Immunol Res DOI 10.1007/s12026-016-8793-y
ORIGINAL ARTICLE
Specific immunotherapy generates CD8+ CD196+ T cells to suppress lung cancer growth in mice Jian Zhang1 • Jing Liu2 • Huiguo Chen1 • Weibin Wu1 • Xiaojun Li1 • Yonghui Wu1 • Zhigang Wang1 • Kai Zhang1 • Yun Li1 • Yimin Weng1 Hongying Liao1 • Lijia Gu1
•
Ó Springer Science+Business Media New York 2016
Abstract That specific immunotherapy can inhibit cancer growth has been recognized; its efficiency is to be improved. This study aimed to inhibit lung cancer (LC) growth in a mouse model by using an LC-specific vaccination. In this study, a LC mouse model was created by adoptive transplantation with LC cells. The tumor-bearing mice were vaccinated with LC cell extracts plus adjuvant TNBS or adoptive transplantation with specific CD8? CD196? T cells. The results showed that the vaccination with LC extracts (LCE)/TNBS markedly inhibited the LC growth and induced CD8? CD196? T cells in LC tissue and the spleen. These CD8? CD196? T cells proliferated and produce high levels of perforin upon exposure to LCE and specifically induced LC cell apoptosis. Exposure to TNBS induced RAW264.7 cells to produce macrophage inflammatory protein-3a; the latter activated signal transducer and activator of transcription 3 and further induced perforin expression in the CD8? CD196? T cells. Adoptive transfer with specific CD8? CD196? T cells suppressed LC growth in mice. In conclusion, immunization with LC extracts and TNBS can induce LC-specific CD8? CD196? T cells in LC-bearing mice and inhibit LC growth. Keywords LC Specific immunotherapy Vaccination Mouse model T helper cell Jian Zhang and Jing Liu are joint first authors. & Lijia Gu [email protected] 1
Thoracic Surgery Department, The Third Affiliated Hospital of Sun Yat-sen University, No. 600, Tianhe Road, Tianhe District, Guangzhou 510630, China
2
Infectious Disease Department, The Third Affiliated Hospital of Sun Yat-sen University, Guangzhou 510630, China
Introduction Lung cancer (LC) is one of the diseases threatening human life. According to one report from China in 2012, LC caused 13 % mortality in cancer-related death [1]. The survival rate of 5 years in patients with non-small cell lung cancer is to be further improved [2]. The prevalence of LC increased rapidly in the last a few decades. The therapeutic remedies of LC include surgery, radiotherapy, chemotherapy and immunotherapy, or combination between any of them [3]. To date, the efficacy on LC is unsatisfactory currently. Published data show that different approaches have been carried out to modulate immune response against cancer, including vaccination, using immunomodulators, adoptive transfer with tumor-reactive effector T cells, administrating with monoclonal antibodies against cancer cells [4]. The basic approaches to induce specific immune response are to administrate with specific antigens plus adjuvants, such as combination with food antigens and cholera toxin to induce food allergy animal models [5]. In these animal models, specific immune effector cells are induced. For example, T helper (Th) 2 cells, Th1 cells and CD8? T cells can be induced in proper animal models [6–8]. These T effector cells release cytokines upon activation. Many of the cytokines have antitumor ability, such as cytotoxic CD8? T cells that release perforin and granzyme B to induce tumor cell apoptosis [9]. It is reported that the CCR6–CCL20 pathway is involved in the activities of cancer [10]. CCR6 belongs to family A of G protein-coupled receptor superfamily and also designated CD196. The gene is preferentially expressed by immature dendritic cells and memory T cells [11]. This receptor has been shown to be important for B-lineage maturation and antigen-driven B cell
123
Immunol Res
differentiation, and it may regulate the migration and recruitment of dendritic and T cells during inflammatory and immunological responses [12]. The ligand of CCR6 is macrophage inflammatory protein 3 alpha (MIP-3a); it also called CCL20, or liver activation-regulated chemokine. It is strongly chemotactic for lymphocytes [13]. The trinitrobenzenesulfonic acid (TNBS) is a nitroaryl oxidizing acid. It can be used to induce ulcerative colitis in the colon to develop a model of inflammatory bowel disease [14]. Based on the above information, we hypothesize that specific immunization may induce LC-specific immune cells in the LC-bearing subjects to suppress LC growth. To test this, we created an LC mouse model. The LC-bearing mice were immunized with LC antigens and TNBS, which markedly suppressed the LC growth in the LC-bearing mice by generating LC-specific CD8? CD196? perforin? T cells.
Materials and methods Reagents The antibodies of MIP-3a, STAT3, pSTAT3 and perforin were purchased from Santa Cruz Biotech (Shanghai, China). The fluorochrome-labeled antibodies of IL-4, IFNc, perforin, granzyme B, CD8, CD4 and CD196 were purchased from BD Biosciences (Shanghai, China). The ELISA kit of perforin and neutralizing antibody of perforin were purchased from R&D Systems (Shanghai, China). The reagents for real-time RT-PCR were purchased from Invitrogen (Shanghai, China). The immune cell isolation kits were purchased from Miltenyi Biotech (Shanghai, China). The ChIP kit was purchased from Sigma Aldrich (Shanghai, China). Cell line and culture Mouse LC cell lines, LL/2 cells and LA4 cells, were purchased from American Type Culture Collection (Beijing, China). The LL/2 cells were cultured in RPMI 1640 medium supplemented with 10 % fetal bovine serum, 100 U/ml penicillin, 0.1 mg/ml streptomycin and 2 mM Lglutamine. The medium together with the agents was changed in 2–3 days. The cell viability was [99 % before use for further experiments as checked by trypan blue exclusion assay. LC model Male C57BL/6 mice (aged 6–8 weeks) were purchased from the Guangzhou Experimental Animal Center and under standard conditions in top-filtered cages. The mice
123
were injected subcutaneously with 100 lL of LL/2 cell suspension (106 cells/mouse) into the right groin. When the mean tumor diameter reached about 5 mm, the tumorbearing mice were randomly divided into four groups and received their assigned treatment via subcutaneous injection at the back skin on day 0, 3 and 6, respectively, including LC extracts (LCE; 1 mg dissolving in 0.2 ml saline) mixing with or without TNBS (0.1 mg dissolving in 0.1 ml 100 % ethanol). If using TNBS alone, it was diluted with 0.2 ml saline. The tumor size was measured with a vernier caliper every 3 days and converted to mm3. All experiments were approved by the Animal Ethic Committee at Sun Yat-sen University and performed in accordance with relevant guidelines and regulations. Preparation of single cells with tumor tissue The LC was excised from the mice, cut into small pieces and incubated in the presence of the collagenase IV (1 mg/ ml) at 37 °C for 1 h with mild agitation. The cells were filtered through a cell strainer (40 lm) and cultured in RPMI 1640 medium. The viability of the cells was [96 % as checked by trypan blue exclusion assay. Preparation of LC extracts The isolated LC cells (see above) were lysed with a lysing buffer. After centrifugation, the supernatant was collected as the LC extracts (LCE). The proteins in LCE were quantified by Bio-Rad protein assay. Isolation of immune cells The immune cells were isolated from the prepared single cells or spleen cells with commercial kits of magnetic cell sorting (MACS) following the manufacturer’s instructions. The purity of the isolated cells was checked with flow cytometry. If the party did not reach 95 %, the MACS procedures were repeated with the cells. Flow cytometry The surface markers of the cells were stained with the fluorochrome-labeled antibodies for 30 min and then fixed with 2 % paraformaldehyde mixed with 0.5 % saponin for 2 h. Cytokines in the cells were stained with fluorochromelabeled antibodies. Washing with phosphate-buffered saline (PBS) was performed after each incubation. Control cells were stained with isotype IgG. The cells were analyzed with a flow cytometer (FACSCanto II; BD Biosciences). The data were analyzed with software flowjo. Data from isotype IgG staining were used as a reference of gating.
