two times higher accumulation of reads mapping against the NSm

ORF, compared to what expected based on ORF size, and lower accumulation of reads mapping the Gn/Gc ORF. These results suggest that absence of the silencing suppressor can have an influence on the preferential targeting of single ORFs in the viral genome. 3.7. NSs-antisense vsRNAs are enriched in both WT and NSs-defective strains We next examined the distribution of vsRNAs mapping to the sense or antisense coding regions of each gene encoded by the tospovirus genome (Fig. 2). A previous work showed that the positive strand vsRNA mapping TSWV genes produced more vsRNAs than the negative strand ones, with the exception of NSs-antisense vsRNAs (Mitter et al., 2013). We here extended the analysis to different TSWV strains, and confirmed the same pattern for all the isolates in study (Fig. 2), suggesting that this behavior is a common feature of TSWV and does not depend on silencing suppressor expression. Analysis of vsRNAs accumulation in cotton infected by cotton leaf roll dwarf virus (a single-stranded positive sense RNA virus containing six open reading frames) showed equivalent amounts of sense and antisense vsRNAs (Silva et al., 2011), as also

Table 4 vsRNA alignments to the intergenic regions (IGR) of the M and S genomic segments. Virus isolate

M segment IGR

S segment IGR

Expected % reads

Observed % reads

Observed/Expected ratio

Expected % reads

p105 p105RBMar

5.5 5.5

7.2 3.2

1.3 0.6

17.3 17.3

Observed % reads 4.5 2.2

Observed/Expected ratio 0.3 0.1

p202/3WT p202/3RB

6.7 6.7

2.3 1.3

0.3 0.2

18.3 18.3

12.5 3.1

0.7 0.2

P. Margaria et al. / Virus Research 208 (2015) 30–38

35

Fig. 3. Relative frequencies of 5 terminal nucleotides of TSWV (A, B, C) and N. benthamiana endogenous (D, E, F) sRNAs, compared to the expected distribution based on viral and host genome composition. (A and D): 21 nt size; (B and E): 22 nt size; (C and F): 24 nt size. See Table 1 for specific treatments.

observed in maize infected by sugarcane mosaic virus (Xia et al., 2014). DsRNA-like secondary structures within the single-stranded viral RNA, have been reported to likely be the main source of vsRNAs; in other cases, dsRNA replication-intermediates could be the source of vsRNAs, thus resulting in equal amounts of sense and antisense sRNA reads (Molnar et al., 2005; Szittya et al., 2010; Wang et al., 2010; Pantaleo et al., 2010). However, low abundance of antisense vsRNAs compared to sense vsRNAs has been described as well (Ho et al., 2007; Donaire et al., 2009; Szittya et al., 2010). In our case, we can hypothesize that the NSs antiviral strand is a better template for sRNAs generation by the silencing machinery, or that +/− NSs vsRNAs are differentially processed (sequestered) after generation by the silencing machinery. Future investigations, also on the relative accumulation of sense and antisense NSs subgenomic RNAs, may help to better explore this peculiar behavior. 3.8. vsRNAs derived from the intergenic region (IGR) of the S and M genomic segments of TSWV are under-represented The IGR of the TSWV S RNA has been recently shown to be a weak inducer of RNA silencing compared to the other regions in the S RNA sequence (Hedil et al., 2014). The authors speculated a role of proteins involved in the translational machinery, as well

as of viral proteins (NSs) in masking the IGR and preventing targeting by the RNAi machinery (Hedil et al., 2014). Our isolates gave us the unique opportunity to analyze the sRNAs distribution in the IGR of NSs-defective mutants in the context of the viral infection. As shown in Table 4, the IGR of the S segment of all the TSWV isolates in study was much less targeted than expected, and the difference was more pronounced when plants were infected with the NSs-defective isolates. From these data, the hypothesis of the NSs possibly masking the IGR from the RNA silencing machinery, and being the major cause of low sRNA abundance, does not seem to be supported, even if we cannot exclude that the truncated NSs alleles could still be able to protect specifically the IGR. The same analysis on the M segment, revealed a lower targeting of the IGR, with the exception of p105 (Table 4). Our data strengthen the hypothesis that the low targeting of the IGR regions is a common feature of members inside the Tospovirus genus, as previously observed by sRNA hybridization approaches (Hedil et al., 2014). 3.9. 5 -terminal nucleotide preference and enrichment of sRNAs VsRNA composition and 5 -terminal nucleotide can indicate a preferential recruitment of sRNAs by different AGOs (Mi et al.,

