ANNUAL REVIEWS
Further
Quick links to online content Annu. Rev. Physioi. 1990. 52:793-806 Copyright © 19.90 by Annual Reviews Inc.
All
rights reserved
SOMATOSTATIN GENE Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
REGULATION O. M. Andrisani and J. E. Dixon Biochemistry Department, Purdue University, West Lafayette, Indiana 47907 KEY WORDS:
cAMP, cAMP-responsive element (eRE), eRE-binding (CREB), transactivator, cloning of CREB
INTRODUCTION Somatostatin gene regulation is important not only because of the wide-spread biological activities of the gene product, but also because it was one of the first genes shown to be regulated by cAMP (33). Recently, the somatostatin gene has taken on added interest because a protein important in recognizing the DNA sequences responsible for cAMP regulation has been cloned by the research groups of Habener et al (22) and Montminy et al (13). This review will briefly cover the background associated with somatostatin gene structure and will focus primarily on recent developments associated with somatostatin gene regulation. The structure and functions of the polypeptide hormone somatostatin have been studied for many years in several species (37, 51). The 14-residue form of somatostatin h as been conserved in all organisms examined. In addition, several oth er m embers of the s omatostatin family have been identified, which include a 28-residue somatostatin from the anglerfish (21) and a 22-residue somatostatin from the catfish (35, 1). cDNAs have been isolated and se quenced that encode each of these peptides (12,14,15,21,29,30,44,50). The gene encoding somatostatin-14 has been isolated from a human gene library by Shen & Rutter (45) and from a rat gene library both by Montminy et al (32) and our laboratory (49). The transcriptional unit of the rat somatostatin gene includes exons of 238 and 367 base pairs (bp) separated by one intron of 621 bp. The intron is 793 0066-4278/90/0315-0793$02.00
794
ANDRISANI & DIXON
located
between the codons for GIn ( -57) and Glu (-56) of pre
prosomatostatin. Analysis of the nucleotide sequence 5' to the start of transcription reveals a number of sequences that may be involved in the expression of the somatostatin gene. A variant of the TATA box, TTTAAA, lies 26 bp upstream from the start of transcription, and a sequence homologous to the CAAT box, GGCTAAT, occurs 92 bp upstream from the transcription initiation site. A long alternating purine-pyrimidine stretch, (GThs, which is similar to Z-DNA-forming sequences in other genes, lies
Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
628 bp 5' to the start of transcription (20). Southern blot analysis of rat DNA suggests that a single gene is present that codes for the preprohormone that is ultimately processed into somatostatin-14. The human gene also consists of two exons separated by an intron of 877 bp. The exon-intron junctions are conserved in the rat and human genes.
AN OVERVIEW OF TRANSCRIPTION The past several years have witnessed a tremendous increase in our knowl edge of how genetic elements of eukaryotic genes regulate transcription through their interaction with cellular transcription factors. Genetic elements (promoters and enhancers) of eukaryotic genes have been defined by a combination of in vitro mutagenesis and gene transfer studies. These genetic elements, which are modular in nature, function through sequence-specific interactions with cellular protein factors. The sequence-specific nature of the interaction of the cellular factors with the genetic cis-acting elements is a powerful property of this class of proteins. Based on the sequence-specific binding of the transcription factors, a number of assays have been developed that have led to the identification and purification of a number of these proteins, also termed transactivators. The general principle that appears to be conSistently reinforced is that protein-DNA interactions as well as protein protein interactions will play dominant roles in defining the course of events that result in the expression and regulation of eukaryotic genes.
DEFINITION OF THE CIS-ACTING ELEMENT REQUIRED FOR SOMATOSTATIN GENE TRANSCRIPTION In order to define the cis-acting elements required for expression of the rat somatostatin gene, deletions of the 5' non-transcribed region of the gene were cloned in front of a reporter gene, and the activity of these deletions was determined by gene transfer experiments in the appropriate cell lines. Ideally, the host cell line should express the endogenous gene of interest; thus agents
SOMATOSTATIN
795
modulating expression of the transfected gene should also modulate expres sion of the endogenous promoter. Andrisani et al (2) utilized the CA-77 cell line system to introduce 5' deletions of the rat somatostatin promoter aligned to transcribe the chloram phenicol acetyltransferase (CAT) reporter gene. The CA-77 cell line es tablished by Roos & colleagues (5) is a neuronally derived cell line that originated from a rat medullary thyroid carcinoma. This cell line expresses elevated levels of somatostatin mRNA and has been utilized as the mRNA
Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
source for the isolation of somatostatin eDNA clones (12, 15). The cis-acting element required for maximal expression of the somatostatin gene was local ized between position -60 to -43 of the promoter. Deletion of the sequences between nucleotide positions -47 and -42 reduced the activity of the promoter to 9% of the wild-type level in CA-77 cells, which suggests that the deleted sequences constitute an important element required for expression of the somatostatin promoter. Montminy et al (34) introduced similar 5'-end deletions into PCl2 cells, a neuronally derived pheochromocytoma cell line. Although PCl2 cells do not express the endogenous somatostatin gene, they are cAMP-responsive, there by providing a system for the study of cAMP effects on neuropeptide gene transcription. Also, a mutant PC12 cell line exists that is deficient in cAMP dependent
protein kinase.
These
investigators (34) demonstrated that
transcription from the somatostatin promoter of the transfected SST-CAT plasmid is inducible by cAMP. This cAMP-induced transcription from the somatostatin promoter requires the presence of a genetic element located between position -71 to -48 of the somatostatin promoter. These are the same sequences required for expression of the somatostatin gene in CA-77 cells (2), although the observed transcription from the somatostatin promoter in the CA-77 cell line does not require nor respond to cAMP induction. Montminy et al (33) showed that the sequences of the somatostatin promoter between nucleotide positions -60 to -29, when placed in front of the SV40 promoter (which is cAMP non-responsive), confer cAMP-responsiveness in the SST-SV40-CAT construct. The cAMP response occurs only in wild-type PC12 cells and not in the kinase A-deficient PCl 2 cell line. These results demonstrate the involvement of the cAMP pathway in the transcriptional effect of cAMP on the somatostatin promoter. Comparison of the cAMP-responsive element present within the somato statin gene to sequences near the promoters of other genes known to be regulated by cAMP (8, 10, 47, 53) suggest the TGACGTCA sequence as the cAMP consensus (Table 1). The TGACGTCA sequence is referred to as CRE for cAMP-responsive element. The TGACGTCA module is also present and required for function in viral
796
ANDRISANI & DIXON
TABLE 1
Genes containing the TGACGTCA (CRE) consensus Distance to
Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
Gene
Sequence
the 5' cap site in bp
Somatostatin
TTGGCTGACGTCAGAGAGAGAG
-48
PEPCK
GCCCCTTACGTCAGAGGCGAGC
VIP
TACTGTGACGTCTTTCAGAGCA
-90 -75 -92
Proenkephalin
GGGCCTG CGTCAGC
a-Chorionic gonadotrophin
AAAATTGACGTCATGG
-122
c-Fos
CCCAGTGACGTAGGA
Ad2 E2
CTGGAGATGACGTAGTTTTCGCGCTTAAATTT
-66 -173 -140 -178 -159 -163 -163 -61 -76
Ad2 EIA
ATAGTCAGCTGACGTGTAGTGTATTTATACCC
-43
Ad2,S EtA
ACTTTGACCGTTTACGTGGAGACTCGC
-117
Fibronectin Cytomegalovirus enhancer HTLV-l/ LTR Bovine leukemia virus LTR Adenovirus 5 (Ad5) E4 Ad2 E4 Ad2 E3
ACAGTCCCCCGTGACGTCACCCGGGAGCCC CCCATTGACGTCAATGGGAGTT GGCCCTGACGTCCCTCCCCCCC GACAGAGACGTCAGCTGCCAGA GGAAGTGACGTAACGTGGGAAAACGG AAATGGGAAGTGACGTATCGTGGGAAAAC GCGGGCGGCTTTCGTCACAGGGTGCGGTC
promoters such as the ElA inducible early (EIA, E2a, E3, E4) adenovirus promoters (6, Table 1). Sassoni-Corsi (41) utilized deletion mutants of the E2a and E3 adenovirus promoters to show by transient expression assays in PC12 cells that a related CRE-like sequence, TACGTCA, is required for both cAMP-responsiveness and EIA transactivation. An interesting observation reported in this study is that the action of the E l A protein in transactivating the E2a and E3 promoters is maintained in the mutant PC12 cell line, which is deficient in cAMP-dependent protein kinase. Engel et al (11) utilized the cAMP-responsive 549 cell line to study cAMP induction of the viral EIA-inducible early promoters during the course of adenovirus infection. It was observed that transcription of the EIA inducible E4 gene utilizing wild-type adenovirus was induced IS-fold in the presence of cAMP treatment. The level of induction of E4 mRNAs was only fourfold when utilizing EIA viral mutants. These investigators concluded that although no changes were observed in the levels of EIA protein during the course of induction, preexisting ElA protein acts in synergy with events triggered by cAMP to induce transcription of the viral early genes. Although the studies described in this section point to the functional importance of the CRE consensus sequence in the expression of the cAMP-responsive and EIA-inducible promoters, the mechanism of cAMP- and ElA-mediated events is not yet understood.
