The American Journal of Surgery (2015) -, -–-
Sonic hedgehog pathway inhibitor mitigates mouse hepatocellular carcinoma Kuo-Shyang Jeng, M.D., F.A.C.S.a,b,*, Chi-Juei Jeng, M.D.c, Wen-Juei Jeng, M.D.d, I-Shyan Sheen, M.D.d, Chiung-Fang Chang, Ph.D.b, Hsin-I Hsiau, M.S.b, Zih-Hang Hung, M.S.b, Ming-Che Yu, M.S.b, Fang-Yu Chang, B.S.b Departments of aSurgery and bMedical Research, Far Eastern Memorial Hospital, Taipei, Taiwan; c Department of Ophthalmology, Graduate Institute of Clinical Medicine, National Taiwan University, Taipei, Taiwan; dDepartment of Hepatogastroenterology, Chang Gung Memorial Hospital, Taoyuan, Taiwan KEYWORDS: Sonic hedgehog pathway; GDC-0449; Smo; Ptch-1; Shh; Gli-1
Abstract BACKGROUND: Hepatocellular carcinoma (HCC) is a leading cause of death in Asian countries. Sonic hedgehog (Shh) pathway plays a role in hepatocarcinogenesis. We investigated the treatment effect of mouse HCC with Shh inhibitor GDC-0449. METHODS: Mouse hepatoma ML-1 cells were implanted in B6 mice. Fifteen days later, GDC-0449 (vismodegib), antagonist of smoothened, was used to treat HCC-bearing mice. The tumor size and liver histopathological features were analyzed, as well as gene expression in Shh pathways. RESULTS: GDC-0449 treatment effectively reduced tumor size and cell infiltration of the HCC in mice. Gene expression of Shh pathway molecules was altered, including upregulated Shh expression and downregulated smoothened expression in tumor fractions after GDC-0449 treatment. CONCLUSION: GDC-0449 could effectively mitigate HCC growth in vivo. Ó 2015 Elsevier Inc. All rights reserved.
Hepatocellular carcinoma (HCC) is a leading cause of death in Asian countries.1–6 In spite of the improvement in diagnostic tools and surgical techniques, prognosis is poor because of the rapid progression.4–9 The effective chemotherapy or target therapy remains limited, so novel antitumor therapies are still necessary. This work was supported by grants from Far Eastern Memorial Hospital (FEMH-99-C-012), (FEMH-2015-C-054) and Ministry of Science and Technology (NSC 100-2314-B-418-004-MY3). The authors declare no conflicts of interest. * Corresponding author. Tel.: 1886-3-3281200; fax: 1886-3-3272236. E-mail address: [email protected] Manuscript received October 3, 2014; revised manuscript January 30, 2015 0002-9610/$ - see front matter Ó 2015 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.amjsurg.2015.03.001
The sonic hedgehog (Shh) signaling pathway contributes to some human cancers.10–22 Some authors suggested that abnormal activation of the Shh pathway is important in hepatocarcinogenesis.23–29 The Shh signaling pathway plays a critical role in organizing cell growth and differentiation during embryonic tissue patterning.10 Some authors support the hypothesis that activation of the hedgehog pathway is an important event in the development of HCC.23–29 However, the correlation between the Shh signaling pathway and the invasiveness of HCC remains controversial.23–28 In the Shh signaling pathway, Shh, patched homolog-1 (Ptch-1), glioma-associated oncogene homolog-1 (Gli-1), and smoothened (Smo) are important genes.11 Activated Shh signaling pathway was associated with tumor size, capsular
The American Journal of Surgery, Vol -, No -, - 2015
2
carcinoma animal.36 GDC-0449 treatment in HCC remains unclear. We conducted this study to investigate the treatment effect of GDC-0449 upon mice HCC in vivo.
Methods Animals and cell culture
Figure 1 The schematic diagram of ML-1 cell implantation and GDC-0449 treatment for groups A, B, C, and D. Group A mice were for negative control without ML-1 cell implantation. Group B mice were for positive control with ML-1 cell implantation. Group C and group D mice with ML-1 cell implantation were treated with GDC-0449 20 and 40 mg/kg/day, respectively.
Pathogen-free, 4-week-old male C57BL/6 mice were purchased from the National Science Council, Taiwan. Mice were housed at our hospital, and all animal work was performed in accordance with the guidelines from the Animal Ethics Committee of the hospitals. ML-1 cell line was established from hepatocytes of BALB/c mice by HBx DNA transfection.25 It was constructed and kindly provided by Dr. Chen at National Yang-Ming University, Taiwan. ML-1 cells were cultured with Dulbecco’s Modified Eagle Medium with 10% inactivated fetal bovine serum and 1% penicillin–streptomycin (Gibco, Grand Island, NY). All cells were incubated at 37 C with 5% CO2.
Cancer implantation and GDC-0449 treatment invasion, and vascular invasion.27 In addition, Shh, Ptch-1, and Gli-1 were all overexpressed in HCC tissues compared with paired adjacent noncancerous liver tissues. From our previous findings, activation of the Shh may also contribute to recurrence.29 The blockage of the Shh pathway could inhibit tumor growth in vitro.29–32 GDC-0449 (vismodegib; 2-chloro-N-[4-chloro-3-pyridin2-ylphenyl]-4-methanesulfonyl benzamide) is a potent and specific synthetic Smo inhibitor, with molecular weight 421.30 g/mol.30,33–35 Some studies reported that GDC-0449 has an antitumor activity in a mouse model of medulloblastoma and in primary human tumor cell xenograft models of colorectal cancer and pancreatic carcinoma.30,33–35 GDC-0449 treatment is effective in the advanced basal cell Table 1 Gene Gapdh F R Shh F R Ptch F R Gli F R Smo F R
Mice were randomly divided into 4 groups: group A, B, C, and D (Fig. 1). Group A was used as control. No treatment was given. To induce the growth of hepatoma in the liver, all mice (group B, C, and D) received implantation of mice hepatoma ML-1 cells (5 ! 106/20 mL) by injection on the marginal site of parenchyma of the left lobe of the liver. Before treatment, the size of liver tumors in mice was examined after exploration at the 2nd week under general anesthesia. Treatment started after the 2nd week after implantation; oral methylcellulose with Tween 80 (MCT) solution (.5% methylcellulose and .2% Tween 80) as vehicle for 7 days for group B; oral GDC-0449 with a dose of 20 mg/kg/day for 7 days for group C; and a dose
Sequences of primer pairs of Shh signaling pathway genes Primers (50 –30 )
Polymer
CACCACCAACTGCTTAG CTTCACCAC CTTCTTGATG
17 19
AAAGCTGACCCCTTTAGCCTA TTCGGAGTTTCTTGTGATCTTCC
21 23
CCGTTCAGCTCCGCACAGA CTCACTCGGGTGGTCCCATAAA
19 22
TGCCAGATATGCTTCAGCCA TGTGGCGAATAGACAGAGGT
19 20
GAGCGTAGCTTCCGGGACTA CTGGGCCGATTCTTGATCTCA
20 21
Amplicon length (bp) 334
102
335
291
100
F 5 forward; Gapdh 5 glyceraldehyde-3-phosphate dehydrogenase; Gli-1 5 glioma-associated oncogene homolog-1; Ptch-1 5 patched homolog-1; R 5 reverse; Shh 5 sonic hedgehog.