36

P. Margaria et al. / Virus Research 208 (2015) 30–38

Fig. 4. Viral small RNA hotspot profiles for the large (L) genomic segments. (A) p105; (B) p202/3WT; (C) p105RBMar and (D) p202/3RB. The blue lines show the RdRp ORF position. See Table 1 for specific treatments. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)

2008; Mallory and Vaucheret, 2010). For example, in A. thaliana, sRNAs with a 5 -terminal A are mostly recruited by AGO2 and AGO4, whereas AGO1 predominantly favors sRNAs with a terminal U, and AGO5 those with a C terminal residue (Takeda et al., 2008; Morel et al., 2002; Qu et al., 2008). Considering the 21–22 vsRNAs, we observed a preference for 5 terminal A and U in our data (Fig. 3), suggesting a dominant role for AGO1 and AGO2 in tospovirus infections. This result is in agreement with previous observations (Mitter et al., 2013), and further suggests the main role of these isoforms in defense against plant viruses (Mi et al., 2008; Mallory and Vaucheret, 2010). Specifically, the defective isolates showed a lower percentage of 5 -A reads, and a higher percentage of 5 -U compared to their respective WT (Fig. 3A and B); the lowest percentage for 5 nt was observed for G, as reported for other viruses (Deleris et al., 2006). Instead, for the 24 nt sRNAs, we observed higher 5 -A and lower 5 -U reads for the NSs-mutant strains (Fig. 3C). These enrichments in 5 nt distribution were not statistically significant with respect to the TSWV viral genome composition, except for the 24 nt vsRNAs in both the p202/3 isolates, and in p105RBMar isolate (chi-square test values: 4.0E−3 for p202/3WT, 1.0E−5 for p202/3RB and 3.1E−03for p105RB Mar). The 5 composition of endogenous N. benthamiana sRNAs was the same for all the TSWV isolates. Specifically, we observed a significant enrichment in 5 -U among the 21nt sRNAs (chi square test values: 4.76041E−10, 4.15811E−07, 1.3E−10, 5.2e−10) and in 5 -A among the 24 nt sRNAs (chi square test values: 5.4E−09, 5.4E−10, 9.3E−14, 1.0E−12 for p105, p105RBMar, p202/3WT and p202/3RB, respectively) (Fig. 3D–F). This is consistent with the known tendencies of plant microRNAs to be 21 nts with a 5 -U, and for plant heterochromatic siRNAs to be 24 nts with a 5 -A (Voinnet, 2009).

3.10. Marked vsRNA accumulation at hotspots in the L segment for NSs-defective strains Next, we compared vsRNA hotspot distribution on the genomic segments. The absence of the silencing suppressor did not affect the hotspot vsRNA profile, with only one noticeable exception: for the L segment, a great accumulation of sRNAs corresponding to a wide region of the genome between nts 6100–8600, particularly originated by the viral antisense strand, was evident in both the NSs-defective strains, but not in the WT strains (Fig. 4). This massive difference, even among strictly related strains that have almost identical genome sequence (with the exception of one/two nt deletions in the S segment), suggests that the absence of the silencing suppressor can massively influence the processing of the genomic segments. This is in agreement with the results described in Table 2, where both NSs-mutants showed a higher accumulation of reads mapping against the L segment. In this context, our results may indicate that NSs has a role in protecting the L RNA from degradation. Since the L RNA encodes the RdRp, which is critical for virus replication in infected cells, the L RNA/NSs interaction might have evolved to determine lower targeting against this genomic segment by the plant silencing machinery. This hypothesis was also formulated by previous authors, which observed very low targeting against the L segment compared to what expected based on genome size (Mitter et al., 2013). Prediction of L RNA secondary structure revealed high base-pairing probability in position 6100–7500 and 8300–8600 for isolate p105 and in position 6480–7800 and 8300–8600 for isolate p202/3WT (Supplementary Fig. 1). These secondary structures might serve as binding sites for the full-length WT NSs, which has been demonstrated to bind dsRNA in vitro (Schnettler et al., 2010), possibly resulting in