Immunol Res
Determining LC-specific CD81 T cells
Chromatin immunoprecipitation (ChIP)
CD8? T cells were isolated from LC tissue or the spleen, labeled with CFSE (carboxyfluorescein succinimidyl ester) and cultured with dendritic cells (DC) at 10:1 (105 cells/104 cells) in the presence of LCE (5 lg/ml) for 3 days. The cells were analyzed by flow cytometry.
Following published procedures [15], we performed ChIP. The cells were fixed with 1 % paraformaldehyde for 15 min and sonicated to 300–500 bp. The DNA fragments were immunoprecipitated with the anti-pSTAT3 antibody, or non-specific IgG overnight at 4 °C. The primers for ChIP include acaagttcgtgccaggtgta and ccggagtccttggagacacac. The samples were then analyzed by RT-qPCR. The results were normalized to an internal control, the input DNA.
Enzyme-linked immunosorbent assay (ELISA) The levels of perforin in culture supernatant were determined with a commercial reagent kit following the manufacturer’s instructions. Assessment of apoptosis of LC cells CD8? CD196? T cells were isolated from LCE/TNBSimmunized mice or naive mice and cultured in the inserts of Transwells in the presence of DCs (CD8? T cell/ DC = 5:1). LL/2 cells or LA4 cells were cultured in the basal chambers of Transwells (3 lm pore size). Two days later, the LC cells were collected and stained with Annexin V reagent and propidium iodide (PI). The cells were analyzed with a flow cytometer. Cells with Annexin V positive, or both Annexin V and PI positive, were regarded as apoptosis.
Adoptive transfer with CD81 CD1961 T cells CD8? CD196? T cells were isolated from the spleen of LC-bearing mice (immunized by LCE/TNBS) or naive mice. LC-bearing mice were adoptively transferred with the CD8? CD196? T cells (106 cells/mouse) via tail vein injection on day 5 and day 15, respectively. Statistics The data are presented as mean ± SD. The difference was determined by Student’s t test between two groups, or ANOVA in those more than two groups. A p \ 0.05 was set as a significant criterion.
Real-time quantitative RT-PCR (RT-qPCR)
Results
The total RNA was extracted from the cells with the TRIzol reagent. The cDNA was synthesized with the RNA and a reverse transcription kit. The qPCR was carried out in a qPCR device (MiniOpticon, Bio-Rad, Shanghai, China) with the SYBR Green Master Mix following the manufacturer’s instructions. The primers of MIP-3a were ctttgtcctcaccctaccgt and caatgtaccggtccatgctg; the primers of perforin were ttcttgtgacaggtctcccc and ctactacacccagctctccg. The results were calculated with the method of 2 DDCt and presented as relative changes against controls.
Specific immunotherapy inhibits LC growth LC-bearing mice were immunized with LC cell extracts (LCE) mixing with or without trinitrobenzenesulfonic acid (TNBS). The tumor size monitoring records showed that the tumor size was significantly less in mice treated with LCE/TNBS than those treated with either LCE or TNBS alone (Fig. 1). The results suggest that the LCE/TNBS immunizing strategy has the ability to suppress the transplanted LC growth.
Western blotting
LCE/TNBS immunization induces perforinproducing cells in mice
The proteins were extracted from cells, fractioned by SDSPAGE and transferred onto a PVDF membrane. The membrane was blocked by incubation with 5 % skim milk for 30 min, incubation with the primary antibodies (500 ng/ml) overnight at 4 °C, and followed by incubation with peroxidase-labeled secondary antibodies for 1 h. The membrane was then developed with ECL. The results were photographed with an image recording system (UVI, Shanghai, China).