K.-S. Jeng et al.
GDC-0449 could mitigate HCC growth
3 complementary DNA was amplified and detected using LightCycler 480 (Roche Diagnostics, Mannheim, Germany) and SYBR Green I Master dye (Roche Diagnostics). Samples were analyzed after normalization to glyceraldehyde 3-phosphate dehydrogenase. The gene expression of Shh pathway was analyzed, including Shh, Ptch-1, Gli-1, and Smo. All primers are listed in Table 1.
Statistical analysis Comparisons between the groups were performed with the Fisher’s exact test for continuous variables. The least significant difference pairwise multiple comparison was used for multivariate analysis of associated factors. All statistical analyses were performed using the SPSS 17.0 version (SPSS, Inc, Chicago, IL). Statistical significance was considered if P value was less than .05. Figure 2 Reduced liver tumor sizes after GDC-0449 treatment. The tumor sizes in C57BL/6 mice livers were presented in 3 groups: group B (ML-1 cell injection with oral MCT solution), group C (ML-1 cell injection with oral 20 mg/kg/day GDC0449), and group D (ML-1 cell injection with oral 40 mg/kg/ day GDC-0449). Left panel: 2 weeks after ML-1 cell injection and before the treatment. Right panel: after the treatment for 1 week. Arrows indicated tumor burden.
Result Reduction in tumor size by GDC-0449 treatment No tumor was found in the liver of group A mice. Two weeks after ML-1 cell implantation, all mice of group A, B, C, and D developed tumors in the left lobe of the liver successfully and the size of the tumors were about .3 cm ! .2 cm to .2 cm ! .1 cm (length ! width). At the end of the GDC-0449 treatment, the tumor size was reduced (about .1 cm ! .1 cm or smaller, length ! width) in 6 mice of group C and in 9 mice of group D (Fig. 2). The reduction rate of group C was 50% and that of group D was 75% (Table 2). In group B, tumor reduction was found in only one mouse. Both groups C and D have a significant tumor reduction rate than group B.
of 40 mg/kg/day for 7 days for group D. One week after the treatment, exploration was done under general anesthesia to harvest the liver from each mouse of group A, B, C, and D.
Hematoxylin and eosin staining The tumor portion and nontumor portion of the livers were taken for microscopic pathological examinations. Octembedded liver tissue sections (5-mm thick) were stained using hematoxylin and eosin.
Reduction in tumor infiltration by GDC-0449 treatment
Real-time quantitative polymerase chain reaction analysis
In addition, the histopathological features of the livers are demonstrated in Fig. 3. Group A showed normal liver of mice. Liver sections of group B (ML-1 implantation) mice without GDC-0449 treatment showed a large portion of ML-1 cells and lots of nucleus staining by hematoxylin. Tumor proportions of group C liver sections decreased and ML-1 cells were found at the edge of livers. Group
For real-time quantitative polymerase chain reaction analysis, the extracted RNA was reverse transcribed using random hexamers and MultiScribe Reverse Transcriptase (Applied Biosystems, Foster city, CA) and the
Table 2 Group B Group C Group D
The tumor decreased after the GDC-0449 treatment Total number
Tumor reduction number
Reduction rate (%)
9 12 12
1 6 9
11 50 75
Tumor sizes before GDC-0449 treatment were about .3 cm ! .2 cm ! .2 cm ! .1 cm. Tumor sizes after the GDC-0449 treatment were about .1 cm ! .1 cm or smaller. The reduction rate (%) was calculated from mouse number of tumor reduction divided by the total number.
4
The American Journal of Surgery, Vol -, No -, - 2015
Figure 3 The histopathological features of livers with or without GDC-0449 treatment. Liver tissue sections were stained with hematoxylin and eosin: group A (normal), group B (ML-1 cell injection), group C (ML-1 cell injection with oral 20 mg/kg/day GDC-0449), and group D (ML-1 cell injection with oral 40 mg/kg/day GDC-0449). Arrows indicated liver tumors (ML-1 cells). A to D, !10; E to H, !40.
D (treatment with high dose of GDC-0449) mice had less nucleus staining and smaller tumor area inside the liver sections (Fig. 3).
Altered gene expression in Shh pathway with GDC-0449 treatment The gene expressions of Shh, Ptch-1, Gli-1, and Smo were examined in 4 groups (Table 3 and Fig. 4). Compared with group B, Shh messenger RNA (mRNA) expression in group D had a statistically significant increase (P 5 .007). The difference in Shh mRNA expression between group C and group D also had a statistical significance (P 5 .003). There is no difference in Ptch-1 expression. There was no significant change in Gli-1 mRNA expression between
group B and C or between group B and group D. However, the level of Gli-1 mRNA in group D is higher than in group C (P 5 .038). Compared with group B, Smo mRNA of group C decreased significantly (P 5 .033), and that of group D decreased with borderline significance (P 5 .063). The difference between group C and group D has no statistical significance (Table 3).
Comments In our study, GDC-0449 treatment effectively decreased the size of liver tumors and the infiltration extent of the lesions in histopathological findings. Group D (the high dose treatment) had a better reduction rate than group C (the low dose treatment).