P. Margaria et al. / Virus Research 208 (2015) 30–38

protection from the RNAi machinery. This result may suggest an additional role for the NSs, consistent with the multi-functional properties of silencing suppressor proteins (Burgyán and Havelda, 2011; Csorba et al., 2015). Future experiments could be carried out to study if the hotspots in the L segment are specifically dependent on NSs presence/absence, by complementation of our NSs-defective isolates with silencing suppressors from other plant viruses (Zhang and Qu, 2014; Csorba et al., 2015). 4. Conclusions In this paper, we used our unique collection of NSs-defective TSWV strains, to describe for the first time the vsRNAs profile in N. benthamiana infected by WT and silencing-suppressor mutant isolates. Some commonalities were observed among all the WT and mutant viruses, such as lower targeting of the IGR region in the M and S segment, and enrichment of sRNAs reads mapping the NSs gene in the viral antisense strand. Absence of the silencing suppressor determined a marked increase of the 21 nt vsRNA class, whose accumulation is generally observed in virus-infected tissues (Molnar et al., 2005). More specifically, higher targeting of the NSm gene and of the 3 terminal region of the L gene were evident in the NSs-defective strains, suggesting that absence of the silencing suppressor likely determines a differential processing of genomic regions with almost identical sequences. Percentage abundance of endogenous N. benthamiana sRNAs classes did not change among WT and mutant isolates, suggesting that processing is similar in the two conditions. 5 terminal enrichment of endogenous 21 and 24 sRNAs was also conserved between WT and mutant isolates, and in agreement with the described abundance of endogenous sRNAs. Acknowledgment We thank Caterina Perrone for careful technical assistance. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.virusres.2015.05. 021 References Adams, I.P., Glover, R.H., Monger, W.A., Mumford, R., Jackeviciene, E., Navalinskiene, M., Samuitiene, M., Boonham, N., 2009. Next-generation sequencing and metagenomic analysis: a universal diagnostic tool in plant virology. Mol. Plant Pathol. 10, 537–545. Axtell, M.J., 2014. Butter: High-Precision Genomic Alignment of Small RNA-Seq Data. BioRxiv., http://dx.doi.org/10.1101/007427 Blevins, T., Rajeswaran, R., Shivaprasad, P.V., Beknazariants, D., Si-Ammour, A., Park, H.S., Vazquez, F., Robertson, D., Meins, F., Hohn, T., Pooggin, M.M., 2006. Four plant Dicers mediate viral small RNA biogenesis and DNA virus induced silencing. Nucleic Acids Res. 34, 6233–6246. Bologna, N.G., Voinnet, O., 2014. The diversity, biogenesis, and activities of endogenous silencing small RNAs in Arabidopsis. Annu. Rev. Plant Biol. 65, 473–503. Bouche, N., Lauressergues, D., Gasciolli, V., Vaucheret, H., 2006. An antagonistic function for Arabidopsis DCL2 in development and a new function for DCL4 in generating viral sRNAs. EMBO J. 25, 3347–3356. Bucher, E., Sijen, T., De Haan, P., Goldbach, R., Prins, M., 2003. Negative-strand tospoviruses and tenuiviruses carry a gene for a suppressor of gene silencing at analogous genomic positions. J. Virol. 77, 1329–1336. Burgyán, J., Havelda, Z., 2011. Viral suppressors of RNA silencing. Trends Plant Sci. 16, 265–272. Cao, M., Du, P., Wang, X., Yu, Y.Q., Qiu, Y.H., Li, W., Gal-On, A., Zhou, C., Li, Y., Ding, S.W., 2014. Virus infection triggers widespread silencing of host genes by a distinct class of endogenous siRNAs in Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 111, 14613–14618. Csorba, T., Levante, L., Burgyan, J., 2015. Viral silencing suppressors: tools forged to fine-tune host-pathogen coexistence. Virology, http://dx.doi.org/10.1016/j. virol.2015.02.028 de Oliveira Resende, R., de Haan, P., de Avila, A.C., Kitajima, E.W., Kormelink, R., Goldbach, R., Peters, D., 1991. Generation of envelope and defective interfering