We next evaluated the intra-tumor immune cells in the LC mice. Single cells were prepared with the LC tissue; the antitumor cytokines in the cells were analyzed by flow cytometry. The results showed that IL-4? cells, IFN-c? cells, perforin? cells and granzyme B? cells were \1 % of the cells from LC-bearing mice treated with saline (the control group; Fig. 2a–e). In the cells from LC-bearing mice treated with LCE/TNBS, however, the frequencies of IL-4? cells (1.2 %), IFN-c? cells (2.8 %), perforin? cells
123
Immunol Res
Fig. 1 Specific immunization inhibits LC growth. LC mice were treated as indicated on the right side. The bars indicate the LC size (mean ± SD; *p \ 0.01, compared with the saline group). LCE/ TNBS: The mice were subcutaneously injected with LCE (1 mg dissolving in 0.2 ml saline) with or without TNBS (0.1 mg dissolving
in 0.1 ml 100 % ethanol). If using TNBS alone, it was diluted with 0.2 ml saline. The tumor size was measured in every 3 days. The data of bars are presented as mean ± SD. *p \ 0.01, compared with the saline group. Each group is consisted of six mice
Fig. 2 Phenotypes of intra-tumor immune cells. Single cells were prepared from LC tissue of mice treated with saline or LCE/TNBS; the cells were analyzed by flow cytometry. The histograms indicate the frequencies of the intra-tumor immune cells as denoted below the
histograms. The bars indicate the summarized data (mean ± SD; *p \ 0.01, compared with the saline group) of the histograms a– d (e) and f–i (j). Each group is consisted of six mice. Samples from individual mice were processed separately
(4.8 %) and granzyme B? cells (1.9 %) were higher (Fig. 2f–j) than those of the control group, in which the frequency of perforin? cells was higher than of the other three cytokines. These cell types in LC mice treated with either LCE alone or TNBS alone were similar to those LC mice treated with saline (not shown). The results suggest that a fraction of antitumor cells was induced in the mice by LCE/TNBS immunization; perforin may be the major antitumor cytokine in these cells.
(Fig. 3b) while the CD4? cells were only 2.44 % (Fig. 3c). To test whether these CD8? T cells were LC antigen specific, we isolated CD8? T cells from the LC tissue, labeled with CFSE and cultured in the presence of LCE and DCs for 3 days. The results showed that more than 65.7 % CD8? T cells proliferated (Fig. 3e). Exposure to BSA did not induce apparent proliferation (Fig. 3f). The LCE did not induce naı¨ve CD8? T cell proliferation (Fig. 3g). The results indicate that these CD8? T cells are LC antigen specific; they can be activated upon exposure to the specific antigens (the LCE). The proliferating CD8? T cells were also CD196 positive (92.6 %; Fig. 3i, j). The CD8? CD196? T cells were CD19 negative (Fig. 3k, l), indicating that these cells are not B cells. The perforin could be detected in the culture medium (Fig. 3m). The results indicate that the LCE/TNBS immunization induces an LC
LCE/TNBS immunization induces LC-specific perforin-producing CD81 CD1961 T cells To further analyze the perforin? cells isolated from LC tissue, the perforin? cells were gated first (Fig. 3a), and we found that 85.6 % perforin? cells were also CD8 positive
123
Immunol Res
Fig. 3 Assessment of perforin-expressing CD8? CD196? T cells. LC tissue was excised from LC-bearing mice (immunized with LC extracts (LCE)/TNBS) on day 10. Single cells were prepared with LC tissue or spleen ($) and analyzed by flow cytometry. a The gated dot plots indicate the frequency of perforin-positive cells. b, c The histograms indicate the frequencies of CD8? (b) and CD4? (c) cells in the gated perforin? cells of panel A. d–h CD8? T cells were isolated from LC tissue, labeled with CFSE and cultured in the presence of LCE (5 lg/ml) and DCs (T cell/DC = 105 cells/104 cells) for 3 days. The cells were analyzed by flow cytometry. The CD11c?
cells were gated out first. The histograms of d–h indicate the frequencies of proliferating CD8? T cells. i, j and k, l the histograms indicate the frequency of CD196? cells (i, j) and CD19? B cells (k, l) in the proliferating cells of panel E and H. m The bars indicate the perforin levels (mean ± SD; *p \ 0.01, compared with group D) in the culture supernatant of d–h (by ELISA). #The CD8? T cells were isolated from naı¨ve mice (used as a control). The gray shadings of panels i–l indicate the isotype IgG staining results (negative control). The data are representatives of three independent experiments
antigen-specific perforin-producing CD8? CD196? T cells in the LC tissue. In addition, we also detected CD8? CD196? T cells in the spleen of LC-bearing mice immunized with LCE/TNBS (not shown).
Transwell system for 48 h. The LL/2 cells were analyzed by flow cytometry. The results showed that the CD8? CD196? T cells from mice treated with LCE/TNBS immunization markedly induced LL/2 cell apoptosis (Fig. 4a, b). Those CD8? CD196? T cells from naive mice did not induce apparent apoptosis in the LL/2 cells (Fig. 4c). To test whether such an effect of the CD8? CD196? T cell is tumor specific, in separate experiments, we cultured CD8? CD196? T cells with another LC cell line, human LC cell line LA4 cells, in the same experimental condition above. The results showed that the CD8? CD196? T cells did not induce LA4 cell apoptosis (Fig. 4d). To enforce the results, we added a neutralizing antiperforin antibody to the culture. The induction of LL/2
Specific CD81 CD1961 T cells induce LC cell apoptosis The above results implicate that the specific CD8? CD196? T cells may be able to inhibit LC cells. To test the hypothesis, we isolated CD8? CD196? T cells from the spleen of mice immunized with LCE/TNBS (these cells expressed high levels of perforin; not shown); the cells were cultured with the LC cell line, the LL/2 cells, in a
123
Immunol Res
Fig. 4 Specific CD8? CD196? T cells induce LC cell apoptosis. CD8? CD196? T cells were isolated from LCE/TNBS-immunized mice or naive mice and cocultured with LC cell lines (LL/2 or LA4) in Transwells (T cell/LC = 105 cells/105 cells/well) for 48 h. T cell = specific CD8? CD196? T cells. nT cell = naive CD8?
CD196? T cells. Ab: neutralizing antiperforin antibody in the culture (500 ng/ml). Perforin: perforin in the culture (100 ng/ml). The experimental condition was denoted above each dot plot panel. The gated dot plots indicate the frequency of apoptotic cells. The data are representatives of three independent experiments
cell apoptosis was abolished (Fig. 4e); treating LL/2 cells with perforin in the culture also induced LL/2 cell apoptosis (Fig. 4f). The results suggest that the specific CD8? CD196? T cells can induce LL/2 cell apoptosis by releasing perforin.
mice immunized with LCE/TNBS). The LC growth was significantly inhibited in mice treated with the specific CD8? CD196? T cells than in those treated with the CD8? CD196? T cells from perforin-deficient mice or naive mice. Transplantation with the CD8? CD196- T cells also showed suppressive effect on the tumor growth, but significantly less than those received the CD8? CD196? T cells (Fig. 6).