K.-S. Jeng et al. Table 3 Group A Mean 6 95% CI Range Group B Mean 6 95% CI Range Group C Mean 6 95% CI Range Group D Mean 6 95% CI Range P value
GDC-0449 could mitigate HCC growth
5
Comparison of expression of Shh, Ptch-1, Gli-1, and Smo mRNA among livers of group A and liver tumors of group B, C, and D Shh mRNA
Ptch-1 mRNA
Gli-1 mRNA
Smo mRNA
SD
1.000 6 1.199 2.259 to 2.259 .233–3.333
1.000 6 .218 .772–1.228 .701–1.212
1.001 6 1.503 2.577 to 2.578 .055–3.992
1.000 6 .121 .873–1.127 .879–1.160
SD
2.455 6 1.196 .969–3.940 1.062–4.019
1.298 6 .370 .838–1.757 .715–1.737
9.616 6 5.378 2.938–16.294 2.081–15.530
3.152 6 .681 1.459–4.845 2.370–3.617
SD
2.248 6 1.330 .852–3.644 .269–3.403
1.183 6 .436 .726–1.640 .417–1.577
8.581 6 6.782 1.463–15.698 1.263–17.113
1.716 6 .946 .724–2.709 .455–2.648
SD
5.587 6 2.616 2.841–8.332 3.379–10.174 B vs C: .845 B vs D: .007 C vs D: .003
.896 6 .661 .202–1.590 .049–1.811 B vs C: .680 B vs D: .160 C vs D: .288
17.299 6 10.104 6.696–27.903 1.492–31.494 B vs C: .803 B vs D: .076 C vs D: .038
1.923 6 1.222 .641–3.205 .498–4.126 B vs C: .033 B vs D: .063 C vs D: .687
CI 5 confidence interval; Gli-1 5 glioma-associated oncogene homolog-1; Group A 5 control group without ML-1 cells implantation and drug treatment; group B 5 ML-1 cells implantation, treatment with vehicle only; group C 5 ML-1 cells implantation, treatment with GDC-0449 20 mg/kg/day for 7 days; group D 5 ML-1 cells implantation, treatment with GDC-0449 40 mg/kg/day for 7 days; Ptch-1 5 patched homolog-1; Shh 5 sonic hedgehog; Smo 5 smoothened; SD 5 standard deviation.
GDC-0449 is a potent Smo inhibitor and the blockade of Smo resulted in a successful mitigation of ML-1 growth. GDC-0449 treatment altered Shh pathway. Shh is a ligand of the Hh pathway and involved in invasion and metastasis by upregulating matrix metallopeptidase 9.31 There was an increased expression of Shh in tumor cells in the comparison of normal livers. However, there was also a significant increase in Shh mRNA in liver tumors after GDC-0449 treatment (Fig. 4). In addition, the oncogene Smo expression was significantly decreased after GDC-0449 treatment. Smo is an intracellular substrate that migrates to the cellular membrane where it is activated after engagement of Ptch-1 by Shh.22,36 It is suggested that Shh signaling pathway could be inhibited after GDC-0449 treatment. There is no difference in Ptch-1 expression after the GDC-0449 treatment (Table 3). Ptch-1 activation predisposes a cell to proliferative and expansive behavior.22,32 Our previous study supported overexpression of Gli-1 and Ptch-1 was associated with the recurrence of HCC.29 Shh signaling may promote tumor formation by inhibiting the expression of Fas.37 Ptch-1 relieves Smo from its inhibition to initiate a signaling cascade that results in the activation of the Gli-1 family of transcription factors.10,11 There was no significant difference in Gli-1 mRNA when comparing with tumor with and without GDC-0449 treatment. However, when compared with group C (low dose of GDC-0449), group D (higher dose of GDC-0449) has an increase of Gli-1 mRNA. The activation of the hedgehog pathway is important in human HCC development and progression.23–27 Shh
pathway target genes Ptch, Gli-1, and Smo were overexpressed in HCC tissues compared with the paired adjacent noncancerous liver tissues.27–29 The significance of Shh pathway activation may be different among various cancer types and tumor stages. Activation of the Shh pathway occurs in the early stage of HCC.24 The degrees of Shh and Gli-1 expressions were independent of tumor stage and cancer cell differentiation.38 The drug GDC-0449 is R95% protein bound in plasma at clinically relevant concentrations and has an approximately 200-fold longer single-dose half-life in humans than in rats.39,40 Because of its low toxicity and specificity for the Hh pathway, GDC-0449 has potential advantages compared with conventional chemotherapy, and may be used in combination treatments in the future.30,33–35 Compared with conventional chemotherapy, GDC-0449 has potential advantages and may be used in combination treatments in the future because of its low toxicity and specificity for the Hh pathway.30,33–35 The antitumor effects of the Smo inhibitor GDC-0449 vary in different cancer cell types. In human HCC cell line Huh7, the angiogenesis was reduced by GDC-0449 treatment but the cell survival rate remained the same.41 GDC-0449 has anti-hepatitis C virus (HCV) activity in a dose-dependent manner in human HCC cell line Huh 7.5.42 Vismodegib reduced TNFrelated apoptosis-inducing ligand-mediated liver injury in mouse model.43 Furthermore, GDC-0449 alters the homeostasis of intracellular Ca21, inhibits cell growth, and reduces side population in lung cancer.34 Therefore, different cell types may have different sensitivities to GDC-0449, as well as the possible mechanisms.
6
Figure 4 The gene expressions Shh, Ptch-1, Gli-1, and Smo were analyzed in 4 groups. Compared with group B, Shh mRNA expression in group D had a statistically significant increase (P 5 .007). The differences in Shh mRNA expression between group C and group D also had a statistical significance (P 5 .003). The level of Gli-1 mRNA in group D is higher than that in group C (P 5 .038). Compared with group B, Smo mRNA of group C decreased significantly (P 5 .033), and that of group D decreased with borderline significance (P 5 .063). *P , .05, **P , .01.
Conclusion Smo inhibitor GDC-0449 could effectively mitigate the mice HCC growth in vivo. It could be a promising treatment for human HCC.
Acknowledgment We thank all the staff and other workers who helped this study.
References 1. Bosch FX, Ribes J, Borras J. Epidemiology of primary liver cancer. Semin Liver Dis 1999;19:271–85.