37

RNA mutants of Tomato spotted wilt virus by mechanical passage. J. Gen. Virol. 72, 2375–2383. Deleris, A., Gallego-Bartolome, J., Bao, J., Kasschau, K.D., Carrington, J.C., Voinnet, O., 2006. Hierarchical action and inhibition of plant Dicer-like proteins in antiviral defense. Science 313, 68–71. Donaire, L., Wang, Y., Gonzalez-Ibeas, D., Mayer, K.F., Aranda, M.A., Llave, C., 2009. Deep-sequencing of plant viral small RNAs reveals effective and widespread targeting of viral genomes. Virology 392, 203–214. Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E., Mello, C.C., 1998. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391, 806–811. Garcia, S., Billecocq, A., Crance, J.M., Prins, M., Garin, D., Bouloy, M., 2006. Viral suppressors of RNA interference impair RNA silencing induced by a Semliki Forest virus replicon in tick cells. J. Gen. Virol. 87, 1985–1989. Geerts-Dimitriadou, C., Lu, Y., Geertsema, C., Goldbach, R., Kormelink, R., 2012. Analysis of the Tomato spotted wilt virus ambisense S RNA-encoded hairpin structure in translation. PLoS ONE 7, e31013. Goldbach, R., Peters, D., 1996. Molecular and biological aspects of tospoviruses. In: Elliot, R.M. (Ed.), The Bunyaviridae. Plenum Press, New York, pp. 129–157. Gruber, A.R., Lorenz, R., Bernhart, S.H., Neuböck, R., Hofacker, I.L., 2008. The Vienna RNA Websuite. Nucleic Acids Res. 36, W70–W74. Hagen, C., Frizzi, A., Kao, J., Jia, L., Huang, M., Zhang, Y., Huang, S., 2011. Using small RNA sequences to diagnose, sequence, and investigate the infectivity characteristics of vegetable-infecting viruses. Arch. Virol. 156, 1209–1216. Hamera, S., Song, X., Su, L., Chen, X., Fang, R., 2012. Cucumber mosaic virus suppressor 2b binds to AGO4-related small RNAs and impairs AGO4 activities. Plant J. 69, 104–115. Hannon, G.J., 2002. RNA interference. Nature 418, 244–251. Havelda, Z., Hornyik, C., Valoczi, A., Burgyan, J., 2005. Defective interfering RNA hinders the activity of a tombusvirus-encoded posttranscriptional gene silencing suppressor. J. Virol. 79, 450–457. Hedil, M., Hassani-Mehraban, A., Lohuis, D., Kormelink, R., 2014. Analysis of the AU rich hairpin from the intergenic region of tospovirus S RNA as target and inducer of RNA silencing. PLOS ONE 9, e106027. Ho, T., Wang, H., Pallett, D., Dalmay, T., 2007. Evidence for targeting common siRNA hotspots and GC preference by plant Dicer-like proteins. FEBS Lett. 581, 3267–3272. Hull, R., 2014. Virus plant interactions: RNA silencing. In: Matthew’s Plant Virology. Academic Press, San Diego, CA, pp. 477–530. Incarbone, M., Dunoyer, P., 2013. RNA silencing and its suppression: novel insights from in planta analyses. Trends Plant Sci. 18, 382–392. King, A.M.Q., Adams, M.J., Carstens, E.B., Lefkowitz, E.J. (Eds.), 2012. Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier Academic Press, San Diego, CA. Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., 2009. The sequence alignment/map format and SAMtools. Bioinformatics 25, 2078–2079. Lin, K.Y., Cheng, C.P., Chang, B.C.H., Wang, W.C., Huang, Y., Lee, Y.S., Huang, H.D., Hsu, Y.H., Lin, N.S., 2010. Global analyses of small interfering RNAs derived from Bamboo mosaic virus and its associated satellite RNAs in different plants. PLoS ONE 5, e11928. Mallory, A., Vaucheret, H., 2010. Form, function, and regulation of ARGONAUTE proteins. Plant Cell 22, 3879–3989. Margaria, P., Bosco, L., Vallino, M., Ciuffo, M., Mautino, G.C., Tavella, L., Turina, M., 2014. The NSs protein of Tomato spotted wilt virus is required for persistent infection and transmission by Frankliniella occidentalis. J. Virol. 88, 5788–5802. Margaria, P., Ciuffo, M., Pacifico, D., Turina, M., 2007. Evidence that the nonstructural protein of Tomato spotted wilt virus is the avirulence determinant in the interaction with resistant pepper carrying the Tsw gene. Mol. Plant Microbe Interact. 20, 547–558. Margaria, P., Miozzi, L., Ciuffo, M., Pappu, H.R., Turina, M., 2015. The first complete genome sequences of two distinct European Tomato spotted wilt virus isolates. Arch. Virol. 160, 591–595. Mautino, G.C., Sacco, D., Ciuffo, M., Turina, M., Tavella, L., 2012. Preliminary evidence of recovery from Tomato spotted wilt virus infection in Frankliniella occidentalis individuals. Ann. Appl. Biol. 161, 266–276. Meister, G., Tuschl, T., 2004. Mechanisms of gene silencing by double-stranded RNA. Nature 431, 343–349. Meister, G., 2013. Argonaute proteins: functional insights and emerging roles. Nat. Rev. Genet. 14, 447–459. Mi, S., Cai, T., Hu, Y., Chen, Y., Hodges, E., Ni, F., Wu, L., Li, S., Zhou, H., Long, C., Chen, S., Hannon, G.J., Qi, Y., 2008. Sorting of small RNAs into Arabidopsis Argonaute complexes is directed by the 5 terminal nucleotide. Cell 133, 116–127. Mitter, N., Koundal, V., Williams, S., Pappu, H., 2013. Differential expression of Tomato Spotted Wilt Virus – derived viral small RNAs in infected commercial and experimental host plants. PLOS ONE 8, e76276. Molnar, A., Csorba, T., Lakatos, L., Varallyay, E., Lacomme, C., Burgyan, J., 2005. Plant virus-derived small interfering RNAs originate predominantly from highly structured single-stranded viral RNAs. J. Virol. 79, 7812–7818. Morel, J.B., Godon, C., Mourrain, P., Beclin, C., Boutet, S., Feuerbach, F., Proux, F., Vaucheret, H., 2002. Fertile hypomorphic ARGONAUTE (ago1) mutants impaired in post-transcriptional gene silencing and virus resistance. Plant Cell 14, 629–639. Naim, F., Nakasugi, K., Crowhurst, R.N., Hilario, E., Zwart, A.B., Hellens, R.P., Taylor, J.M., Waterhouse, P.M., Wood, C.C., 2012. Advanced engineering of lipid metabolism in Nicotiana benthamiana using a draft genome and the V2 viral silencing-suppressor protein. PLoS ONE 7, e52717.