TNBS modulates perforin expression in CD81 T cells We took a further insight into the mechanism by which the LCE/TNBS immunization induces perforin-producing CD8? CD196? T cells in LC-bearing mice. The ligand of CD196 is the MIP-3a; we inferred that TNBS induced macrophages to produce MIP-3a and then to modulate the expression of perforin in the T cells. To test inference, we stimulated RAW264.7 cells (a macrophage cell line) with TNBS in the culture. The results showed that the exposure to TNBS markedly increased the expression of MIP-3a in RAW264.7 cells (Fig. 5a, b). Although the interaction of chemokines and their receptors mainly induces the target cell chemoattractive activities, it sometimes modulates the target cell functions [16]. Thus, we inferred that the MIP-3a ligated CD196 to induce the expression of perforin in CD8? CD196? cells. To this end, we treated naı¨ve CD8? CD196? T cells with rMIP-3a in the culture. It markedly increased the STAT3 phosphorylation (Fig. 5c) and the STAT3 binding to the perforin promoter (Fig. 5d), which increased the expression of perforin (Fig. 5e, f) in the CD8? CD196? T cells. Specific CD81 CD1961 T cells inhibit LC growth in a mouse model The above results strongly suggest that the CD8? CD196? T cells can inhibit LC growth. To enforce the results, we developed the LC mouse model; the LC-bearing mice were adoptively transplanted with the CD8? CD196? T cells or CD8? CD196- T cells (isolated from the mouse spleen of
123
Discussion Immunization with pathogen antigens has been proved to be an efficient approach to preventing and treating a number of diseases. Because the precise LC antigens have not been determined, so far the effective LC immunization has not been reported in the human LC treatment. The present data show that immunization with LC antigens (the LC extracts) plus TNBS (adjuvant) suppressed LC growth in the LC-bearing mice. The immunization induced an LC-specific CD8? CD196? T cells. This fraction of T cells produced the antitumor cytokine perforin upon activation by the specific antigen to induce LC cell apoptosis. In this study, the antigens used in the immunization are the LC cell extracts, which are a mixture of a number of antigens. It is certain that some of the antigens in this mixture are LC-specific antigens. The present data show that after immunization, the LC growth was efficiently inhibited, indicating that an anti-LC immune response has been induced in the mice. Our strategy is in line with some immunization approaches used in other fields. For example, in the specific antigen immunotherapy for asthma, the allergen vaccines are the raw extracts of mites; the vaccines are also a mixture of a large number of proteins. The specific immune response to suppress asthma can be well induced. This animal model is currently extensively used in the asthma studies [17].
Immunol Res
Fig. 5 Modulation of perforin in CD8? CD196? T cells. a, b RAW264.7 cells (Mac; a mouse macrophage cell line) were cultured in the presence of TNBS (dissolved in 100 % ethanol at 10 mg/ml; the dosage of TNBS is denoted on the X axis of panel A) or vehicle (Ethanol; 1 ll/ml) for 48 h. a The bars indicate the MIP-3a mRNA changes. b The Western blots indicate the protein levels of MIP-3a. C–F, CD8? CD196? T cells were isolated from the naive mouse spleen and cultured with TNBS-conditioned Mac or naive
Mac, or in the presence of MIP-3a (100 ng/ml) for 48 h. c The Western blots indicate the status of STAT3 phosphorylation. d The bars indicate the perforin promoter binding by pSTAT3 (assessed by ChIP). e The bars indicate the perforin mRNA levels. f The Western blots indicate the perforin protein levels. The data of bars are presented as mean ± SD. *p \ 0.01, compared with the medium group. The data are representatives of three independent experiments
Fig. 6 Adoptive transfer with specific CD8? CD196? T cells to suppress LC growth. Naive mice were immunized with LCR/TNBS. CD8? CD196? T cells and CD8? CD196- T cells were isolated from the spleen. LC-bearing mice were adoptively transferred with CD8?
CD196? T cells or CD8? CD196- T cells (106 cell/mouse) on day 5 and day 15, respectively. #Perforin-deficient mice. a–e Representative LC images from the LC-bearing mice. f The bars indicate the tumor size recorded on day 27. Each group consists of six mice
In this study, TNBS was used as an adjuvant in the immunization with LCE. TNBS is a half antigen and is used as a major reagent in the induction of animal models of inflammatory bowel diseases [18]. We observed a fraction of CD8? CD196? T cells in the LC-bearing mice after immunization with LCE/TNBS. Increases in CD4? T
cells and CD8? T cells in the intestine were also reported in the TNBS colitis mouse model [19]. Our data also show that the immunization with LCE/TNBS can induce LCspecific CD8? T cells. This fraction of CD8? CD196? T cells releases antitumor cytokine perforin upon activation. Such a property implicates that these CD8? CD196? T
123
Immunol Res
cells are a fraction of antitumor T cells. The inference is supported by the data of in vitro experiment, and coculturing the specific CD8? CD196? T cells with LL/2 cells induced LL/2 cell apoptosis. CD196 is essential for the ability of B memory cells to respond to a recall response to their cognate antigens [16]. The present data show that a fraction of CD8? T cells also expresses CD196 in LC-bearing mice as well as naive mice. CD196 is the ligand of MIP-3a. The fact implicates that the MIP-3a source cells have the chemotactic effect on CD196positive cells. Besides, MIP-3a is also an inflammatory cytokine; it can regulate the target cell’s activities and induces inflammation; for example, macrophage-derived MIP-3a can induce periodontal ligament cells to express inflammatory substances [20]. Treatment of mice with an anti-MIP-3alpha neutralizing monoclonal antibody significantly reduced TNBS-mediated colitis [19]. Our data are in line with the previous reports by showing that the macrophage-derived MIP-3a ligates CD196 on CD8? T cells to induce the CD8? CD196? T cells to produce perforin; the latter induces LC cell apoptosis. Since the perforin was detected in the culture supernatant, it was necessary to test whether the ‘‘free’’ perforin could induce cancer cell apoptosis. Data from Transwell study confirmed the inference. The released perforin did induce LC apoptosis. Others also found that perforin could bind to target cells [21]. In summary, the present study shows that using TNBS as an adjuvant, immunization with LCE can induce a specific subtype of T cells, the CD8? CD196? T cells with antitumor properties. This fraction of T cells induces LC cell apoptosis and suppresses LC growth in mice. Author contributions JZ, JL, HC, WW, XL, YW, ZW, KZ, YL, YW and HL performed experiments, analyzed data and reviewed the manuscript. LG designed the project, supervised the research and wrote the paper.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
Compliance with ethical standards Conflict of interest
None.