The American Journal of Surgery, Vol -, No -, - 2015 2. Parkin DM, Bray F, Ferlay J, et al. Estimating the world cancer burden: Globocan 2000. Int J Cancer 2001;94:153–6. 3. Venook AP, Papandreou C, Furuse J, et al. The incidence and epidemiology of hepatocellular carcinoma: a global and regional perspective. Oncologist 2010;15:5–13. 4. Chen MF, Hwang TL, Jeng LB, et al. Postoperative recurrence of hepatocellular carcinoma. Two hundred five consecutive patients who underwent hepatic resection in 15 years. Arch Surg 1994;129:738–42. 5. Jeng KS, Sheen IS, Tsai YC. Does the presence of circulating hepatocellular carcinoma cells indicate a risk of recurrence after resection. Am J Gastroenterol 2004;99:1503–9. 6. Tung-Ping Poon R, Fan ST, Wong J. Risk factors, prevention, and management of postoperative recurrence after resection of hepatocellular carcinoma. Ann Surg 2000;232:10–24. 7. Kondo K, Chijiiwa K, Makino I, et al. Risk factors for early death after liver resection in patients with solitary hepatocellular carcinoma. J Hepatobiliary Pancreat Surg 2005;12:399–404. 8. Ercolani G, Grazi GL, Ravaioli M, et al. Liver resection for hepatocellular carcinoma on cirrhosis: univariate and multivariate analysis of risk factors for intrahepatic recurrence. Ann Surg 2003;237:536–43. 9. Bismuth H, Majno PE, Adam R. Liver transplantation for hepatocellular carcinoma. Semin Liver Dis 1999;19:311–22. 10. Chari NS, McDonnell TJ. The sonic hedgehog signaling network in development and neoplasia. Adv Anat Pathol 2007;14:344–52. 11. Bale AE, Yu KP. The hedgehog pathway and basal cell carcinomas. Hum Mol Genet 2001;10:757–62. 12. Karhadkar SS, Bova GS, Abdallah N, et al. Hedgehog signalling in prostate regeneration, neoplasia and metastasis. Nature 2004;431: 707–12. 13. Ma X, Chen K, Huang S, et al. Frequent activation of the hedgehog pathway in advanced gastric adenocarcinomas. Carcinogenesis 2005; 26:1698–705. 14. Ma X, Sheng T, Zhang Y, et al. Hedgehog signaling is activated in subsets of esophageal cancers. Int J Cancer 2006;118:139–48. 15. Watkins DN, Peacock CD. Hedgehog signalling in foregut malignancy. Biochem Pharmacol 2004;68:1055–60. 16. Thayer SP, di Magliano MP, Heiser PW, et al. Hedgehog is an early and late mediator of pancreatic cancer tumorigenesis. Nature 2003; 425:851–6. 17. Nakamura M, Kubo M, Nagai S, et al. New therapeutic strategy for cancer targeting the hedgehog signaling pathway. Gan To Kagaku Ryoho 2007;34:1914–6. 18. Koga K, Nakamura M, Nakashima H, et al. Novel link between estrogen receptor alpha and hedgehog pathway in breast cancer. Anticancer Res 2008;28:731–40. 19. Lupi O. Correlations between the Sonic Hedgehog pathway and basal cell carcinoma. Int J Dermatol 2007;46:1113–7. 20. Bailey JM, Mohr AM, Hollingsworth MA. Sonic hedgehog paracrine signaling regulates metastasis and lymphangiogenesis in pancreatic cancer. Oncogene 2009;28:3513–25. 21. Kelleher FC. Hedgehog signaling and therapeutics in pancreatic cancer. Carcinogenesis 2011;32:445–51. 22. Taipale J, Beachy PA. The Hedgehog and Wnt signalling pathways in cancer. Nature 2001;411:349–54. 23. Cheng WT, Xu K, Tian DY, et al. Role of Hedgehog signaling pathway in proliferation and invasiveness of hepatocellular carcinoma cells. Int J Oncol 2009;34:829–36. 24. Huang S, He J, Zhang X, et al. Activation of the hedgehog pathway in human hepatocellular carcinomas. Carcinogenesis 2006;27:1334–40. 25. Chen SH, Hu CP, Chang CM, et al. Hepatitis B virus replication in well differentiated mouse hepatocyte cell lines immortalized by plasmid DNA. Cancer Res 1992;52:1329–35. 26. Fu X, Wang Q, Chen X, et al. Expression patterns and polymorphisms of PTCH in Chinese hepatocellular carcinoma patients. Exp Mol Pathol 2008;84:195–9. 27. Che L, Ren J, Yuan YH, et al. Expression of genes related to Sonic Hedgehog signaling in human hepatocellular carcinomas. Beijing Da Xue Xue Bao 2008;40:616–23.
K.-S. Jeng et al.
GDC-0449 could mitigate HCC growth
28. Chen XL, Cheng QY, She MR, et al. Expression of sonic hedgehog signaling components in hepatocellular carcinoma and cyclopamineinduced apoptosis through Bcl-2 downregulation in vitro. Arch Med Res 2010;41:315–23. 29. Jeng KS, Sheen IS, Jeng WJ, et al. High expression of patched homolog-1 messenger RNA and glioma-associated oncogene-1 messenger RNA of sonic hedgehog signaling pathway indicates a risk of postresection recurrence of hepatocellular carcinoma. Ann Surg Oncol 2013;20:464–73. 30. De Smaele E, Ferretti E, Gulino A. Vismodegib, a small-molecule inhibitor of the hedgehog pathway for the treatment of advanced cancers. Curr Opin Investig Drugs 2010;11:707–18. 31. Lu JT, Zhao WD, He W, et al. Hedgehog signaling pathway mediates invasion and metastasis of hepatocellular carcinoma via ERK pathway. Acta Pharmacol Sin 2012;33:691–700. 32. Adolphe C, Hetherington R, Ellis T, et al. Patched1 functions as a gatekeeper by promoting cell cycle progression. Cancer Res 2006;66:2081–8. 33. Rudin CM, Hann CL, Laterra J, et al. Treatment of medulloblastoma with hedgehog pathway inhibitor GDC-0449. N Engl J Med 2009; 361:1173–8. 34. Tian F, Mysliwietz J, Ellwart J, et al. Effects of the Hedgehog pathway inhibitor GDC-0449 on lung cancer cell lines are mediated by side populations. Clin Exp Med 2012;12:25–30. 35. LoRusso PM, Rudin CM, Reddy JC, et al. Phase I trial of hedgehog pathway inhibitor vismodegib (GDC-0449) in patients with refractory, locally advanced or metastatic solid tumors. Clin Cancer Res 2011;17: 2502–11.
7 36. Amin SH, Tibes R, Kim JE, et al. Hedgehog antagonist GDC-0449 is effective in the treatment of advanced basal cell carcinoma. Laryngoscope 2010;120:2456–9. 37. Athar M, Li C, Tang X, et al. Inhibition of smoothened signaling prevents ultraviolet B-induced basal cell carcinomas through regulation of Fas expression and apoptosis. Cancer Res 2004;64:7545–52. 38. Kim YJ, Park SB, Park JY, et al. The sonic hedgehog pathway as a treatment target for extrahepatic biliary tract cancer. Mol Med Rep 2012;5:12–6. 39. Wong H, Alicke B, West KA, et al. Pharmacokinetic-pharmacodynamic analysis of vismodegib in preclinical models of mutational and ligand-dependent Hedgehog pathway activation. Clin Cancer Res 2011;17:4682–92. 40. Giannetti AM, Wong H, Dijkgraaf GJ, et al. Identification, characterization, and implications of species-dependent plasma protein binding for the oral Hedgehog pathway inhibitor vismodegib (GDC-0449). J Med Chem 2011;54:2592–601. 41. Pinter M, Sieghart W, Schmid M, et al. Hedgehog inhibition reduces angiogenesis by downregulation of tumoral VEGF-A expression in hepatocellular carcinoma. United European Gastroenterol J 2013;1: 265–75. 42. Choi SS, Bradrick S, Qiang G, et al. Up-regulation of Hedgehog pathway is associated with cellular permissiveness for hepatitis C virus replication. Hepatology 2011;54:1580–90. 43. Hirsova P, Ibrahim SH, Bronk SF, et al. Vismodegib suppresses TRAIL-mediated liver injury in a mouse model of nonalcoholic steatohepatitis. PLoS One 2013;8:e70599.