797
SOMATOSTATIN
IDENTIFICATION OF THE CELLULAR PROTEIN FACTORS THAT INTERACT WITH THE RAT SOMATOSTATIN CRE ELEMENT In vitro, protein-DNA-binding assays such as DNase I footprinting and gel
Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
retardation assays (7, 25, 46) have been utilized for the identification, characterization, and purification of cellular transactivator proteins. The suc cess of these in vitro assays is based on the property that most transactivator p roteins possess: high affinity and sequence-specific binding to defined re gions of DNA. DNase I footprint assays can be used to identify regions of a radiolabeled DNA fr agment that are protected from DNase I digestion be cause of the sequence-specific binding of protein factors. DNase I footprint assays utilizing the radiolabeled somatostatin promoter DNA as a probe and cell extracts from PC12 (31), CA-77 (3), or HeLa (24,28) cells have shown that the - 55 to - 35 region of the somatostatin promoter, which harbors the CRE, is protected from DNase I digestion. Gel retardation assays have also been used to identify factor(s) binding to the eRE-containing region of the rat somatostatin gene (3). A radiolabeled DNA fra gment containing the CRE element of th e somatostatin promoter was utilized as a probe and allowed to interact in vitro with extracts prepared from various cell lines or tissues. The DNA/protein complexes were analyzed on low ionic strength polyacrylamide gels. Three sequence-specific DNA/protein complexes have been identified in e xtracts of many different cell types. These complexes show competitive b i nding to other eRE-consensus sequences, but do not compete for binding with fragments derived from a variety of other DNAs including the f3-globin promoter, maj or late promoter, or upstream sequences of the somatostatin promoter. The activities forming the three sequence-specific complexes are chromatographically separable, which suggests that distinct entities are responsible for the formation of the three sequence-specific complexes (3). Similar observations are reported in the study by Hardy & Shenk (18), who
utilized HeLa cell extracts fractionated on an ion exchange column. These fractions were measured by the gel retardation assay with the adenovirus E4 CRE-like element and the somatostatin CRE as probes. Also, Cortes et al (9) observed multiple eRE binding acti vities after chromato graphic fractionation of HeLa extracts. These activities were assayed both by in vitro DNA protein assays using the E4 and somatostatin CRE elements and functional in vitro transcription assays. Although the gel retardation and DNase I footprinting assays have im p licated the CRE consensus in sequence-specific binding of cellular protein factor(s), the direct involvement of the eRE in the formation of these -
-
sequence-specific complexes has been determined by in vitro methylation
798
ANDRISANI & DIXON
Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
interference assays (3). It was shown that the G residues within the TGACG TCA core element come into direct contact with the protein factor(s) forming the DNA/protein complexes. Synthetic oligonucleotides containing point mutations of the G residues within the TGACGTCA palindrome fail to compete for binding in vitro. Similar methylation interference data have been reported by Green's laboratory (28), utilizing the early adenovirus promoter E4, somatostatin, and other CRE-containing promoters.
PURIFICATION OF A CRE-BINDING 43-kd PROTEIN (CREB) Purification to apparent homogeneity of a number of sequence-specific DNA binding proteins has been achieved by use of conventional chromatography in combination with a sequence-specific DNA-affinity chromatography step. Kadonaga & Tjian (25) reported the development of a sequence-specific DNA-affinity column for the purification of the transcription factor SPl. The DNA-affinity column was constructed by coupling multimeric units of dou ble-stranded synthetic oligonucleotides containing the binding site of interest to cyanogen bromide-activated sepharose. An alternative method for con structing a high capacity DNA-affinity column involves the incorporation of biotinylated nucleotides into the ends of concatemerized DNA (4). The biotinylated DNA is subsequently bound by avidin, which has been im mobilized on agarose. In the last two years, a number of laboratories have employed CRE sequence-specific affinity chromatography for the purification of CRE binding cellular transcription factors. Purification of a 43-kd protein from PC12 extracts by a somatostatin CRE-sequence-specific affinity column was initially reported by Montminy & Bilezikjian (31). This 43-kd protein, re ferred to as CREB for CRE-binding, protects the -55 to -32 region of the somatostatin promoter from DNase I digestion. Zhu et al (55) reported the purification of a 43-kd protein from rat brain extracts by employing ion exchange chromatography for the fractionation of three CRE-binding activi ties followed by two cycles of DNA-affinity chromatography of the major CRE-binding fractions. This 43-kd protein was purified to an apparent single band on SDS gels. It similarly binds in a sequence-specific manner to the somatostatin CRE-containing promoter fragment as shown by Southwestern blots and DNase I footprints. A 45-kd protein has also been purified by Hurst & Jones from HeLa cell extracts (24). These investigators used the sequences from the E1A-inducible adenovirus E3 promoter for constructing the sequence-specific DNA-affinity chromatography column. To elucidate the relationship between the proteins purified by CRE-affinity
Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
SOMATOSTATIN
799
chromatography utilizing the eRE-consensus sequence of cAMP-responsive or ElA-inducible genes, Lin & Green (28) employed UV crosslinking ex periments to attach the labeled eRE DNA covalently to the bound protein. The covalent DNA-protein complex was analyzed by SDS PAGE elec trophoresis. These experiments demonstrated that a common 45-kd polypep tide was capable of interacting with both EIA and cAMP-inducible promot ers. The 45-kd polypeptide binding to the adenovirus ElA-inducible promot ers that contain eRE-like sequences is referred to as ATF (adenovirus transcription factor). The UV c rosslink ing results suggest that a common 43-45-kd protein, ATF/CREB, is involved in the activation of ElA-inducible or cAMP-inducible sets of genes that respond to different induction signals. Hai et al (17) reported the purification of a series of polypeptides that migrate as 43 and 47-kda proteins by CRE-affinity chromatography utilizing eRE-like sequences from the adenovirus E4 p rom oter. These polypeptides represent a family of proteins that are related by DNA-binding specificity and imm unor eactivity. This family of immunologically related functions includes multiple forms of ATF and API. API, activator protein 1, has been shown to mediate phorbol ester action (27). The recognition sequence of API is similar, but not identical, to the ATF-binding site (the API-binding site is GTGAGT�A, whereas ATF is TGAgJT�A). The immunological cross reactivity and similar DNA-binding specificity between ATF and API sug gests that these proteins contain similar amino acid sequences and may have originated from a common ancestral gene.
TRANSCRIPTIONAL ACTIVITY OF CREB Although the 43-kd protein has been purified to apparent homogeneity by a number of laboratories (24, 31, 55) an d has been shown to bind specifically to
cAMP-responsive elements, a functional in vitro transcription assay is es sential to show that the 43-kd protein is the somatostatin gene transactivator. Andrisani et al (4) developed a functional in vitro transcription assay for the rat somatostatin promoter. HeLa cell nuclear extracts were prepared accord ing to Shapiro et al (43). Transcription from the somatostatin promoter was monitored by linking it to the bacterial CAT gene. In addition, the adenovirus major late promoter (MLP) was similarly fused to the eAT structural gen e This MLP-CAT construct served as an internal control in the in vitro transcription assays. Transcripts initiated from the somatostatin and MLP promoters were detected by a primer extension analysis. The transcriptional activity of the 43-kd protein was examined in in vitro transcription assays after the endogenous eRE-binding activities were de pleted from the HeLa cell extracts (4). This was accomplished by passing the transcriptionally active extract through a CRE-oligonucleotide avidin column. .
800
ANDRISANI & DIXON
While the depleted extract was unable to transcribe the somatostatin promot
er, transcription from the MLP promoter, which served as an internal control, was unaffected. Addition of the purified 43-kd protein restored transcription to the somatostatin promoter, thus proving that the 43-kd protein is the somatostatin gene transactivator.
ACTION OF CREBIATF
Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
The mechanism of action of eukaryotic transactivator proteins is largely unknown. With the availability of purified CREB/ATF protein and the es tablishment of CREB/ATF-dependent in vitro transcription systems, a num ber of questions pertaining to the action of CREBIATF are beginning to be addressed.
What is the Role of CREBIATF in the Interaction with the Transcriptional Complex? The transcriptional complex is composed of RNA polymerase II and a number of common transcription factors, such as TFIID, TFIIB, and TFIIE, which must be assembled in an ordered manner into a functional complex for initiation to
occur (38, 39, 42). Early studies have shown that the TATAA
box and cap site are necessary and sufficient for accurate transcription initia
tion. Subsequent studies (19) suggest that upstream activating sequences and. their associated factors increase the rate of transcription probably by facilitat ing the association of the common transcription factors under conditions where these interactions are rate-limiting. The studies by Horikoshi et al
(23) and Hai et al (16) have addressed this adenovirus E4 promot
question by utilizing the ATF purified protein and the
er. DNase I footprint studies showed that the ATF protein interacts with the TATA box binding factor, TFIID, and this interaction facilitates the forma tion of the initiation complex
(23). Functional in vitro transcription assays
conducted with the ATF-dependent E4 promoter showed that ATF acts prior to initiation of transcription, during the first rate-limiting step referred to as the template-commitment step (16). These data suggest that ATF and TFIID initially bind to the promoter to form the template-committed complex and ,
this interaction promotes the binding of factors TFIIE, TFIlB, and RNA polymerase II.
How Does CREB Bind to DNA? The somatostatin promoter CRE element, TGAC I GTCA, is a perfect palin drome. In prokaryotes, numerous transcription factors bind to palindromes as
dimers; the monomers have reduced DNA binding affinity and transcriptional activity
(36).
Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
SOMATOSTATIN
801
The functional importance of the somatostatin promoter palindromic CRE sequence was studied by constructing SST-CAT p1asmids containing 0, Yz, or 1 CRE (54). The response of these constructs to forskolin induction was examined by transient expression assays in PC12 cells. Forskolin, a post receptor activator of adenylyl cyclase, induces transcription of 1 CRE containing SST-CAT plasmid by 14-fold in PC12 cells, whereas the con structs containing no CRE or Yz CRE were induced two and threefold, respectively. These results point to the functional importance of the palin drome in somatostatin gene transcription and suggest that the 43-kd CREB protein may act as a dimer. How Does CREB Become Activated by cAMP Triggered Events? The purified 43-kd CREB protein is an excellent substrate for the cAMP dependent protein kinase A in vitro (54, 55). Phosphorylation takes place on serine residues, as shown by phosphoamino acid analysis (54, 55). In addi tion, phosphorylation of CREB protein occurs in vivo (31). This phosphoryla tion is stimulated three to fourfold in PC12 cells treated with forskolin, and grown in the presence of 32p-orthophosphate. Phosphorylation does not alter the binding affinity of the 43-kd CREB protein for the CRE, however. Extracts prepared from forskolin-treated cells do not display increased CRE binding affinity as shown for the cAMP-responsive a-hCG promoter (10). These data suggest that phosphorylation may influence the transcription activation potential of CREB. Yamamoto et al (54) added the catalytic subunit of the cAMP-dependent kinase A to in vitro transcription reactions with extracts isolated from PC12 cells. A 20-fold induction in the transcription directed from the somatostatin p ro mo te r was observed, which suggests that cAMP-dependent protein kinase A acts directly on the CREB protein. A model proposed by Hanson & colleagues (40) on the mechanism of cAMP-stimulated transcription is diagrammed in Figure 1.
CLONING OF THE cAMP-RESPONSIVE DNA-BINDING PROTEIN Isolation of cDNA clones encoding DNA-binding proteins can be achieved via several independent screening routes. One approach utilizes synthetic oligonucleotide probes deduced from the amino acid sequence obtained from the purified protein. Although this is a biochemically sound approach, diffi culties can be encountered with low yields of the purified transactivator proteins. Also, the purified proteins often have blocked NHz-termini; thus
Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
802
Figure I
ANDRISANI
& DIXON
Model for cAMP regulation of gene transcription.
(A) The CRE-binding protein
(stippled triangle) binds to the CRE-consensus sequence. This binding stimulates basal transcrip tion by interacting with proximal promoter elements such as the TATAA box binding factor TFlID (diagonally lined box) and/or RNA polymerase II. E lev at ion of cAMP levels induces phosphorylation of the CRE-binding protein, which further stimulates transcription by at least
two general mechanisms (B and C).
(B) Phosphorylated CREB recruits more transcription (C) Phosphorylated CREB
factors and/or increases the interaction between these factors.
interacts with a non-DNA binding protein (solid box), which allows the formation of a higher order protein complex. Figure 1 reproduced with permission from Roesler et al (40)
internal peptides must be generated from the protein that in tum must be isolated and sequenced. Alternatively, antibodies raised against the purified protein or to synthetic peptides can be utilized as a screening tool in Agtll expression libraries. Relatively large amounts of protein, however, are also necessary for produc ing antibodies. Yet another approach, which is uniquely applicable to the isolation of cDNAs encoding sequence-specific DNA-binding proteins, is based on the renaturability and sequence-specific DNA-binding characteristics of this class of proteins. Agtll libraries expressing hybrid /3-galactosidase fusion proteins are screened with ligated DNA probes containing the binding site of interest (48, 52). This technique has been successfully utilized for the isolation of a number of cDNAs encoding DNA-binding proteins (22, 48, 52). Habener's laboratory rellorted the first isolation of a CREB-cDNA clone (22). This clone was obtained by screening a placental Agtll library for the expression of specific eRE-binding protein(s) and utilizing aCRE-consensus
SOMATOSTATIN
803
sequence as the radioactive probe. The isolated cDNA clone encodes a protein of 326 amino acids (MW 35,044) and displays sequence-specific CRE binding properties. It also belongs to a class of proteins that contain the structural motif referred to as a leucine zipper (26). This class of proteins, which includes myc, fos, C/EBP, GCN4, and c-jun, contains an array of leucine residues spaced with a periodicity of seven amino acid residues in a predicted amphipathic a-helix. The leucine side chains extending from one a-helix interdigitate with those displayed from a similar a-helix of a second polypeptide, which facilitates dimerization. Computer analysis of sequence similarity between the 35,000 CRE-binding protein and c-jun revealed a single region of 61 % amino acid identity located at the carboxy-terminal end of the protein. These regions of similarity are located adjacent to the leucine zipper regions of the protein and constitute the basic domain. It has been suggested that the similarity of amino acid sequence in this domain may reflect the fact that these proteins have similar palindromic binding domains; TGACGTCA for CRE-binding protein vs TGAGTCA for c-jun. Montminy's laboratory reported the isolation of a CREB-encoding cDNA from a rat PC12 Agtll library (13). This cDNA clone was isolated utilizing oligonucleotide probes that were synthesized from amino acid sequence information obtained from tryptic peptide fragments of the purified 43-kd CREB protein. The predicted amino acid sequence of the human (22) and rat (13) CREB eDNA clones are quite similar. The predicted mass of the CREB protein encoded by the rat cDNA clone is 37 kd. The difference in the molecular weight between the deduced amino acid sequence derived from the cloned human and rat CREB cDNAs, 35 kd and 37 kd, respectively, and the purified 43-kd CREB protein has not been resolved. Post-translational mod ifications, such as phosphorylation and glycosylation, may account for some of this apparent difference. Montminy et al (13) noted several sites within the CREB molecule that might serve as potential sites of phosphorylation by the cAMP-dependent kinase A, kinase C, and casein kinase II. The functional significance of these sites in the activity and regulation of the CREB protein will obviously constitute an exciting area for future study. The availability of the CREB cDNA clones should provide the tools necessary to increase our understanding of the structure/function of the CREB molecule in regulating somatostatin gene transcription. These observations are likely to reflect on our understanding of the entire family of cAMP regulated genes.
Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
=
SUMMARY Since the cloning of the somatostatin eDNA and gene, the efforts of a number of laboratories have contributed to the understanding of somatostatin gene expression and regulation. A genetic element located approximately 40 nu-
804
ANDRlSANI & DIXON
cleotides upstream from the somatostatin mRNA cap site is important in the expression and cAMP-induced transcription of this neuropeptide gene. The identification of this genetic element has enabled the i denti fication purifica ,
tion, and cloning of a new class of proteins: the somatostatin gene transactiva tor named CREB. The availability of cloned CREB will permit studies designed to understand not only the mechanism of somatostatin gene expres sion and r egulation but also the pathway of signal transduction tri ggered by cAMP-stimulated events. Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
,
NOTE ADDED IN PROOF The cDNA sequence encoding a different CRE binding protein named CRE-BPI has been reported by Maekawa et al (29a). The human CRE-BPI clone encodes a 54.5-kd protein, and it is distinct from the CREB clones isolated by Habener et al (22) and Gonzalez et al (13). ACKNOWLEDGMENTS
This work was supported in part by grants from the National Institutes of Health. This is Journal Paper No. 12,031 from the Agricultural Experiment a tion Station, Purdue University.
Literature Cited 1 . Andrews, P. c., Dixon, J. E. 1 981 . Isolation and structure of a peptide hor mone predicted from an mRNA se quence: a second somatostatin from the catfish pancreas. 1. Bioi. Chern. 256:8267-70 2. Andrisani, O. M., Hayes, T. E., Roos, B., Dixon, J. E. 1987. Identification of the promoter sequences involved in the cell specific expression of the rat so matostatin gene. Nucleic Acids Res.
15:5715-28 3. Andrisani, O. M., Pot, D. A., Zhu, Z., Dixon, J. E. 1 988. Three sequence
specific DNA protein complexes are formed with the same promoter element essential for expression of the rat so matostatin gene. Mol. Cell. BioI.
8:1947-56
4. Andrisani, O. M., Zhu, Z., Pot, D. A., Dixon, J. E. 1989. In vitro transcription directed from the somatostatin promoter is dependent upon a purified 43 kda DNA-binding protein. Proc. Natl. Acad.
Sci. USA 86:2181-85 5. Aron, D. C., Muszynski, M., Birn
baum, R., Sabo, S., Roos, B. 1981. Somatostatin elaboration by monolayer cell cultures derived from transplantable rat medullary thyroid carcinoma: syn ergistic stimulatory effects of glucagon and calcium. Endocrinology 109: 183034
6. Berk, A. J. 1 986. Adenovirus promoters and EIA transactivation. Annll. Rev. Genet. 20:45-79 7. Carthew, R. W., Chodosh, L. A., Sharp, P. A. 1 985. An RNA polymerase
II transcription factor binds to an up stream element in the adenovirus major late promoter. Cell 43:439-48 8. Comb, M., Birnberg, N. C., Scasholtz, A., Herbert, E., Goodman, H. M. 1986. A cyclic AMP- and phorbol ester ind ucible DNA element. Nature 323: 353--56 9. Cortes, P., Buckbinder, L., Leza, A. M., Rak, N., Hearing, P., et aI. 1988. EivF, a factor required for transcription of the Adenovirus ElV promoter binds to an element involved in EIA-dependent activation and cAMP induction. Genes
Dev. 2:975-90 10. Delegeane, A. M., Ferland, L. H Mel lon, P. L. 1987. Tissue specific enhanc .•
-
er of the human glycoprotein hormone a-subunit gene: dependence on cyclic AMP inducible elements. Mol. Cell. BioI. 7:3994-4002 II. Eng el, D. A., Hardy, S., Shenk, T. 1988. cAMP Acts in synergy with ElA protein to activate transcription of the Adenovirus early genes 14 and ElA. Genes Dev. 2:1517-28 12. Funckes, C. L., Minth, C. D., De schenes, R., Magazin, M., Tavianini,
Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
SOMATOSTATIN M. A., et aI. 198 3. Cloning and characterization of a mRNA-encoding rat preprosomatostatin. J. Bioi. Chern. 258:8781-87 13. Gonzalez, G. A., Yamamoto, K. K., Fischer, W. H., Karr, D. , Menzel, P., et aI. 1989. A clus ter of phosphorylation sites on the cyclic AMP-regulatcd nu clear factor CREB predicted by its se quence. Nature 337:749- 52 14. Goodman, R. H., Aron, D. C., Roos, B. A. 1983. Rat preprosomatostatin: structure and processing by microsomal membranes. J. Bioi. Chern. 258:5570-
73 15. Goodman, R. H., Jacobs, J. W., Chin, W. W., Lund, P. K., Dee, P. C., Habener, 1. F. 1980. Somatostatin-28 encoded in a cloned cDNA obtained from a rat m ed ullary thyroid carcinoma. Proc. Natl. Acad. Sci. USA 77:586973
16. Hai, T., Horikoshi, M., Roeder, R. G.,
Green, M. R. 1988. Analysis of the role of the transcription factor ATF in the assembly of a functional preinitiation complcx. Cell 54:1043--51 17. Hai, T., Liu, F., Allegretto, E. A., Karin, M., Green, M. 1988. A family of imm un ol ogically related transcription factors that includes multiple forms of ATF and AP -l. Genes Dev. 2:1216--25 18. Hardy, S., Shenk, T. 1988. Adenoviral control regions activated by EIA and the cAMP response element bind to the same factor. Proc. Natl. Acad. Sci.USA
85:4171-75
19. Hawley, D. K., Roeder, R. G. 1987. Functional steps in transcription initia tion and reinitiation from the major late promoter in a HeLa nuclear extract. J. Bioi.Chern. 262:3452-61 20. Hayes, T. E., Dixo n, J. E. 1985. Z DNA in the rat somatostatin ge ne . J.