18.
References 19. 1. Chen W, Zheng R, Zhang S, Zhao P, Li G, Wu L, He J. Report of incidence and mortality in China cancer registries, 2009. Chin J Cancer Res. 2013;25:10–21. 2. Siegel RND, Jemal A. Cancer statistics, 2013. CA Cancer J Clin. 2013;63:11–3. 3. Akhurst TMM, Hicks RJ. Lung cancer. PET Clin. 2015;10: 147–58. 4. Holt GEPE, Raez LE. Immunotherapy as a strategy for the treatment of non-small-cell lung cancer. Therapy. 2011;8:43–54. 5. Feng BSCX, He SH, Zheng PY, Foster J, Xing Z, Bienenstock J, Yang PC. Disruption of T-cell immunoglobulin and mucin domain molecule (TIM)-1/TIM4 interaction as a therapeutic
123
20.
21.
strategy in a dendritic cell-induced peanut allergy model. J Allergy Clin Immunol. 2008;122:55–61. Yao X, Wang W, Li Y, Huang P, Zhang Q, Wang J, et al. IL-25 induces airways angiogenesis and expression of multiple angiogenic factors in a murine asthma model. Respir Res. 2015;16:39. Dungan LS, McGuinness NC, Boon L, Lynch MA, Mills KH. Innate IFN-gamma promotes development of experimental autoimmune encephalomyelitis: a role for NK cells and M1 macrophages. Eur J Immunol. 2014;44:2903–17. Kosaka A, Ohkuri T, Ikeura M, Kohanbash G, Okada H. Transgene-derived overexpression of miR-17-92 in CD8? T-cells confers enhanced cytotoxic activity. Biochem Biophys Res Commun. 2015;458:549–54. Wang BQZC, Gao W, Wang XF, Zhang HL, Yang PC. Cancerderived matrix metalloproteinase-9 contributes to tumor tolerance. J Cancer Res Clin Oncol. 2011;137:1525–33. Yu QLX, He Y. Preferential recruitment of Th17 cells to cervical cancer via CCR6-CCL20 pathway. PLoS ONE. 2015;10: e0120855. Ferraccioli GZG. The potential role of Th17 in mediating the transition from acute to chronic autoimmune inflammation: rheumatoid arthritis as a model. Discov Med. 2011;11:413–24. Annunziato FSV, Maggi L, Cosmi L, Liotta F, Romagnani S. Reasons for rarity of Th17 cells in inflammatory sites of human disorders. Semin Immunol. 2013;25:299–304. Li X, Zhou Q, Yang WB, Xiong XZ, Du RH, Zhang JC. Pleural mesothelial cells promote expansion of IL-17—producing CD8? T cells in tuberculous pleural effusion. J Clin Immunol. 2013;33:775–87. Zou Y, Li WY, Wan Z, Zhao B, He ZW, Wu ZG, et al. Huangqin-Tang ameliorates TNBS-induced colitis by regulating effector and regulatory CD4(?) T cells. BioMed Res Int. 2015;2015:102021. Kato K, Nomoto M, Izumi H, Ise T, Nakano S, Niho Y, et al. Structure and functional analysis of the human STAT3 gene promoter: alteration of chromatin structure as a possible mechanism for the upregulation in cisplatin-resistant cells. Biochim Biophys Acta. 2000;1493:91–100. Elgueta R, Marks E, Nowak E, Menezes S, Benson M, Raman VS, et al. CCR6-dependent positioning of memory B cells is essential for their ability to mount a recall response to antigen. J Immunol. 2015;194:505–13. Torres R, Serra-Pages M, Plaza J, Herrerias A, Costa-Farre C, Marco A, et al. Activation of the Prostaglandin E2 receptor EP2 prevents house dust mite-induced airway hyperresponsiveness and inflammation by restraining mast cells activity. Clin Exp Allergy. 2015;45:1590–600. Robinson AM, Sakkal S, Park A, Jovanovska V, Payne N, Carbone SE, et al. Mesenchymal stem cells and conditioned medium avert enteric neuropathy and colon dysfunction in guinea pig TNBS-induced colitis. Am J Physiol Gastrointest Liver Physiol. 2014;307:G1115–29. Katchar K, Kelly CP, Keates S, O’Brien MJ, Keates AC. MIP3alpha neutralizing monoclonal antibody protects against TNBSinduced colonic injury and inflammation in mice. Am J Physiol Gastrointest Liver Physiol. 2007;292:G1263–71. Lee SK, Pi SH, Kim SH, Min KS, Lee HJ, Chang HS, et al. Substance P regulates macrophage inflammatory protein 3alpha/ chemokine C-C ligand 20 (CCL20) with heme oxygenase-1 in human periodontal ligament cells. Clin Exp Immunol. 2007;150:567–75. Law RH, Lukoyanova N, Voskoboinik I, Caradoc-Davies TT, Baran K, Dunstone MA, et al. The structural basis for membrane binding and pore formation by lymphocyte perforin. Nature. 2010;468:447–51.