Sonic hedgehog pathway inhibitor mitigates mouse hepatocellular carcinoma Kuo-Shyang Jeng, M.D., F.A.C.S.a,b,*, Chi-Juei Jeng, M.D.c, Wen-Juei Jeng, M.D.d, I-Shyan Sheen, M.D.d, Chiung-Fang Chang, Ph.D.b, Hsin-I Hsiau, M.S.b, Zih-Hang Hung, M.S.b, Ming-Che Yu, M.S.b, Fang-Yu Chang, B.S.b Departments of aSurgery and bMedical Research, Far Eastern Memorial Hospital, Taipei, Taiwan; c Department of Ophthalmology, Graduate Institute of Clinical Medicine, National Taiwan University, Taipei, Taiwan; dDepartment of Hepatogastroenterology, Chang Gung Memorial Hospital, Taoyuan, Taiwan KEYWORDS: Sonic hedgehog pathway; GDC-0449; Smo; Ptch-1; Shh; Gli-1
Abstract BACKGROUND: Hepatocellular carcinoma (HCC) is a leading cause of death in Asian countries. Sonic hedgehog (Shh) pathway plays a role in hepatocarcinogenesis. We investigated the treatment effect of mouse HCC with Shh inhibitor GDC-0449. METHODS: Mouse hepatoma ML-1 cells were implanted in B6 mice. Fifteen days later, GDC-0449 (vismodegib), antagonist of smoothened, was used to treat HCC-bearing mice. The tumor size and liver histopathological features were analyzed, as well as gene expression in Shh pathways. RESULTS: GDC-0449 treatment effectively reduced tumor size and cell infiltration of the HCC in mice. Gene expression of Shh pathway molecules was altered, including upregulated Shh expression and downregulated smoothened expression in tumor fractions after GDC-0449 treatment. CONCLUSION: GDC-0449 could effectively mitigate HCC growth in vivo. Ó 2015 Elsevier Inc. All rights reserved.
Hepatocellular carcinoma (HCC) is a leading cause of death in Asian countries.1–6 In spite of the improvement in diagnostic tools and surgical techniques, prognosis is poor because of the rapid progression.4–9 The effective chemotherapy or target therapy remains limited, so novel antitumor therapies are still necessary. This work was supported by grants from Far Eastern Memorial Hospital (FEMH-99-C-012), (FEMH-2015-C-054) and Ministry of Science and Technology (NSC 100-2314-B-418-004-MY3). The authors declare no conflicts of interest. * Corresponding author. Tel.: 1886-3-3281200; fax: 1886-3-3272236. E-mail address: [email protected] Manuscript received October 3, 2014; revised manuscript January 30, 2015 0002-9610/$ - see front matter Ó 2015 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.amjsurg.2015.03.001
The sonic hedgehog (Shh) signaling pathway contributes to some human cancers.10–22 Some authors suggested that abnormal activation of the Shh pathway is important in hepatocarcinogenesis.23–29 The Shh signaling pathway plays a critical role in organizing cell growth and differentiation during embryonic tissue patterning.10 Some authors support the hypothesis that activation of the hedgehog pathway is an important event in the development of HCC.23–29 However, the correlation between the Shh signaling pathway and the invasiveness of HCC remains controversial.23–28 In the Shh signaling pathway, Shh, patched homolog-1 (Ptch-1), glioma-associated oncogene homolog-1 (Gli-1), and smoothened (Smo) are important genes.11 Activated Shh signaling pathway was associated with tumor size, capsular
The American Journal of Surgery, Vol -, No -, - 2015
2
carcinoma animal.36 GDC-0449 treatment in HCC remains unclear. We conducted this study to investigate the treatment effect of GDC-0449 upon mice HCC in vivo.
Methods Animals and cell culture
Figure 1 The schematic diagram of ML-1 cell implantation and GDC-0449 treatment for groups A, B, C, and D. Group A mice were for negative control without ML-1 cell implantation. Group B mice were for positive control with ML-1 cell implantation. Group C and group D mice with ML-1 cell implantation were treated with GDC-0449 20 and 40 mg/kg/day, respectively.
Pathogen-free, 4-week-old male C57BL/6 mice were purchased from the National Science Council, Taiwan. Mice were housed at our hospital, and all animal work was performed in accordance with the guidelines from the Animal Ethics Committee of the hospitals. ML-1 cell line was established from hepatocytes of BALB/c mice by HBx DNA transfection.25 It was constructed and kindly provided by Dr. Chen at National Yang-Ming University, Taiwan. ML-1 cells were cultured with Dulbecco’s Modified Eagle Medium with 10% inactivated fetal bovine serum and 1% penicillin–streptomycin (Gibco, Grand Island, NY). All cells were incubated at 37 C with 5% CO2.
Cancer implantation and GDC-0449 treatment invasion, and vascular invasion.27 In addition, Shh, Ptch-1, and Gli-1 were all overexpressed in HCC tissues compared with paired adjacent noncancerous liver tissues. From our previous findings, activation of the Shh may also contribute to recurrence.29 The blockage of the Shh pathway could inhibit tumor growth in vitro.29–32 GDC-0449 (vismodegib; 2-chloro-N-[4-chloro-3-pyridin2-ylphenyl]-4-methanesulfonyl benzamide) is a potent and specific synthetic Smo inhibitor, with molecular weight 421.30 g/mol.30,33–35 Some studies reported that GDC-0449 has an antitumor activity in a mouse model of medulloblastoma and in primary human tumor cell xenograft models of colorectal cancer and pancreatic carcinoma.30,33–35 GDC-0449 treatment is effective in the advanced basal cell Table 1 Gene Gapdh F R Shh F R Ptch F R Gli F R Smo F R
Mice were randomly divided into 4 groups: group A, B, C, and D (Fig. 1). Group A was used as control. No treatment was given. To induce the growth of hepatoma in the liver, all mice (group B, C, and D) received implantation of mice hepatoma ML-1 cells (5 ! 106/20 mL) by injection on the marginal site of parenchyma of the left lobe of the liver. Before treatment, the size of liver tumors in mice was examined after exploration at the 2nd week under general anesthesia. Treatment started after the 2nd week after implantation; oral methylcellulose with Tween 80 (MCT) solution (.5% methylcellulose and .2% Tween 80) as vehicle for 7 days for group B; oral GDC-0449 with a dose of 20 mg/kg/day for 7 days for group C; and a dose
Sequences of primer pairs of Shh signaling pathway genes Primers (50 –30 )
Polymer
CACCACCAACTGCTTAG CTTCACCAC CTTCTTGATG
17 19
AAAGCTGACCCCTTTAGCCTA TTCGGAGTTTCTTGTGATCTTCC
21 23
CCGTTCAGCTCCGCACAGA CTCACTCGGGTGGTCCCATAAA
19 22
TGCCAGATATGCTTCAGCCA TGTGGCGAATAGACAGAGGT
19 20
GAGCGTAGCTTCCGGGACTA CTGGGCCGATTCTTGATCTCA
20 21
Amplicon length (bp) 334
102
335
291
100
F 5 forward; Gapdh 5 glyceraldehyde-3-phosphate dehydrogenase; Gli-1 5 glioma-associated oncogene homolog-1; Ptch-1 5 patched homolog-1; R 5 reverse; Shh 5 sonic hedgehog.