BioI. Chern. 260:8145--56
21. Hobart, P., Crawford, R., Shen, L.-P., Pictet, R., Rutter, W. J. 1980. Cloning and sequence analysis of cDNAs encod ing two distinct somatostatin precursors found in the endocrine pancreas of an glerfish. Nature 288 : 137--41 22. Hoeffler, J. P., Meyer, T. E., Yun, Y., Jameson, L. J., Habener, J. F. 1988. Cyclic AMP-responsive DNA-binding protein: structure based on a cloned placental cDNA. Science 242:1430-33 23. Horikoshi, M., Hai, T., Liu, Y. S., Green, M. R., Roeder, R. G. 1988. Transcription factor ATF interacts with the TATA factor to fac ilit at e establish ment of a prei ni tiatio n co mpl ex. Cell
54: 1033--42
24. Hurst, H. C., Jones, N. C. 1987. Identification of factors that interact with
805
the ElA-inducible Adenovirus E3 pro moter. Genes Dev. 1:1132-46 25. Kadonaga, J. T., Tjian, R. 1986. Affin ity purification of sequence-specific DNA binding proteins. Proc. Natl.
Acad. Sd. USA 83:5889-93
26. Landschulz, W. H., John son , P. F., McKnight , S. L. 1988. The l eucin e zi p per: a hypothetical structure common to a new class of DNA binding proteins. Science 240: 1759-64 27. Lee, W., Mitchell, P., Tjian, R. 1987 . Purified transcription factor AP-I in teracts with TPA·inducible enhancer ele ments. Cell 49:741-52 28. Lin, Y. S., Green, M. R. 1988. Interac tion of a common cellular transcription factor, ATF, with regulatory elements in both EIA and cyclic AMP-inducible promoters. Proc. Natl.Acad. Sci. USA 85:3396--3400 29. Magazin, M., Minth, C. D., Funckes, C. L., Deschenes, R., Tavianini, M. A., Dixon, J. E. 1982. Sequence of a cDNA encoding pancreatic preprosomatostat in-22. ProC. Natl. Acad. Sci. USA 79: 5152-56 29a. Maekawa, T., Sakura, H., Kanei-Ishii, C., Sado, T., Yo shi mura , T., et al. 1989. Leucine zipper structure of the protein CRE-BPI binding to cyclic AMP response element in brain. EMBO J.
8:2023-28
30. Minth, C. D., Taylor, W. L., Magazin, M., Tavianini, M. A., Collier, K., et al. 1982. The structure of cloned DNA complementary to catfish pancreatic somatostatin-14. J. Bioi. Chern. 257 : 10372-77 31. Montminy, M. R., Bilezikjian, L. M. 1987. Binding of a nuclear protein to the cyclic-AMP response element of the somatostatin gene. Na/ure 328:17578 32. Montminy, M. R., Goodman, R. H., Horovitch, S. J., Habener, J. F. 1984. Primary structure of a gene encoding rat preprosomatostatin. Proc. Natl. Acad.
Sci. USA 81:3337--40 33. Montm iny M. R., Low M. J., Tap ia ,
,
Arancibia, L., Reichlin, S., Mandel, G., Goodman, R. D. 1986. Cyclic AMP regulates somatostatin mRNA accumu lation in primary diencephalic cultures and in transfected fibroblast cells. J.
Neurosci.6:1171-76
34. Montminy, M. R., Sevarino, K. A., Wagner, J. A., Mandel, G., Goodman, R. H. 1986. Identification of a cyclic AMP -responsiv e element within the r at
somatostatin gene. Proc. Natl. Acad. Sci. USA 83:6682-86
35. Oyama, H., Bradshaw, R. A., Bates, O.
J., Permutt, A. 1980. Amino acid se -
Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
806
ANDRISANI & DIXON
quence of catfish pancreatic somatostat in I. J. Bioi. Chern. 255:2251-54 36. Ptashne, M. 1987. A Genetic Switch. Cambridge, MA: Cell Press & Black well Sci. 2nd ed. 37. Reichlin, S. 1983. Somatostatin. New Engl. J. Med. 309:1495-1501 38. Reinberg, D., Horikoshi, M., Roeder, R. G. 1987. Factors involved i n specific transcription in mammalian RNA polymerase II. J. BioI. Chern. 262:3322-30 39. Reinberg, D., Roeder, R. G. 1987. Fac tors involved in specific transcription in mammalian RNA polymerase II. J. Bioi. Chern. 262:3331-37 40. Roesler, W. J., Van denbark , G. R., Hanson, R. W. 1988. Cyclic AMP and the induction of eukaryotic gene transcription. J. Bioi. Chern. 263:906366 41. Sassone-Corsi, P. 1988. Cyclic-AMP induction of early Adenovirus promoters involves sequences required for EIA trans-activation. Proc. Natl.Acad. Sci. USA 85:7192-96 42. Sawadogo, M., Roeder, R. G. 1985. Interaction of a gene specific transcrip tion factor with the adenovirus maj or late promoter upstream of the TATA box region. Cell 43:165-76 43. Shapiro, D. J., Sharp, P. A., Wahli, W. W., Keller, M. J. 1988. A high efficiency HeLa cell nuclear transcrip tion extract. DNA 7:47-55 44. Shen, L.-P., Pictet, R. L., Rutter, W. J. 1982. Human somatostatin I: sequence of the eDNA. Proc. Natl. Acad. Sci. USA 79:4575-79 45. Shen, L.-P., Rutter, W. J. 1984. Se quence of the human somatostatin I gene. Science 224:168--71 46. Siebenlist, U., Gilbert, W. 1980. Con tacts between E. coli RNA polymerase and an early promoter of phage T7. Proc. Natl. Acad. Sci. USA 77:122-26 47. Silver, B. J. , Bokar, J. A., Virgin, J. B., Vallen, E. A., Milsted, A., Nilson,
J. H. 1987. Cyclic AMP regulation of the human glycoprotein hormone cr subunit gene is mediated by an 18-base pair element. Proc. Natl. Acad. Sci. USA 84:2198--2202 48. Singh, H., LeBowitz, J. H., Baldwin, A. S. Jr., Sharp, P. A. 1988. Molecular cloning of an enhancer binding protein: isolation by screening of an expression library with a rccognition site DNA. Cell 52:415-23 49. Tavianini, M. A., Hayes, T. E., Maga zin, M. D., Minth, C. D., Dixon, J. E. 1984. Isolation, characterization, and DNA-sequence of the rat somatostatin gene. J. Bioi. Chern. 259:11798-11803 50. Taylor, W. L., Collier, K. J., De sc henes , R. J., Wei th , H. L., Dixon, J. E. 1981. Sequence analysis of a cDNA coding for a pancreatic precursor to somatostatin. Proc. Natl. Acad. Sci. USA 78:6694-98 51. Vale, W., Rivier, C., Brown, M. 1977. Regulatory peptides of the hypothala mus. Annu. Rev. Physiol. 39:473-527 52. Vinson, C. R., LaMarco, K. L., John son, P. F., Landschulz, W. H., McKnight, S. L. 1988. In situ detection of sequence-specific DNA bin di ng activ ity specified by a recombinant bacterio phage. Genes Dev. 2:801-6 53. Wynshaw-Boris, A., Gross Lugo, T., Short, J. M., Fournier, R. E. K., Han son, R. W. 1984. Identification of a cAMP regulatory region in the gene for rat cytosolic phosp hoeno lpyru vate car boxykinase (GTP). J. Bioi. Chern. 259:12161-69 54. Yamamoto, K. K., Gonzalez, G. A., Biggs, W. H. III, Montminy, M. R. 1988. Phosphorylation-induced binding and transcription efficacy of nuclear fac tor CREB. Nature 334:494-98 55. Z hu, Z., Andrisani, O. M., Pot, D. A., Dixon, J. E. 1989. Purification and characterization of a 43 kda transcription factor required for rat somatostatin gene expression. J. Bioi. Chern.264:6550-56
Further
Quick links to online content Annu. Rev. Physioi. 1990. 52:793-806 Copyright © 19.90 by Annual Reviews Inc.