38

P. Margaria et al. / Virus Research 208 (2015) 30–38

Pantaleo, V., Saldarelli, P., Miozzi, L., Giampetruzzi, A., Gisel, A., Moxon, S., Dalmay, T., Bisztray, G., Burgyan, J., 2010. Deep sequencing analysis of viral short RNAs from a Pinot Noir infected grapevine. Virology 408, 49–56. Pappu, H.R., Jones, R.A.C., Jain, R.K., 2009. Global status of tospovirus epidemics in diverse cropping systems: successes achieved and challenges ahead. Virus Res. 141, 219–236. Pattanayak, D., Solanke, A.U., Kumar, P.A., 2013. Plant RNA interference pathways: diversity in function, similarity in action. Plant Mol. Biol. Rep. 31, 493–506. Pumplin, N., Voinnet, O., 2013. RNA silencing suppression by plant pathogens: defence, counter-defence and counter-counter-defence. Nat. Rev. Microbiol. 11, 745–760. Qu, F., Morris, J.T., 2005. Suppressors of RNA silencing encoded by plant viruses and their role in viral infections. FEBS Lett. 579, 5958–5964. Qu, F., Ye, X.H., Morris, T.J., 2008. Arabidopsis DRB4, AGO1, AGO7, and RDR6 participate in a DCL4-initiated antiviral RNA silencing pathway negatively regulated by DCL1. Proc. Natl. Acad. Sci. U. S. A. 105, 14732–14737. Roth, B.M., Pruss, G.J., Vance, V.B., 2004. Plant viral suppressors of RNA silencing. Virus Res. 102, 97–108. Schnettler, E., Hemmes, H., Huismann, R., Goldbach, R., Prins, M., Kormelink, R., 2010. Diverging affinity of tospovirus RNA silencing suppressor proteins, NSs, for various RNA duplex molecules. J. Virol. 84, 11542–11554. Scholthof, K.B.G., Adkins, S., Czosnek, H., Palukaitis, P., Jacquot, E., Hohn, T., Hohn, B., Saunders, K., Candresse, T., Ahlquist, P., Hemenway, C., Foster, G.D., 2011. Top 10 plant viruses in molecular plant pathology. Mol. Plant Pathol. 12, 938–954. Silva, T.F., Romanel, E.A.C., Andrade, R.R.S., Farinelli, L., Osteras, M., Deluen, C., Correa, R.L., Schrago, C.E.G., Vaslin, M.F.S., 2011. Profile of small interfering RNAs from cotton plants infected with the polerovirus Cotton leafroll dwarf virus. BMC Mol. Biol. 12. Szittya, G., Moxon, S., Pantaleo, V., Toth, G., Rusholme Pilcher, R.L., Moulton, V., Burgyan, J., Dalmay, T., 2010. Structural and functional analysis of viral siRNAs. PLOS Pathog. 6, e1000838.