K.-S. Jeng et al.
GDC-0449 could mitigate HCC growth
3 complementary DNA was amplified and detected using LightCycler 480 (Roche Diagnostics, Mannheim, Germany) and SYBR Green I Master dye (Roche Diagnostics). Samples were analyzed after normalization to glyceraldehyde 3-phosphate dehydrogenase. The gene expression of Shh pathway was analyzed, including Shh, Ptch-1, Gli-1, and Smo. All primers are listed in Table 1.
Statistical analysis Comparisons between the groups were performed with the Fisher’s exact test for continuous variables. The least significant difference pairwise multiple comparison was used for multivariate analysis of associated factors. All statistical analyses were performed using the SPSS 17.0 version (SPSS, Inc, Chicago, IL). Statistical significance was considered if P value was less than .05. Figure 2 Reduced liver tumor sizes after GDC-0449 treatment. The tumor sizes in C57BL/6 mice livers were presented in 3 groups: group B (ML-1 cell injection with oral MCT solution), group C (ML-1 cell injection with oral 20 mg/kg/day GDC0449), and group D (ML-1 cell injection with oral 40 mg/kg/ day GDC-0449). Left panel: 2 weeks after ML-1 cell injection and before the treatment. Right panel: after the treatment for 1 week. Arrows indicated tumor burden.
Result Reduction in tumor size by GDC-0449 treatment No tumor was found in the liver of group A mice. Two weeks after ML-1 cell implantation, all mice of group A, B, C, and D developed tumors in the left lobe of the liver successfully and the size of the tumors were about .3 cm ! .2 cm to .2 cm ! .1 cm (length ! width). At the end of the GDC-0449 treatment, the tumor size was reduced (about .1 cm ! .1 cm or smaller, length ! width) in 6 mice of group C and in 9 mice of group D (Fig. 2). The reduction rate of group C was 50% and that of group D was 75% (Table 2). In group B, tumor reduction was found in only one mouse. Both groups C and D have a significant tumor reduction rate than group B.
of 40 mg/kg/day for 7 days for group D. One week after the treatment, exploration was done under general anesthesia to harvest the liver from each mouse of group A, B, C, and D.
Hematoxylin and eosin staining The tumor portion and nontumor portion of the livers were taken for microscopic pathological examinations. Octembedded liver tissue sections (5-mm thick) were stained using hematoxylin and eosin.
Reduction in tumor infiltration by GDC-0449 treatment
Real-time quantitative polymerase chain reaction analysis
In addition, the histopathological features of the livers are demonstrated in Fig. 3. Group A showed normal liver of mice. Liver sections of group B (ML-1 implantation) mice without GDC-0449 treatment showed a large portion of ML-1 cells and lots of nucleus staining by hematoxylin. Tumor proportions of group C liver sections decreased and ML-1 cells were found at the edge of livers. Group
For real-time quantitative polymerase chain reaction analysis, the extracted RNA was reverse transcribed using random hexamers and MultiScribe Reverse Transcriptase (Applied Biosystems, Foster city, CA) and the
Table 2 Group B Group C Group D
The tumor decreased after the GDC-0449 treatment Total number
Tumor reduction number
Reduction rate (%)
9 12 12
1 6 9
11 50 75
Tumor sizes before GDC-0449 treatment were about .3 cm ! .2 cm ! .2 cm ! .1 cm. Tumor sizes after the GDC-0449 treatment were about .1 cm ! .1 cm or smaller. The reduction rate (%) was calculated from mouse number of tumor reduction divided by the total number.
4
The American Journal of Surgery, Vol -, No -, - 2015
Figure 3 The histopathological features of livers with or without GDC-0449 treatment. Liver tissue sections were stained with hematoxylin and eosin: group A (normal), group B (ML-1 cell injection), group C (ML-1 cell injection with oral 20 mg/kg/day GDC-0449), and group D (ML-1 cell injection with oral 40 mg/kg/day GDC-0449). Arrows indicated liver tumors (ML-1 cells). A to D, !10; E to H, !40.
D (treatment with high dose of GDC-0449) mice had less nucleus staining and smaller tumor area inside the liver sections (Fig. 3).
Altered gene expression in Shh pathway with GDC-0449 treatment The gene expressions of Shh, Ptch-1, Gli-1, and Smo were examined in 4 groups (Table 3 and Fig. 4). Compared with group B, Shh messenger RNA (mRNA) expression in group D had a statistically significant increase (P 5 .007). The difference in Shh mRNA expression between group C and group D also had a statistical significance (P 5 .003). There is no difference in Ptch-1 expression. There was no significant change in Gli-1 mRNA expression between
group B and C or between group B and group D. However, the level of Gli-1 mRNA in group D is higher than in group C (P 5 .038). Compared with group B, Smo mRNA of group C decreased significantly (P 5 .033), and that of group D decreased with borderline significance (P 5 .063). The difference between group C and group D has no statistical significance (Table 3).
Comments In our study, GDC-0449 treatment effectively decreased the size of liver tumors and the infiltration extent of the lesions in histopathological findings. Group D (the high dose treatment) had a better reduction rate than group C (the low dose treatment).
K.-S. Jeng et al. Table 3 Group A Mean 6 95% CI Range Group B Mean 6 95% CI Range Group C Mean 6 95% CI Range Group D Mean 6 95% CI Range P value
GDC-0449 could mitigate HCC growth
5
Comparison of expression of Shh, Ptch-1, Gli-1, and Smo mRNA among livers of group A and liver tumors of group B, C, and D Shh mRNA
Ptch-1 mRNA
Gli-1 mRNA
Smo mRNA
SD
1.000 6 1.199 2.259 to 2.259 .233–3.333
1.000 6 .218 .772–1.228 .701–1.212
1.001 6 1.503 2.577 to 2.578 .055–3.992
1.000 6 .121 .873–1.127 .879–1.160
SD
2.455 6 1.196 .969–3.940 1.062–4.019
1.298 6 .370 .838–1.757 .715–1.737
9.616 6 5.378 2.938–16.294 2.081–15.530
3.152 6 .681 1.459–4.845 2.370–3.617
SD
2.248 6 1.330 .852–3.644 .269–3.403
1.183 6 .436 .726–1.640 .417–1.577
8.581 6 6.782 1.463–15.698 1.263–17.113
1.716 6 .946 .724–2.709 .455–2.648
SD
5.587 6 2.616 2.841–8.332 3.379–10.174 B vs C: .845 B vs D: .007 C vs D: .003
.896 6 .661 .202–1.590 .049–1.811 B vs C: .680 B vs D: .160 C vs D: .288
17.299 6 10.104 6.696–27.903 1.492–31.494 B vs C: .803 B vs D: .076 C vs D: .038
1.923 6 1.222 .641–3.205 .498–4.126 B vs C: .033 B vs D: .063 C vs D: .687
CI 5 confidence interval; Gli-1 5 glioma-associated oncogene homolog-1; Group A 5 control group without ML-1 cells implantation and drug treatment; group B 5 ML-1 cells implantation, treatment with vehicle only; group C 5 ML-1 cells implantation, treatment with GDC-0449 20 mg/kg/day for 7 days; group D 5 ML-1 cells implantation, treatment with GDC-0449 40 mg/kg/day for 7 days; Ptch-1 5 patched homolog-1; Shh 5 sonic hedgehog; Smo 5 smoothened; SD 5 standard deviation.