All
rights reserved
SOMATOSTATIN GENE Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
REGULATION O. M. Andrisani and J. E. Dixon Biochemistry Department, Purdue University, West Lafayette, Indiana 47907 KEY WORDS:
cAMP, cAMP-responsive element (eRE), eRE-binding (CREB), transactivator, cloning of CREB
INTRODUCTION Somatostatin gene regulation is important not only because of the wide-spread biological activities of the gene product, but also because it was one of the first genes shown to be regulated by cAMP (33). Recently, the somatostatin gene has taken on added interest because a protein important in recognizing the DNA sequences responsible for cAMP regulation has been cloned by the research groups of Habener et al (22) and Montminy et al (13). This review will briefly cover the background associated with somatostatin gene structure and will focus primarily on recent developments associated with somatostatin gene regulation. The structure and functions of the polypeptide hormone somatostatin have been studied for many years in several species (37, 51). The 14-residue form of somatostatin h as been conserved in all organisms examined. In addition, several oth er m embers of the s omatostatin family have been identified, which include a 28-residue somatostatin from the anglerfish (21) and a 22-residue somatostatin from the catfish (35, 1). cDNAs have been isolated and se quenced that encode each of these peptides (12,14,15,21,29,30,44,50). The gene encoding somatostatin-14 has been isolated from a human gene library by Shen & Rutter (45) and from a rat gene library both by Montminy et al (32) and our laboratory (49). The transcriptional unit of the rat somatostatin gene includes exons of 238 and 367 base pairs (bp) separated by one intron of 621 bp. The intron is 793 0066-4278/90/0315-0793$02.00
794
ANDRISANI & DIXON
located
between the codons for GIn ( -57) and Glu (-56) of pre
prosomatostatin. Analysis of the nucleotide sequence 5' to the start of transcription reveals a number of sequences that may be involved in the expression of the somatostatin gene. A variant of the TATA box, TTTAAA, lies 26 bp upstream from the start of transcription, and a sequence homologous to the CAAT box, GGCTAAT, occurs 92 bp upstream from the transcription initiation site. A long alternating purine-pyrimidine stretch, (GThs, which is similar to Z-DNA-forming sequences in other genes, lies
Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
628 bp 5' to the start of transcription (20). Southern blot analysis of rat DNA suggests that a single gene is present that codes for the preprohormone that is ultimately processed into somatostatin-14. The human gene also consists of two exons separated by an intron of 877 bp. The exon-intron junctions are conserved in the rat and human genes.
AN OVERVIEW OF TRANSCRIPTION The past several years have witnessed a tremendous increase in our knowl edge of how genetic elements of eukaryotic genes regulate transcription through their interaction with cellular transcription factors. Genetic elements (promoters and enhancers) of eukaryotic genes have been defined by a combination of in vitro mutagenesis and gene transfer studies. These genetic elements, which are modular in nature, function through sequence-specific interactions with cellular protein factors. The sequence-specific nature of the interaction of the cellular factors with the genetic cis-acting elements is a powerful property of this class of proteins. Based on the sequence-specific binding of the transcription factors, a number of assays have been developed that have led to the identification and purification of a number of these proteins, also termed transactivators. The general principle that appears to be conSistently reinforced is that protein-DNA interactions as well as protein protein interactions will play dominant roles in defining the course of events that result in the expression and regulation of eukaryotic genes.
DEFINITION OF THE CIS-ACTING ELEMENT REQUIRED FOR SOMATOSTATIN GENE TRANSCRIPTION In order to define the cis-acting elements required for expression of the rat somatostatin gene, deletions of the 5' non-transcribed region of the gene were cloned in front of a reporter gene, and the activity of these deletions was determined by gene transfer experiments in the appropriate cell lines. Ideally, the host cell line should express the endogenous gene of interest; thus agents
SOMATOSTATIN
795
modulating expression of the transfected gene should also modulate expres sion of the endogenous promoter. Andrisani et al (2) utilized the CA-77 cell line system to introduce 5' deletions of the rat somatostatin promoter aligned to transcribe the chloram phenicol acetyltransferase (CAT) reporter gene. The CA-77 cell line es tablished by Roos & colleagues (5) is a neuronally derived cell line that originated from a rat medullary thyroid carcinoma. This cell line expresses elevated levels of somatostatin mRNA and has been utilized as the mRNA
Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
source for the isolation of somatostatin eDNA clones (12, 15). The cis-acting element required for maximal expression of the somatostatin gene was local ized between position -60 to -43 of the promoter. Deletion of the sequences between nucleotide positions -47 and -42 reduced the activity of the promoter to 9% of the wild-type level in CA-77 cells, which suggests that the deleted sequences constitute an important element required for expression of the somatostatin promoter. Montminy et al (34) introduced similar 5'-end deletions into PCl2 cells, a neuronally derived pheochromocytoma cell line. Although PCl2 cells do not express the endogenous somatostatin gene, they are cAMP-responsive, there by providing a system for the study of cAMP effects on neuropeptide gene transcription. Also, a mutant PC12 cell line exists that is deficient in cAMP dependent
protein kinase.
These
investigators (34) demonstrated that
transcription from the somatostatin promoter of the transfected SST-CAT plasmid is inducible by cAMP. This cAMP-induced transcription from the somatostatin promoter requires the presence of a genetic element located between position -71 to -48 of the somatostatin promoter. These are the same sequences required for expression of the somatostatin gene in CA-77 cells (2), although the observed transcription from the somatostatin promoter in the CA-77 cell line does not require nor respond to cAMP induction. Montminy et al (33) showed that the sequences of the somatostatin promoter between nucleotide positions -60 to -29, when placed in front of the SV40 promoter (which is cAMP non-responsive), confer cAMP-responsiveness in the SST-SV40-CAT construct. The cAMP response occurs only in wild-type PC12 cells and not in the kinase A-deficient PCl 2 cell line. These results demonstrate the involvement of the cAMP pathway in the transcriptional effect of cAMP on the somatostatin promoter. Comparison of the cAMP-responsive element present within the somato statin gene to sequences near the promoters of other genes known to be regulated by cAMP (8, 10, 47, 53) suggest the TGACGTCA sequence as the cAMP consensus (Table 1). The TGACGTCA sequence is referred to as CRE for cAMP-responsive element. The TGACGTCA module is also present and required for function in viral
796
ANDRISANI & DIXON
TABLE 1
Genes containing the TGACGTCA (CRE) consensus Distance to
Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
Gene
Sequence
the 5' cap site in bp
Somatostatin
TTGGCTGACGTCAGAGAGAGAG
-48
PEPCK
GCCCCTTACGTCAGAGGCGAGC
VIP
TACTGTGACGTCTTTCAGAGCA
-90 -75 -92
Proenkephalin
GGGCCTG CGTCAGC
a-Chorionic gonadotrophin
AAAATTGACGTCATGG
-122
c-Fos
CCCAGTGACGTAGGA
Ad2 E2
CTGGAGATGACGTAGTTTTCGCGCTTAAATTT
-66 -173 -140 -178 -159 -163 -163 -61 -76
Ad2 EIA
ATAGTCAGCTGACGTGTAGTGTATTTATACCC
-43
Ad2,S EtA
ACTTTGACCGTTTACGTGGAGACTCGC
-117
Fibronectin Cytomegalovirus enhancer HTLV-l/ LTR Bovine leukemia virus LTR Adenovirus 5 (Ad5) E4 Ad2 E4 Ad2 E3
ACAGTCCCCCGTGACGTCACCCGGGAGCCC CCCATTGACGTCAATGGGAGTT GGCCCTGACGTCCCTCCCCCCC GACAGAGACGTCAGCTGCCAGA GGAAGTGACGTAACGTGGGAAAACGG AAATGGGAAGTGACGTATCGTGGGAAAAC GCGGGCGGCTTTCGTCACAGGGTGCGGTC
promoters such as the ElA inducible early (EIA, E2a, E3, E4) adenovirus promoters (6, Table 1). Sassoni-Corsi (41) utilized deletion mutants of the E2a and E3 adenovirus promoters to show by transient expression assays in PC12 cells that a related CRE-like sequence, TACGTCA, is required for both cAMP-responsiveness and EIA transactivation. An interesting observation reported in this study is that the action of the E l A protein in transactivating the E2a and E3 promoters is maintained in the mutant PC12 cell line, which is deficient in cAMP-dependent protein kinase. Engel et al (11) utilized the cAMP-responsive 549 cell line to study cAMP induction of the viral EIA-inducible early promoters during the course of adenovirus infection. It was observed that transcription of the EIA inducible E4 gene utilizing wild-type adenovirus was induced IS-fold in the presence of cAMP treatment. The level of induction of E4 mRNAs was only fourfold when utilizing EIA viral mutants. These investigators concluded that although no changes were observed in the levels of EIA protein during the course of induction, preexisting ElA protein acts in synergy with events triggered by cAMP to induce transcription of the viral early genes. Although the studies described in this section point to the functional importance of the CRE consensus sequence in the expression of the cAMP-responsive and EIA-inducible promoters, the mechanism of cAMP- and ElA-mediated events is not yet understood.