Takeda, A., Iwasaki, S., Watanabe, T., Utsumi, M., Watanabe, Y., 2008. The mechanism selecting the guide strand from small RNA duplexes is different among Argonaute proteins. Plant Cell Physiol. 49, 493–500. Takeda, A., Sugiyama, K., Nagano, H., Mori, M., Kaido, M., Mise, K., Tsuda, S., Okuno, T., 2002. Identification of a novel RNA silencing suppressor, NSs protein of Tomato spotted wilt virus. Febs Lett. 532, 75–79. Voinnet, O., 2005. Induction and suppression of RNA silencing: insights from viral infections. Nat. Rev. Genet. 6, 206–220. Voinnet, O., 2006. RNA silencing as a plant immune system against viruses. EMBO Rep. 7, 1168–1175. Voinnet, O., 2009. Origin, biogenesis, and activity of plant microRNAs. Cell 136, 669–687. Wang, X.B., Wu, Q., Ito, T., Cillo, F., Li, W.X., Chen, X., Yu, J.L., Ding, S.W., 2010. RNAi-mediated viral immunity requires amplification of virus-derived siRNAs in Arabidopsis thaliana. Proc. Natl. Acad. Sci. U. S. A. 107, 484–489. Xia, Z., Peng, J., Li, Y., Chen, L., Li, S., Zhou, T., Fan, Z., 2014. Characterization of small interfering RNAs derived from sugarcane mosaic virus in infected maize plants by deep sequencing. PLoS ONE 9, e97013. Xu, Y., Huang, L., Fu, S., Wu, J., Zhou, X., 2012. Population diversity of rice stripe virus-derived sRNAs in three different hosts and RNAi-based antiviral immunity in Laodelphax striatellus. PLoS ONE 7, e46238. Yan, F., Zhang, H.M., Adams, M.J., Yang, J., Peng, J.J., Antoniw, J.F., Zhou, Y., Chen, J., 2010. Characterization of sRNAs derived from rice stripe virus in infected rice plants by deep sequencing. Arch. Virol. 155, 935–940. Yang, S.J., Carter, S.A., Cole, A.B., Cheng, N.H., Nelson, R.S., 2004. A natural variant of a host RNA-dependent RNA polymerase is associated with increased susceptibility to viruses by Nicotiana benthamiana. Proc. Natl. Acad. Sci. U. S. A. 101, 6297–6302. Yang, X., Wang, Y., Guo, W., Xie, Y., Xie, Q., Fan, L., Zhou, X., 2011. Characterization of sRNAs derived from the gemini virus/betasattellite complex using deep sequencing. PLoS ONE 6, e16928. Zhang, X., Qu, F., 2014. Plant Virus Silencing Suppressors and RNA Silencing in Plants. eLS, http://dx.doi.org/10.1002/9780470015902.a0020710.pub2.