ORIGINAL ARTICLE
Specific immunotherapy generates CD8+ CD196+ T cells to suppress lung cancer growth in mice Jian Zhang1 • Jing Liu2 • Huiguo Chen1 • Weibin Wu1 • Xiaojun Li1 • Yonghui Wu1 • Zhigang Wang1 • Kai Zhang1 • Yun Li1 • Yimin Weng1 Hongying Liao1 • Lijia Gu1
•
Ó Springer Science+Business Media New York 2016
Abstract That specific immunotherapy can inhibit cancer growth has been recognized; its efficiency is to be improved. This study aimed to inhibit lung cancer (LC) growth in a mouse model by using an LC-specific vaccination. In this study, a LC mouse model was created by adoptive transplantation with LC cells. The tumor-bearing mice were vaccinated with LC cell extracts plus adjuvant TNBS or adoptive transplantation with specific CD8? CD196? T cells. The results showed that the vaccination with LC extracts (LCE)/TNBS markedly inhibited the LC growth and induced CD8? CD196? T cells in LC tissue and the spleen. These CD8? CD196? T cells proliferated and produce high levels of perforin upon exposure to LCE and specifically induced LC cell apoptosis. Exposure to TNBS induced RAW264.7 cells to produce macrophage inflammatory protein-3a; the latter activated signal transducer and activator of transcription 3 and further induced perforin expression in the CD8? CD196? T cells. Adoptive transfer with specific CD8? CD196? T cells suppressed LC growth in mice. In conclusion, immunization with LC extracts and TNBS can induce LC-specific CD8? CD196? T cells in LC-bearing mice and inhibit LC growth. Keywords LC Specific immunotherapy Vaccination Mouse model T helper cell Jian Zhang and Jing Liu are joint first authors. & Lijia Gu [email protected] 1
Thoracic Surgery Department, The Third Affiliated Hospital of Sun Yat-sen University, No. 600, Tianhe Road, Tianhe District, Guangzhou 510630, China
2
Infectious Disease Department, The Third Affiliated Hospital of Sun Yat-sen University, Guangzhou 510630, China
Introduction Lung cancer (LC) is one of the diseases threatening human life. According to one report from China in 2012, LC caused 13 % mortality in cancer-related death [1]. The survival rate of 5 years in patients with non-small cell lung cancer is to be further improved [2]. The prevalence of LC increased rapidly in the last a few decades. The therapeutic remedies of LC include surgery, radiotherapy, chemotherapy and immunotherapy, or combination between any of them [3]. To date, the efficacy on LC is unsatisfactory currently. Published data show that different approaches have been carried out to modulate immune response against cancer, including vaccination, using immunomodulators, adoptive transfer with tumor-reactive effector T cells, administrating with monoclonal antibodies against cancer cells [4]. The basic approaches to induce specific immune response are to administrate with specific antigens plus adjuvants, such as combination with food antigens and cholera toxin to induce food allergy animal models [5]. In these animal models, specific immune effector cells are induced. For example, T helper (Th) 2 cells, Th1 cells and CD8? T cells can be induced in proper animal models [6–8]. These T effector cells release cytokines upon activation. Many of the cytokines have antitumor ability, such as cytotoxic CD8? T cells that release perforin and granzyme B to induce tumor cell apoptosis [9]. It is reported that the CCR6–CCL20 pathway is involved in the activities of cancer [10]. CCR6 belongs to family A of G protein-coupled receptor superfamily and also designated CD196. The gene is preferentially expressed by immature dendritic cells and memory T cells [11]. This receptor has been shown to be important for B-lineage maturation and antigen-driven B cell
123
Immunol Res
differentiation, and it may regulate the migration and recruitment of dendritic and T cells during inflammatory and immunological responses [12]. The ligand of CCR6 is macrophage inflammatory protein 3 alpha (MIP-3a); it also called CCL20, or liver activation-regulated chemokine. It is strongly chemotactic for lymphocytes [13]. The trinitrobenzenesulfonic acid (TNBS) is a nitroaryl oxidizing acid. It can be used to induce ulcerative colitis in the colon to develop a model of inflammatory bowel disease [14]. Based on the above information, we hypothesize that specific immunization may induce LC-specific immune cells in the LC-bearing subjects to suppress LC growth. To test this, we created an LC mouse model. The LC-bearing mice were immunized with LC antigens and TNBS, which markedly suppressed the LC growth in the LC-bearing mice by generating LC-specific CD8? CD196? perforin? T cells.
Materials and methods Reagents The antibodies of MIP-3a, STAT3, pSTAT3 and perforin were purchased from Santa Cruz Biotech (Shanghai, China). The fluorochrome-labeled antibodies of IL-4, IFNc, perforin, granzyme B, CD8, CD4 and CD196 were purchased from BD Biosciences (Shanghai, China). The ELISA kit of perforin and neutralizing antibody of perforin were purchased from R&D Systems (Shanghai, China). The reagents for real-time RT-PCR were purchased from Invitrogen (Shanghai, China). The immune cell isolation kits were purchased from Miltenyi Biotech (Shanghai, China). The ChIP kit was purchased from Sigma Aldrich (Shanghai, China). Cell line and culture Mouse LC cell lines, LL/2 cells and LA4 cells, were purchased from American Type Culture Collection (Beijing, China). The LL/2 cells were cultured in RPMI 1640 medium supplemented with 10 % fetal bovine serum, 100 U/ml penicillin, 0.1 mg/ml streptomycin and 2 mM Lglutamine. The medium together with the agents was changed in 2–3 days. The cell viability was [99 % before use for further experiments as checked by trypan blue exclusion assay. LC model Male C57BL/6 mice (aged 6–8 weeks) were purchased from the Guangzhou Experimental Animal Center and under standard conditions in top-filtered cages. The mice
123
were injected subcutaneously with 100 lL of LL/2 cell suspension (106 cells/mouse) into the right groin. When the mean tumor diameter reached about 5 mm, the tumorbearing mice were randomly divided into four groups and received their assigned treatment via subcutaneous injection at the back skin on day 0, 3 and 6, respectively, including LC extracts (LCE; 1 mg dissolving in 0.2 ml saline) mixing with or without TNBS (0.1 mg dissolving in 0.1 ml 100 % ethanol). If using TNBS alone, it was diluted with 0.2 ml saline. The tumor size was measured with a vernier caliper every 3 days and converted to mm3. All experiments were approved by the Animal Ethic Committee at Sun Yat-sen University and performed in accordance with relevant guidelines and regulations. Preparation of single cells with tumor tissue The LC was excised from the mice, cut into small pieces and incubated in the presence of the collagenase IV (1 mg/ ml) at 37 °C for 1 h with mild agitation. The cells were filtered through a cell strainer (40 lm) and cultured in RPMI 1640 medium. The viability of the cells was [96 % as checked by trypan blue exclusion assay. Preparation of LC extracts The isolated LC cells (see above) were lysed with a lysing buffer. After centrifugation, the supernatant was collected as the LC extracts (LCE). The proteins in LCE were quantified by Bio-Rad protein assay. Isolation of immune cells The immune cells were isolated from the prepared single cells or spleen cells with commercial kits of magnetic cell sorting (MACS) following the manufacturer’s instructions. The purity of the isolated cells was checked with flow cytometry. If the party did not reach 95 %, the MACS procedures were repeated with the cells. Flow cytometry The surface markers of the cells were stained with the fluorochrome-labeled antibodies for 30 min and then fixed with 2 % paraformaldehyde mixed with 0.5 % saponin for 2 h. Cytokines in the cells were stained with fluorochromelabeled antibodies. Washing with phosphate-buffered saline (PBS) was performed after each incubation. Control cells were stained with isotype IgG. The cells were analyzed with a flow cytometer (FACSCanto II; BD Biosciences). The data were analyzed with software flowjo. Data from isotype IgG staining were used as a reference of gating.