797
SOMATOSTATIN
IDENTIFICATION OF THE CELLULAR PROTEIN FACTORS THAT INTERACT WITH THE RAT SOMATOSTATIN CRE ELEMENT In vitro, protein-DNA-binding assays such as DNase I footprinting and gel
Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
retardation assays (7, 25, 46) have been utilized for the identification, characterization, and purification of cellular transactivator proteins. The suc cess of these in vitro assays is based on the property that most transactivator p roteins possess: high affinity and sequence-specific binding to defined re gions of DNA. DNase I footprint assays can be used to identify regions of a radiolabeled DNA fr agment that are protected from DNase I digestion be cause of the sequence-specific binding of protein factors. DNase I footprint assays utilizing the radiolabeled somatostatin promoter DNA as a probe and cell extracts from PC12 (31), CA-77 (3), or HeLa (24,28) cells have shown that the - 55 to - 35 region of the somatostatin promoter, which harbors the CRE, is protected from DNase I digestion. Gel retardation assays have also been used to identify factor(s) binding to the eRE-containing region of the rat somatostatin gene (3). A radiolabeled DNA fra gment containing the CRE element of th e somatostatin promoter was utilized as a probe and allowed to interact in vitro with extracts prepared from various cell lines or tissues. The DNA/protein complexes were analyzed on low ionic strength polyacrylamide gels. Three sequence-specific DNA/protein complexes have been identified in e xtracts of many different cell types. These complexes show competitive b i nding to other eRE-consensus sequences, but do not compete for binding with fragments derived from a variety of other DNAs including the f3-globin promoter, maj or late promoter, or upstream sequences of the somatostatin promoter. The activities forming the three sequence-specific complexes are chromatographically separable, which suggests that distinct entities are responsible for the formation of the three sequence-specific complexes (3). Similar observations are reported in the study by Hardy & Shenk (18), who
utilized HeLa cell extracts fractionated on an ion exchange column. These fractions were measured by the gel retardation assay with the adenovirus E4 CRE-like element and the somatostatin CRE as probes. Also, Cortes et al (9) observed multiple eRE binding acti vities after chromato graphic fractionation of HeLa extracts. These activities were assayed both by in vitro DNA protein assays using the E4 and somatostatin CRE elements and functional in vitro transcription assays. Although the gel retardation and DNase I footprinting assays have im p licated the CRE consensus in sequence-specific binding of cellular protein factor(s), the direct involvement of the eRE in the formation of these -
-
sequence-specific complexes has been determined by in vitro methylation
798
ANDRISANI & DIXON
Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
interference assays (3). It was shown that the G residues within the TGACG TCA core element come into direct contact with the protein factor(s) forming the DNA/protein complexes. Synthetic oligonucleotides containing point mutations of the G residues within the TGACGTCA palindrome fail to compete for binding in vitro. Similar methylation interference data have been reported by Green's laboratory (28), utilizing the early adenovirus promoter E4, somatostatin, and other CRE-containing promoters.
PURIFICATION OF A CRE-BINDING 43-kd PROTEIN (CREB) Purification to apparent homogeneity of a number of sequence-specific DNA binding proteins has been achieved by use of conventional chromatography in combination with a sequence-specific DNA-affinity chromatography step. Kadonaga & Tjian (25) reported the development of a sequence-specific DNA-affinity column for the purification of the transcription factor SPl. The DNA-affinity column was constructed by coupling multimeric units of dou ble-stranded synthetic oligonucleotides containing the binding site of interest to cyanogen bromide-activated sepharose. An alternative method for con structing a high capacity DNA-affinity column involves the incorporation of biotinylated nucleotides into the ends of concatemerized DNA (4). The biotinylated DNA is subsequently bound by avidin, which has been im mobilized on agarose. In the last two years, a number of laboratories have employed CRE sequence-specific affinity chromatography for the purification of CRE binding cellular transcription factors. Purification of a 43-kd protein from PC12 extracts by a somatostatin CRE-sequence-specific affinity column was initially reported by Montminy & Bilezikjian (31). This 43-kd protein, re ferred to as CREB for CRE-binding, protects the -55 to -32 region of the somatostatin promoter from DNase I digestion. Zhu et al (55) reported the purification of a 43-kd protein from rat brain extracts by employing ion exchange chromatography for the fractionation of three CRE-binding activi ties followed by two cycles of DNA-affinity chromatography of the major CRE-binding fractions. This 43-kd protein was purified to an apparent single band on SDS gels. It similarly binds in a sequence-specific manner to the somatostatin CRE-containing promoter fragment as shown by Southwestern blots and DNase I footprints. A 45-kd protein has also been purified by Hurst & Jones from HeLa cell extracts (24). These investigators used the sequences from the E1A-inducible adenovirus E3 promoter for constructing the sequence-specific DNA-affinity chromatography column. To elucidate the relationship between the proteins purified by CRE-affinity
Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
SOMATOSTATIN
799
chromatography utilizing the eRE-consensus sequence of cAMP-responsive or ElA-inducible genes, Lin & Green (28) employed UV crosslinking ex periments to attach the labeled eRE DNA covalently to the bound protein. The covalent DNA-protein complex was analyzed by SDS PAGE elec trophoresis. These experiments demonstrated that a common 45-kd polypep tide was capable of interacting with both EIA and cAMP-inducible promot ers. The 45-kd polypeptide binding to the adenovirus ElA-inducible promot ers that contain eRE-like sequences is referred to as ATF (adenovirus transcription factor). The UV c rosslink ing results suggest that a common 43-45-kd protein, ATF/CREB, is involved in the activation of ElA-inducible or cAMP-inducible sets of genes that respond to different induction signals. Hai et al (17) reported the purification of a series of polypeptides that migrate as 43 and 47-kda proteins by CRE-affinity chromatography utilizing eRE-like sequences from the adenovirus E4 p rom oter. These polypeptides represent a family of proteins that are related by DNA-binding specificity and imm unor eactivity. This family of immunologically related functions includes multiple forms of ATF and API. API, activator protein 1, has been shown to mediate phorbol ester action (27). The recognition sequence of API is similar, but not identical, to the ATF-binding site (the API-binding site is GTGAGT�A, whereas ATF is TGAgJT�A). The immunological cross reactivity and similar DNA-binding specificity between ATF and API sug gests that these proteins contain similar amino acid sequences and may have originated from a common ancestral gene.
TRANSCRIPTIONAL ACTIVITY OF CREB Although the 43-kd protein has been purified to apparent homogeneity by a number of laboratories (24, 31, 55) an d has been shown to bind specifically to
cAMP-responsive elements, a functional in vitro transcription assay is es sential to show that the 43-kd protein is the somatostatin gene transactivator. Andrisani et al (4) developed a functional in vitro transcription assay for the rat somatostatin promoter. HeLa cell nuclear extracts were prepared accord ing to Shapiro et al (43). Transcription from the somatostatin promoter was monitored by linking it to the bacterial CAT gene. In addition, the adenovirus major late promoter (MLP) was similarly fused to the eAT structural gen e This MLP-CAT construct served as an internal control in the in vitro transcription assays. Transcripts initiated from the somatostatin and MLP promoters were detected by a primer extension analysis. The transcriptional activity of the 43-kd protein was examined in in vitro transcription assays after the endogenous eRE-binding activities were de pleted from the HeLa cell extracts (4). This was accomplished by passing the transcriptionally active extract through a CRE-oligonucleotide avidin column. .
800
ANDRISANI & DIXON
While the depleted extract was unable to transcribe the somatostatin promot
er, transcription from the MLP promoter, which served as an internal control, was unaffected. Addition of the purified 43-kd protein restored transcription to the somatostatin promoter, thus proving that the 43-kd protein is the somatostatin gene transactivator.
ACTION OF CREBIATF
Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
The mechanism of action of eukaryotic transactivator proteins is largely unknown. With the availability of purified CREB/ATF protein and the es tablishment of CREB/ATF-dependent in vitro transcription systems, a num ber of questions pertaining to the action of CREBIATF are beginning to be addressed.
What is the Role of CREBIATF in the Interaction with the Transcriptional Complex? The transcriptional complex is composed of RNA polymerase II and a number of common transcription factors, such as TFIID, TFIIB, and TFIIE, which must be assembled in an ordered manner into a functional complex for initiation to
occur (38, 39, 42). Early studies have shown that the TATAA
box and cap site are necessary and sufficient for accurate transcription initia
tion. Subsequent studies (19) suggest that upstream activating sequences and. their associated factors increase the rate of transcription probably by facilitat ing the association of the common transcription factors under conditions where these interactions are rate-limiting. The studies by Horikoshi et al
(23) and Hai et al (16) have addressed this adenovirus E4 promot
question by utilizing the ATF purified protein and the
er. DNase I footprint studies showed that the ATF protein interacts with the TATA box binding factor, TFIID, and this interaction facilitates the forma tion of the initiation complex
(23). Functional in vitro transcription assays
conducted with the ATF-dependent E4 promoter showed that ATF acts prior to initiation of transcription, during the first rate-limiting step referred to as the template-commitment step (16). These data suggest that ATF and TFIID initially bind to the promoter to form the template-committed complex and ,
this interaction promotes the binding of factors TFIIE, TFIlB, and RNA polymerase II.
How Does CREB Bind to DNA? The somatostatin promoter CRE element, TGAC I GTCA, is a perfect palin drome. In prokaryotes, numerous transcription factors bind to palindromes as
dimers; the monomers have reduced DNA binding affinity and transcriptional activity
(36).
Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
SOMATOSTATIN
801
The functional importance of the somatostatin promoter palindromic CRE sequence was studied by constructing SST-CAT p1asmids containing 0, Yz, or 1 CRE (54). The response of these constructs to forskolin induction was examined by transient expression assays in PC12 cells. Forskolin, a post receptor activator of adenylyl cyclase, induces transcription of 1 CRE containing SST-CAT plasmid by 14-fold in PC12 cells, whereas the con structs containing no CRE or Yz CRE were induced two and threefold, respectively. These results point to the functional importance of the palin drome in somatostatin gene transcription and suggest that the 43-kd CREB protein may act as a dimer. How Does CREB Become Activated by cAMP Triggered Events? The purified 43-kd CREB protein is an excellent substrate for the cAMP dependent protein kinase A in vitro (54, 55). Phosphorylation takes place on serine residues, as shown by phosphoamino acid analysis (54, 55). In addi tion, phosphorylation of CREB protein occurs in vivo (31). This phosphoryla tion is stimulated three to fourfold in PC12 cells treated with forskolin, and grown in the presence of 32p-orthophosphate. Phosphorylation does not alter the binding affinity of the 43-kd CREB protein for the CRE, however. Extracts prepared from forskolin-treated cells do not display increased CRE binding affinity as shown for the cAMP-responsive a-hCG promoter (10). These data suggest that phosphorylation may influence the transcription activation potential of CREB. Yamamoto et al (54) added the catalytic subunit of the cAMP-dependent kinase A to in vitro transcription reactions with extracts isolated from PC12 cells. A 20-fold induction in the transcription directed from the somatostatin p ro mo te r was observed, which suggests that cAMP-dependent protein kinase A acts directly on the CREB protein. A model proposed by Hanson & colleagues (40) on the mechanism of cAMP-stimulated transcription is diagrammed in Figure 1.
CLONING OF THE cAMP-RESPONSIVE DNA-BINDING PROTEIN Isolation of cDNA clones encoding DNA-binding proteins can be achieved via several independent screening routes. One approach utilizes synthetic oligonucleotide probes deduced from the amino acid sequence obtained from the purified protein. Although this is a biochemically sound approach, diffi culties can be encountered with low yields of the purified transactivator proteins. Also, the purified proteins often have blocked NHz-termini; thus
Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
802
Figure I
ANDRISANI
& DIXON
Model for cAMP regulation of gene transcription.
(A) The CRE-binding protein
(stippled triangle) binds to the CRE-consensus sequence. This binding stimulates basal transcrip tion by interacting with proximal promoter elements such as the TATAA box binding factor TFlID (diagonally lined box) and/or RNA polymerase II. E lev at ion of cAMP levels induces phosphorylation of the CRE-binding protein, which further stimulates transcription by at least
two general mechanisms (B and C).
(B) Phosphorylated CREB recruits more transcription (C) Phosphorylated CREB
factors and/or increases the interaction between these factors.
interacts with a non-DNA binding protein (solid box), which allows the formation of a higher order protein complex. Figure 1 reproduced with permission from Roesler et al (40)
internal peptides must be generated from the protein that in tum must be isolated and sequenced. Alternatively, antibodies raised against the purified protein or to synthetic peptides can be utilized as a screening tool in Agtll expression libraries. Relatively large amounts of protein, however, are also necessary for produc ing antibodies. Yet another approach, which is uniquely applicable to the isolation of cDNAs encoding sequence-specific DNA-binding proteins, is based on the renaturability and sequence-specific DNA-binding characteristics of this class of proteins. Agtll libraries expressing hybrid /3-galactosidase fusion proteins are screened with ligated DNA probes containing the binding site of interest (48, 52). This technique has been successfully utilized for the isolation of a number of cDNAs encoding DNA-binding proteins (22, 48, 52). Habener's laboratory rellorted the first isolation of a CREB-cDNA clone (22). This clone was obtained by screening a placental Agtll library for the expression of specific eRE-binding protein(s) and utilizing aCRE-consensus
SOMATOSTATIN
803
sequence as the radioactive probe. The isolated cDNA clone encodes a protein of 326 amino acids (MW 35,044) and displays sequence-specific CRE binding properties. It also belongs to a class of proteins that contain the structural motif referred to as a leucine zipper (26). This class of proteins, which includes myc, fos, C/EBP, GCN4, and c-jun, contains an array of leucine residues spaced with a periodicity of seven amino acid residues in a predicted amphipathic a-helix. The leucine side chains extending from one a-helix interdigitate with those displayed from a similar a-helix of a second polypeptide, which facilitates dimerization. Computer analysis of sequence similarity between the 35,000 CRE-binding protein and c-jun revealed a single region of 61 % amino acid identity located at the carboxy-terminal end of the protein. These regions of similarity are located adjacent to the leucine zipper regions of the protein and constitute the basic domain. It has been suggested that the similarity of amino acid sequence in this domain may reflect the fact that these proteins have similar palindromic binding domains; TGACGTCA for CRE-binding protein vs TGAGTCA for c-jun. Montminy's laboratory reported the isolation of a CREB-encoding cDNA from a rat PC12 Agtll library (13). This cDNA clone was isolated utilizing oligonucleotide probes that were synthesized from amino acid sequence information obtained from tryptic peptide fragments of the purified 43-kd CREB protein. The predicted amino acid sequence of the human (22) and rat (13) CREB eDNA clones are quite similar. The predicted mass of the CREB protein encoded by the rat cDNA clone is 37 kd. The difference in the molecular weight between the deduced amino acid sequence derived from the cloned human and rat CREB cDNAs, 35 kd and 37 kd, respectively, and the purified 43-kd CREB protein has not been resolved. Post-translational mod ifications, such as phosphorylation and glycosylation, may account for some of this apparent difference. Montminy et al (13) noted several sites within the CREB molecule that might serve as potential sites of phosphorylation by the cAMP-dependent kinase A, kinase C, and casein kinase II. The functional significance of these sites in the activity and regulation of the CREB protein will obviously constitute an exciting area for future study. The availability of the CREB cDNA clones should provide the tools necessary to increase our understanding of the structure/function of the CREB molecule in regulating somatostatin gene transcription. These observations are likely to reflect on our understanding of the entire family of cAMP regulated genes.
Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
=
SUMMARY Since the cloning of the somatostatin eDNA and gene, the efforts of a number of laboratories have contributed to the understanding of somatostatin gene expression and regulation. A genetic element located approximately 40 nu-
804
ANDRlSANI & DIXON
cleotides upstream from the somatostatin mRNA cap site is important in the expression and cAMP-induced transcription of this neuropeptide gene. The identification of this genetic element has enabled the i denti fication purifica ,
tion, and cloning of a new class of proteins: the somatostatin gene transactiva tor named CREB. The availability of cloned CREB will permit studies designed to understand not only the mechanism of somatostatin gene expres sion and r egulation but also the pathway of signal transduction tri ggered by cAMP-stimulated events. Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
,
NOTE ADDED IN PROOF The cDNA sequence encoding a different CRE binding protein named CRE-BPI has been reported by Maekawa et al (29a). The human CRE-BPI clone encodes a 54.5-kd protein, and it is distinct from the CREB clones isolated by Habener et al (22) and Gonzalez et al (13). ACKNOWLEDGMENTS
This work was supported in part by grants from the National Institutes of Health. This is Journal Paper No. 12,031 from the Agricultural Experiment a tion Station, Purdue University.
Literature Cited 1 . Andrews, P. c., Dixon, J. E. 1 981 . Isolation and structure of a peptide hor mone predicted from an mRNA se quence: a second somatostatin from the catfish pancreas. 1. Bioi. Chern. 256:8267-70 2. Andrisani, O. M., Hayes, T. E., Roos, B., Dixon, J. E. 1987. Identification of the promoter sequences involved in the cell specific expression of the rat so matostatin gene. Nucleic Acids Res.
15:5715-28 3. Andrisani, O. M., Pot, D. A., Zhu, Z., Dixon, J. E. 1 988. Three sequence
specific DNA protein complexes are formed with the same promoter element essential for expression of the rat so matostatin gene. Mol. Cell. BioI.
8:1947-56
4. Andrisani, O. M., Zhu, Z., Pot, D. A., Dixon, J. E. 1989. In vitro transcription directed from the somatostatin promoter is dependent upon a purified 43 kda DNA-binding protein. Proc. Natl. Acad.
Sci. USA 86:2181-85 5. Aron, D. C., Muszynski, M., Birn
baum, R., Sabo, S., Roos, B. 1981. Somatostatin elaboration by monolayer cell cultures derived from transplantable rat medullary thyroid carcinoma: syn ergistic stimulatory effects of glucagon and calcium. Endocrinology 109: 183034
6. Berk, A. J. 1 986. Adenovirus promoters and EIA transactivation. Annll. Rev. Genet. 20:45-79 7. Carthew, R. W., Chodosh, L. A., Sharp, P. A. 1 985. An RNA polymerase
II transcription factor binds to an up stream element in the adenovirus major late promoter. Cell 43:439-48 8. Comb, M., Birnberg, N. C., Scasholtz, A., Herbert, E., Goodman, H. M. 1986. A cyclic AMP- and phorbol ester ind ucible DNA element. Nature 323: 353--56 9. Cortes, P., Buckbinder, L., Leza, A. M., Rak, N., Hearing, P., et aI. 1988. EivF, a factor required for transcription of the Adenovirus ElV promoter binds to an element involved in EIA-dependent activation and cAMP induction. Genes
Dev. 2:975-90 10. Delegeane, A. M., Ferland, L. H Mel lon, P. L. 1987. Tissue specific enhanc .•
-
er of the human glycoprotein hormone a-subunit gene: dependence on cyclic AMP inducible elements. Mol. Cell. BioI. 7:3994-4002 II. Eng el, D. A., Hardy, S., Shenk, T. 1988. cAMP Acts in synergy with ElA protein to activate transcription of the Adenovirus early genes 14 and ElA. Genes Dev. 2:1517-28 12. Funckes, C. L., Minth, C. D., De schenes, R., Magazin, M., Tavianini,
Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
SOMATOSTATIN M. A., et aI. 198 3. Cloning and characterization of a mRNA-encoding rat preprosomatostatin. J. Bioi. Chern. 258:8781-87 13. Gonzalez, G. A., Yamamoto, K. K., Fischer, W. H., Karr, D. , Menzel, P., et aI. 1989. A clus ter of phosphorylation sites on the cyclic AMP-regulatcd nu clear factor CREB predicted by its se quence. Nature 337:749- 52 14. Goodman, R. H., Aron, D. C., Roos, B. A. 1983. Rat preprosomatostatin: structure and processing by microsomal membranes. J. Bioi. Chern. 258:5570-
73 15. Goodman, R. H., Jacobs, J. W., Chin, W. W., Lund, P. K., Dee, P. C., Habener, 1. F. 1980. Somatostatin-28 encoded in a cloned cDNA obtained from a rat m ed ullary thyroid carcinoma. Proc. Natl. Acad. Sci. USA 77:586973
16. Hai, T., Horikoshi, M., Roeder, R. G.,
Green, M. R. 1988. Analysis of the role of the transcription factor ATF in the assembly of a functional preinitiation complcx. Cell 54:1043--51 17. Hai, T., Liu, F., Allegretto, E. A., Karin, M., Green, M. 1988. A family of imm un ol ogically related transcription factors that includes multiple forms of ATF and AP -l. Genes Dev. 2:1216--25 18. Hardy, S., Shenk, T. 1988. Adenoviral control regions activated by EIA and the cAMP response element bind to the same factor. Proc. Natl. Acad. Sci.USA
85:4171-75
19. Hawley, D. K., Roeder, R. G. 1987. Functional steps in transcription initia tion and reinitiation from the major late promoter in a HeLa nuclear extract. J. Bioi.Chern. 262:3452-61 20. Hayes, T. E., Dixo n, J. E. 1985. Z DNA in the rat somatostatin ge ne . J.