GDC-0449 is a potent Smo inhibitor and the blockade of Smo resulted in a successful mitigation of ML-1 growth. GDC-0449 treatment altered Shh pathway. Shh is a ligand of the Hh pathway and involved in invasion and metastasis by upregulating matrix metallopeptidase 9.31 There was an increased expression of Shh in tumor cells in the comparison of normal livers. However, there was also a significant increase in Shh mRNA in liver tumors after GDC-0449 treatment (Fig. 4). In addition, the oncogene Smo expression was significantly decreased after GDC-0449 treatment. Smo is an intracellular substrate that migrates to the cellular membrane where it is activated after engagement of Ptch-1 by Shh.22,36 It is suggested that Shh signaling pathway could be inhibited after GDC-0449 treatment. There is no difference in Ptch-1 expression after the GDC-0449 treatment (Table 3). Ptch-1 activation predisposes a cell to proliferative and expansive behavior.22,32 Our previous study supported overexpression of Gli-1 and Ptch-1 was associated with the recurrence of HCC.29 Shh signaling may promote tumor formation by inhibiting the expression of Fas.37 Ptch-1 relieves Smo from its inhibition to initiate a signaling cascade that results in the activation of the Gli-1 family of transcription factors.10,11 There was no significant difference in Gli-1 mRNA when comparing with tumor with and without GDC-0449 treatment. However, when compared with group C (low dose of GDC-0449), group D (higher dose of GDC-0449) has an increase of Gli-1 mRNA. The activation of the hedgehog pathway is important in human HCC development and progression.23–27 Shh
pathway target genes Ptch, Gli-1, and Smo were overexpressed in HCC tissues compared with the paired adjacent noncancerous liver tissues.27–29 The significance of Shh pathway activation may be different among various cancer types and tumor stages. Activation of the Shh pathway occurs in the early stage of HCC.24 The degrees of Shh and Gli-1 expressions were independent of tumor stage and cancer cell differentiation.38 The drug GDC-0449 is R95% protein bound in plasma at clinically relevant concentrations and has an approximately 200-fold longer single-dose half-life in humans than in rats.39,40 Because of its low toxicity and specificity for the Hh pathway, GDC-0449 has potential advantages compared with conventional chemotherapy, and may be used in combination treatments in the future.30,33–35 Compared with conventional chemotherapy, GDC-0449 has potential advantages and may be used in combination treatments in the future because of its low toxicity and specificity for the Hh pathway.30,33–35 The antitumor effects of the Smo inhibitor GDC-0449 vary in different cancer cell types. In human HCC cell line Huh7, the angiogenesis was reduced by GDC-0449 treatment but the cell survival rate remained the same.41 GDC-0449 has anti-hepatitis C virus (HCV) activity in a dose-dependent manner in human HCC cell line Huh 7.5.42 Vismodegib reduced TNFrelated apoptosis-inducing ligand-mediated liver injury in mouse model.43 Furthermore, GDC-0449 alters the homeostasis of intracellular Ca21, inhibits cell growth, and reduces side population in lung cancer.34 Therefore, different cell types may have different sensitivities to GDC-0449, as well as the possible mechanisms.
6
Figure 4 The gene expressions Shh, Ptch-1, Gli-1, and Smo were analyzed in 4 groups. Compared with group B, Shh mRNA expression in group D had a statistically significant increase (P 5 .007). The differences in Shh mRNA expression between group C and group D also had a statistical significance (P 5 .003). The level of Gli-1 mRNA in group D is higher than that in group C (P 5 .038). Compared with group B, Smo mRNA of group C decreased significantly (P 5 .033), and that of group D decreased with borderline significance (P 5 .063). *P , .05, **P , .01.
Conclusion Smo inhibitor GDC-0449 could effectively mitigate the mice HCC growth in vivo. It could be a promising treatment for human HCC.
Acknowledgment We thank all the staff and other workers who helped this study.
References 1. Bosch FX, Ribes J, Borras J. Epidemiology of primary liver cancer. Semin Liver Dis 1999;19:271–85.