Immunol Res
Determining LC-specific CD81 T cells
Chromatin immunoprecipitation (ChIP)
CD8? T cells were isolated from LC tissue or the spleen, labeled with CFSE (carboxyfluorescein succinimidyl ester) and cultured with dendritic cells (DC) at 10:1 (105 cells/104 cells) in the presence of LCE (5 lg/ml) for 3 days. The cells were analyzed by flow cytometry.
Following published procedures [15], we performed ChIP. The cells were fixed with 1 % paraformaldehyde for 15 min and sonicated to 300–500 bp. The DNA fragments were immunoprecipitated with the anti-pSTAT3 antibody, or non-specific IgG overnight at 4 °C. The primers for ChIP include acaagttcgtgccaggtgta and ccggagtccttggagacacac. The samples were then analyzed by RT-qPCR. The results were normalized to an internal control, the input DNA.
Enzyme-linked immunosorbent assay (ELISA) The levels of perforin in culture supernatant were determined with a commercial reagent kit following the manufacturer’s instructions. Assessment of apoptosis of LC cells CD8? CD196? T cells were isolated from LCE/TNBSimmunized mice or naive mice and cultured in the inserts of Transwells in the presence of DCs (CD8? T cell/ DC = 5:1). LL/2 cells or LA4 cells were cultured in the basal chambers of Transwells (3 lm pore size). Two days later, the LC cells were collected and stained with Annexin V reagent and propidium iodide (PI). The cells were analyzed with a flow cytometer. Cells with Annexin V positive, or both Annexin V and PI positive, were regarded as apoptosis.
Adoptive transfer with CD81 CD1961 T cells CD8? CD196? T cells were isolated from the spleen of LC-bearing mice (immunized by LCE/TNBS) or naive mice. LC-bearing mice were adoptively transferred with the CD8? CD196? T cells (106 cells/mouse) via tail vein injection on day 5 and day 15, respectively. Statistics The data are presented as mean ± SD. The difference was determined by Student’s t test between two groups, or ANOVA in those more than two groups. A p \ 0.05 was set as a significant criterion.
Real-time quantitative RT-PCR (RT-qPCR)
Results
The total RNA was extracted from the cells with the TRIzol reagent. The cDNA was synthesized with the RNA and a reverse transcription kit. The qPCR was carried out in a qPCR device (MiniOpticon, Bio-Rad, Shanghai, China) with the SYBR Green Master Mix following the manufacturer’s instructions. The primers of MIP-3a were ctttgtcctcaccctaccgt and caatgtaccggtccatgctg; the primers of perforin were ttcttgtgacaggtctcccc and ctactacacccagctctccg. The results were calculated with the method of 2 DDCt and presented as relative changes against controls.
Specific immunotherapy inhibits LC growth LC-bearing mice were immunized with LC cell extracts (LCE) mixing with or without trinitrobenzenesulfonic acid (TNBS). The tumor size monitoring records showed that the tumor size was significantly less in mice treated with LCE/TNBS than those treated with either LCE or TNBS alone (Fig. 1). The results suggest that the LCE/TNBS immunizing strategy has the ability to suppress the transplanted LC growth.
Western blotting
LCE/TNBS immunization induces perforinproducing cells in mice
The proteins were extracted from cells, fractioned by SDSPAGE and transferred onto a PVDF membrane. The membrane was blocked by incubation with 5 % skim milk for 30 min, incubation with the primary antibodies (500 ng/ml) overnight at 4 °C, and followed by incubation with peroxidase-labeled secondary antibodies for 1 h. The membrane was then developed with ECL. The results were photographed with an image recording system (UVI, Shanghai, China).
We next evaluated the intra-tumor immune cells in the LC mice. Single cells were prepared with the LC tissue; the antitumor cytokines in the cells were analyzed by flow cytometry. The results showed that IL-4? cells, IFN-c? cells, perforin? cells and granzyme B? cells were \1 % of the cells from LC-bearing mice treated with saline (the control group; Fig. 2a–e). In the cells from LC-bearing mice treated with LCE/TNBS, however, the frequencies of IL-4? cells (1.2 %), IFN-c? cells (2.8 %), perforin? cells
123
Immunol Res
Fig. 1 Specific immunization inhibits LC growth. LC mice were treated as indicated on the right side. The bars indicate the LC size (mean ± SD; *p \ 0.01, compared with the saline group). LCE/ TNBS: The mice were subcutaneously injected with LCE (1 mg dissolving in 0.2 ml saline) with or without TNBS (0.1 mg dissolving
in 0.1 ml 100 % ethanol). If using TNBS alone, it was diluted with 0.2 ml saline. The tumor size was measured in every 3 days. The data of bars are presented as mean ± SD. *p \ 0.01, compared with the saline group. Each group is consisted of six mice
Fig. 2 Phenotypes of intra-tumor immune cells. Single cells were prepared from LC tissue of mice treated with saline or LCE/TNBS; the cells were analyzed by flow cytometry. The histograms indicate the frequencies of the intra-tumor immune cells as denoted below the
histograms. The bars indicate the summarized data (mean ± SD; *p \ 0.01, compared with the saline group) of the histograms a– d (e) and f–i (j). Each group is consisted of six mice. Samples from individual mice were processed separately
(4.8 %) and granzyme B? cells (1.9 %) were higher (Fig. 2f–j) than those of the control group, in which the frequency of perforin? cells was higher than of the other three cytokines. These cell types in LC mice treated with either LCE alone or TNBS alone were similar to those LC mice treated with saline (not shown). The results suggest that a fraction of antitumor cells was induced in the mice by LCE/TNBS immunization; perforin may be the major antitumor cytokine in these cells.