BioI. Chern. 260:8145--56
21. Hobart, P., Crawford, R., Shen, L.-P., Pictet, R., Rutter, W. J. 1980. Cloning and sequence analysis of cDNAs encod ing two distinct somatostatin precursors found in the endocrine pancreas of an glerfish. Nature 288 : 137--41 22. Hoeffler, J. P., Meyer, T. E., Yun, Y., Jameson, L. J., Habener, J. F. 1988. Cyclic AMP-responsive DNA-binding protein: structure based on a cloned placental cDNA. Science 242:1430-33 23. Horikoshi, M., Hai, T., Liu, Y. S., Green, M. R., Roeder, R. G. 1988. Transcription factor ATF interacts with the TATA factor to fac ilit at e establish ment of a prei ni tiatio n co mpl ex. Cell
54: 1033--42
24. Hurst, H. C., Jones, N. C. 1987. Identification of factors that interact with
805
the ElA-inducible Adenovirus E3 pro moter. Genes Dev. 1:1132-46 25. Kadonaga, J. T., Tjian, R. 1986. Affin ity purification of sequence-specific DNA binding proteins. Proc. Natl.
Acad. Sd. USA 83:5889-93
26. Landschulz, W. H., John son , P. F., McKnight , S. L. 1988. The l eucin e zi p per: a hypothetical structure common to a new class of DNA binding proteins. Science 240: 1759-64 27. Lee, W., Mitchell, P., Tjian, R. 1987 . Purified transcription factor AP-I in teracts with TPA·inducible enhancer ele ments. Cell 49:741-52 28. Lin, Y. S., Green, M. R. 1988. Interac tion of a common cellular transcription factor, ATF, with regulatory elements in both EIA and cyclic AMP-inducible promoters. Proc. Natl.Acad. Sci. USA 85:3396--3400 29. Magazin, M., Minth, C. D., Funckes, C. L., Deschenes, R., Tavianini, M. A., Dixon, J. E. 1982. Sequence of a cDNA encoding pancreatic preprosomatostat in-22. ProC. Natl. Acad. Sci. USA 79: 5152-56 29a. Maekawa, T., Sakura, H., Kanei-Ishii, C., Sado, T., Yo shi mura , T., et al. 1989. Leucine zipper structure of the protein CRE-BPI binding to cyclic AMP response element in brain. EMBO J.
8:2023-28
30. Minth, C. D., Taylor, W. L., Magazin, M., Tavianini, M. A., Collier, K., et al. 1982. The structure of cloned DNA complementary to catfish pancreatic somatostatin-14. J. Bioi. Chern. 257 : 10372-77 31. Montminy, M. R., Bilezikjian, L. M. 1987. Binding of a nuclear protein to the cyclic-AMP response element of the somatostatin gene. Na/ure 328:17578 32. Montminy, M. R., Goodman, R. H., Horovitch, S. J., Habener, J. F. 1984. Primary structure of a gene encoding rat preprosomatostatin. Proc. Natl. Acad.
Sci. USA 81:3337--40 33. Montm iny M. R., Low M. J., Tap ia ,
,
Arancibia, L., Reichlin, S., Mandel, G., Goodman, R. D. 1986. Cyclic AMP regulates somatostatin mRNA accumu lation in primary diencephalic cultures and in transfected fibroblast cells. J.
Neurosci.6:1171-76
34. Montminy, M. R., Sevarino, K. A., Wagner, J. A., Mandel, G., Goodman, R. H. 1986. Identification of a cyclic AMP -responsiv e element within the r at
somatostatin gene. Proc. Natl. Acad. Sci. USA 83:6682-86
35. Oyama, H., Bradshaw, R. A., Bates, O.
J., Permutt, A. 1980. Amino acid se -
Annu. Rev. Physiol. 1990.52:793-806. Downloaded from www.annualreviews.org Access provided by University of Bristol on 01/25/15. For personal use only.
806
ANDRISANI & DIXON
quence of catfish pancreatic somatostat in I. J. Bioi. Chern. 255:2251-54 36. Ptashne, M. 1987. A Genetic Switch. Cambridge, MA: Cell Press & Black well Sci. 2nd ed. 37. Reichlin, S. 1983. Somatostatin. New Engl. J. Med. 309:1495-1501 38. Reinberg, D., Horikoshi, M., Roeder, R. G. 1987. Factors involved i n specific transcription in mammalian RNA polymerase II. J. BioI. Chern. 262:3322-30 39. Reinberg, D., Roeder, R. G. 1987. Fac tors involved in specific transcription in mammalian RNA polymerase II. J. Bioi. Chern. 262:3331-37 40. Roesler, W. J., Van denbark , G. R., Hanson, R. W. 1988. Cyclic AMP and the induction of eukaryotic gene transcription. J. Bioi. Chern. 263:906366 41. Sassone-Corsi, P. 1988. Cyclic-AMP induction of early Adenovirus promoters involves sequences required for EIA trans-activation. Proc. Natl.Acad. Sci. USA 85:7192-96 42. Sawadogo, M., Roeder, R. G. 1985. Interaction of a gene specific transcrip tion factor with the adenovirus maj or late promoter upstream of the TATA box region. Cell 43:165-76 43. Shapiro, D. J., Sharp, P. A., Wahli, W. W., Keller, M. J. 1988. A high efficiency HeLa cell nuclear transcrip tion extract. DNA 7:47-55 44. Shen, L.-P., Pictet, R. L., Rutter, W. J. 1982. Human somatostatin I: sequence of the eDNA. Proc. Natl. Acad. Sci. USA 79:4575-79 45. Shen, L.-P., Rutter, W. J. 1984. Se quence of the human somatostatin I gene. Science 224:168--71 46. Siebenlist, U., Gilbert, W. 1980. Con tacts between E. coli RNA polymerase and an early promoter of phage T7. Proc. Natl. Acad. Sci. USA 77:122-26 47. Silver, B. J. , Bokar, J. A., Virgin, J. B., Vallen, E. A., Milsted, A., Nilson,
J. H. 1987. Cyclic AMP regulation of the human glycoprotein hormone cr subunit gene is mediated by an 18-base pair element. Proc. Natl. Acad. Sci. USA 84:2198--2202 48. Singh, H., LeBowitz, J. H., Baldwin, A. S. Jr., Sharp, P. A. 1988. Molecular cloning of an enhancer binding protein: isolation by screening of an expression library with a rccognition site DNA. Cell 52:415-23 49. Tavianini, M. A., Hayes, T. E., Maga zin, M. D., Minth, C. D., Dixon, J. E. 1984. Isolation, characterization, and DNA-sequence of the rat somatostatin gene. J. Bioi. Chern. 259:11798-11803 50. Taylor, W. L., Collier, K. J., De sc henes , R. J., Wei th , H. L., Dixon, J. E. 1981. Sequence analysis of a cDNA coding for a pancreatic precursor to somatostatin. Proc. Natl. Acad. Sci. USA 78:6694-98 51. Vale, W., Rivier, C., Brown, M. 1977. Regulatory peptides of the hypothala mus. Annu. Rev. Physiol. 39:473-527 52. Vinson, C. R., LaMarco, K. L., John son, P. F., Landschulz, W. H., McKnight, S. L. 1988. In situ detection of sequence-specific DNA bin di ng activ ity specified by a recombinant bacterio phage. Genes Dev. 2:801-6 53. Wynshaw-Boris, A., Gross Lugo, T., Short, J. M., Fournier, R. E. K., Han son, R. W. 1984. Identification of a cAMP regulatory region in the gene for rat cytosolic phosp hoeno lpyru vate car boxykinase (GTP). J. Bioi. Chern. 259:12161-69 54. Yamamoto, K. K., Gonzalez, G. A., Biggs, W. H. III, Montminy, M. R. 1988. Phosphorylation-induced binding and transcription efficacy of nuclear fac tor CREB. Nature 334:494-98 55. Z hu, Z., Andrisani, O. M., Pot, D. A., Dixon, J. E. 1989. Purification and characterization of a 43 kda transcription factor required for rat somatostatin gene expression. J. Bioi. Chern.264:6550-56