The American Journal of Surgery, Vol -, No -, - 2015 2. Parkin DM, Bray F, Ferlay J, et al. Estimating the world cancer burden: Globocan 2000. Int J Cancer 2001;94:153–6. 3. Venook AP, Papandreou C, Furuse J, et al. The incidence and epidemiology of hepatocellular carcinoma: a global and regional perspective. Oncologist 2010;15:5–13. 4. Chen MF, Hwang TL, Jeng LB, et al. Postoperative recurrence of hepatocellular carcinoma. Two hundred five consecutive patients who underwent hepatic resection in 15 years. Arch Surg 1994;129:738–42. 5. Jeng KS, Sheen IS, Tsai YC. Does the presence of circulating hepatocellular carcinoma cells indicate a risk of recurrence after resection. Am J Gastroenterol 2004;99:1503–9. 6. Tung-Ping Poon R, Fan ST, Wong J. Risk factors, prevention, and management of postoperative recurrence after resection of hepatocellular carcinoma. Ann Surg 2000;232:10–24. 7. Kondo K, Chijiiwa K, Makino I, et al. Risk factors for early death after liver resection in patients with solitary hepatocellular carcinoma. J Hepatobiliary Pancreat Surg 2005;12:399–404. 8. Ercolani G, Grazi GL, Ravaioli M, et al. Liver resection for hepatocellular carcinoma on cirrhosis: univariate and multivariate analysis of risk factors for intrahepatic recurrence. Ann Surg 2003;237:536–43. 9. Bismuth H, Majno PE, Adam R. Liver transplantation for hepatocellular carcinoma. Semin Liver Dis 1999;19:311–22. 10. Chari NS, McDonnell TJ. The sonic hedgehog signaling network in development and neoplasia. Adv Anat Pathol 2007;14:344–52. 11. Bale AE, Yu KP. The hedgehog pathway and basal cell carcinomas. Hum Mol Genet 2001;10:757–62. 12. Karhadkar SS, Bova GS, Abdallah N, et al. Hedgehog signalling in prostate regeneration, neoplasia and metastasis. Nature 2004;431: 707–12. 13. Ma X, Chen K, Huang S, et al. Frequent activation of the hedgehog pathway in advanced gastric adenocarcinomas. Carcinogenesis 2005; 26:1698–705. 14. Ma X, Sheng T, Zhang Y, et al. Hedgehog signaling is activated in subsets of esophageal cancers. Int J Cancer 2006;118:139–48. 15. Watkins DN, Peacock CD. Hedgehog signalling in foregut malignancy. Biochem Pharmacol 2004;68:1055–60. 16. Thayer SP, di Magliano MP, Heiser PW, et al. Hedgehog is an early and late mediator of pancreatic cancer tumorigenesis. Nature 2003; 425:851–6. 17. Nakamura M, Kubo M, Nagai S, et al. New therapeutic strategy for cancer targeting the hedgehog signaling pathway. Gan To Kagaku Ryoho 2007;34:1914–6. 18. Koga K, Nakamura M, Nakashima H, et al. Novel link between estrogen receptor alpha and hedgehog pathway in breast cancer. Anticancer Res 2008;28:731–40. 19. Lupi O. Correlations between the Sonic Hedgehog pathway and basal cell carcinoma. Int J Dermatol 2007;46:1113–7. 20. Bailey JM, Mohr AM, Hollingsworth MA. Sonic hedgehog paracrine signaling regulates metastasis and lymphangiogenesis in pancreatic cancer. Oncogene 2009;28:3513–25. 21. Kelleher FC. Hedgehog signaling and therapeutics in pancreatic cancer. Carcinogenesis 2011;32:445–51. 22. Taipale J, Beachy PA. The Hedgehog and Wnt signalling pathways in cancer. Nature 2001;411:349–54. 23. Cheng WT, Xu K, Tian DY, et al. Role of Hedgehog signaling pathway in proliferation and invasiveness of hepatocellular carcinoma cells. Int J Oncol 2009;34:829–36. 24. Huang S, He J, Zhang X, et al. Activation of the hedgehog pathway in human hepatocellular carcinomas. Carcinogenesis 2006;27:1334–40. 25. Chen SH, Hu CP, Chang CM, et al. Hepatitis B virus replication in well differentiated mouse hepatocyte cell lines immortalized by plasmid DNA. Cancer Res 1992;52:1329–35. 26. Fu X, Wang Q, Chen X, et al. Expression patterns and polymorphisms of PTCH in Chinese hepatocellular carcinoma patients. Exp Mol Pathol 2008;84:195–9. 27. Che L, Ren J, Yuan YH, et al. Expression of genes related to Sonic Hedgehog signaling in human hepatocellular carcinomas. Beijing Da Xue Xue Bao 2008;40:616–23.
K.-S. Jeng et al.
GDC-0449 could mitigate HCC growth
28. Chen XL, Cheng QY, She MR, et al. Expression of sonic hedgehog signaling components in hepatocellular carcinoma and cyclopamineinduced apoptosis through Bcl-2 downregulation in vitro. Arch Med Res 2010;41:315–23. 29. Jeng KS, Sheen IS, Jeng WJ, et al. High expression of patched homolog-1 messenger RNA and glioma-associated oncogene-1 messenger RNA of sonic hedgehog signaling pathway indicates a risk of postresection recurrence of hepatocellular carcinoma. Ann Surg Oncol 2013;20:464–73. 30. De Smaele E, Ferretti E, Gulino A. Vismodegib, a small-molecule inhibitor of the hedgehog pathway for the treatment of advanced cancers. Curr Opin Investig Drugs 2010;11:707–18. 31. Lu JT, Zhao WD, He W, et al. Hedgehog signaling pathway mediates invasion and metastasis of hepatocellular carcinoma via ERK pathway. Acta Pharmacol Sin 2012;33:691–700. 32. Adolphe C, Hetherington R, Ellis T, et al. Patched1 functions as a gatekeeper by promoting cell cycle progression. Cancer Res 2006;66:2081–8. 33. Rudin CM, Hann CL, Laterra J, et al. Treatment of medulloblastoma with hedgehog pathway inhibitor GDC-0449. N Engl J Med 2009; 361:1173–8. 34. Tian F, Mysliwietz J, Ellwart J, et al. Effects of the Hedgehog pathway inhibitor GDC-0449 on lung cancer cell lines are mediated by side populations. Clin Exp Med 2012;12:25–30. 35. LoRusso PM, Rudin CM, Reddy JC, et al. Phase I trial of hedgehog pathway inhibitor vismodegib (GDC-0449) in patients with refractory, locally advanced or metastatic solid tumors. Clin Cancer Res 2011;17: 2502–11.
7 36. Amin SH, Tibes R, Kim JE, et al. Hedgehog antagonist GDC-0449 is effective in the treatment of advanced basal cell carcinoma. Laryngoscope 2010;120:2456–9. 37. Athar M, Li C, Tang X, et al. Inhibition of smoothened signaling prevents ultraviolet B-induced basal cell carcinomas through regulation of Fas expression and apoptosis. Cancer Res 2004;64:7545–52. 38. Kim YJ, Park SB, Park JY, et al. The sonic hedgehog pathway as a treatment target for extrahepatic biliary tract cancer. Mol Med Rep 2012;5:12–6. 39. Wong H, Alicke B, West KA, et al. Pharmacokinetic-pharmacodynamic analysis of vismodegib in preclinical models of mutational and ligand-dependent Hedgehog pathway activation. Clin Cancer Res 2011;17:4682–92. 40. Giannetti AM, Wong H, Dijkgraaf GJ, et al. Identification, characterization, and implications of species-dependent plasma protein binding for the oral Hedgehog pathway inhibitor vismodegib (GDC-0449). J Med Chem 2011;54:2592–601. 41. Pinter M, Sieghart W, Schmid M, et al. Hedgehog inhibition reduces angiogenesis by downregulation of tumoral VEGF-A expression in hepatocellular carcinoma. United European Gastroenterol J 2013;1: 265–75. 42. Choi SS, Bradrick S, Qiang G, et al. Up-regulation of Hedgehog pathway is associated with cellular permissiveness for hepatitis C virus replication. Hepatology 2011;54:1580–90. 43. Hirsova P, Ibrahim SH, Bronk SF, et al. Vismodegib suppresses TRAIL-mediated liver injury in a mouse model of nonalcoholic steatohepatitis. PLoS One 2013;8:e70599.