(Fig. 3b) while the CD4? cells were only 2.44 % (Fig. 3c). To test whether these CD8? T cells were LC antigen specific, we isolated CD8? T cells from the LC tissue, labeled with CFSE and cultured in the presence of LCE and DCs for 3 days. The results showed that more than 65.7 % CD8? T cells proliferated (Fig. 3e). Exposure to BSA did not induce apparent proliferation (Fig. 3f). The LCE did not induce naı¨ve CD8? T cell proliferation (Fig. 3g). The results indicate that these CD8? T cells are LC antigen specific; they can be activated upon exposure to the specific antigens (the LCE). The proliferating CD8? T cells were also CD196 positive (92.6 %; Fig. 3i, j). The CD8? CD196? T cells were CD19 negative (Fig. 3k, l), indicating that these cells are not B cells. The perforin could be detected in the culture medium (Fig. 3m). The results indicate that the LCE/TNBS immunization induces an LC
LCE/TNBS immunization induces LC-specific perforin-producing CD81 CD1961 T cells To further analyze the perforin? cells isolated from LC tissue, the perforin? cells were gated first (Fig. 3a), and we found that 85.6 % perforin? cells were also CD8 positive
123
Immunol Res
Fig. 3 Assessment of perforin-expressing CD8? CD196? T cells. LC tissue was excised from LC-bearing mice (immunized with LC extracts (LCE)/TNBS) on day 10. Single cells were prepared with LC tissue or spleen ($) and analyzed by flow cytometry. a The gated dot plots indicate the frequency of perforin-positive cells. b, c The histograms indicate the frequencies of CD8? (b) and CD4? (c) cells in the gated perforin? cells of panel A. d–h CD8? T cells were isolated from LC tissue, labeled with CFSE and cultured in the presence of LCE (5 lg/ml) and DCs (T cell/DC = 105 cells/104 cells) for 3 days. The cells were analyzed by flow cytometry. The CD11c?
cells were gated out first. The histograms of d–h indicate the frequencies of proliferating CD8? T cells. i, j and k, l the histograms indicate the frequency of CD196? cells (i, j) and CD19? B cells (k, l) in the proliferating cells of panel E and H. m The bars indicate the perforin levels (mean ± SD; *p \ 0.01, compared with group D) in the culture supernatant of d–h (by ELISA). #The CD8? T cells were isolated from naı¨ve mice (used as a control). The gray shadings of panels i–l indicate the isotype IgG staining results (negative control). The data are representatives of three independent experiments
antigen-specific perforin-producing CD8? CD196? T cells in the LC tissue. In addition, we also detected CD8? CD196? T cells in the spleen of LC-bearing mice immunized with LCE/TNBS (not shown).
Transwell system for 48 h. The LL/2 cells were analyzed by flow cytometry. The results showed that the CD8? CD196? T cells from mice treated with LCE/TNBS immunization markedly induced LL/2 cell apoptosis (Fig. 4a, b). Those CD8? CD196? T cells from naive mice did not induce apparent apoptosis in the LL/2 cells (Fig. 4c). To test whether such an effect of the CD8? CD196? T cell is tumor specific, in separate experiments, we cultured CD8? CD196? T cells with another LC cell line, human LC cell line LA4 cells, in the same experimental condition above. The results showed that the CD8? CD196? T cells did not induce LA4 cell apoptosis (Fig. 4d). To enforce the results, we added a neutralizing antiperforin antibody to the culture. The induction of LL/2
Specific CD81 CD1961 T cells induce LC cell apoptosis The above results implicate that the specific CD8? CD196? T cells may be able to inhibit LC cells. To test the hypothesis, we isolated CD8? CD196? T cells from the spleen of mice immunized with LCE/TNBS (these cells expressed high levels of perforin; not shown); the cells were cultured with the LC cell line, the LL/2 cells, in a
123
Immunol Res
Fig. 4 Specific CD8? CD196? T cells induce LC cell apoptosis. CD8? CD196? T cells were isolated from LCE/TNBS-immunized mice or naive mice and cocultured with LC cell lines (LL/2 or LA4) in Transwells (T cell/LC = 105 cells/105 cells/well) for 48 h. T cell = specific CD8? CD196? T cells. nT cell = naive CD8?
CD196? T cells. Ab: neutralizing antiperforin antibody in the culture (500 ng/ml). Perforin: perforin in the culture (100 ng/ml). The experimental condition was denoted above each dot plot panel. The gated dot plots indicate the frequency of apoptotic cells. The data are representatives of three independent experiments
cell apoptosis was abolished (Fig. 4e); treating LL/2 cells with perforin in the culture also induced LL/2 cell apoptosis (Fig. 4f). The results suggest that the specific CD8? CD196? T cells can induce LL/2 cell apoptosis by releasing perforin.
mice immunized with LCE/TNBS). The LC growth was significantly inhibited in mice treated with the specific CD8? CD196? T cells than in those treated with the CD8? CD196? T cells from perforin-deficient mice or naive mice. Transplantation with the CD8? CD196- T cells also showed suppressive effect on the tumor growth, but significantly less than those received the CD8? CD196? T cells (Fig. 6).
TNBS modulates perforin expression in CD81 T cells We took a further insight into the mechanism by which the LCE/TNBS immunization induces perforin-producing CD8? CD196? T cells in LC-bearing mice. The ligand of CD196 is the MIP-3a; we inferred that TNBS induced macrophages to produce MIP-3a and then to modulate the expression of perforin in the T cells. To test inference, we stimulated RAW264.7 cells (a macrophage cell line) with TNBS in the culture. The results showed that the exposure to TNBS markedly increased the expression of MIP-3a in RAW264.7 cells (Fig. 5a, b). Although the interaction of chemokines and their receptors mainly induces the target cell chemoattractive activities, it sometimes modulates the target cell functions [16]. Thus, we inferred that the MIP-3a ligated CD196 to induce the expression of perforin in CD8? CD196? cells. To this end, we treated naı¨ve CD8? CD196? T cells with rMIP-3a in the culture. It markedly increased the STAT3 phosphorylation (Fig. 5c) and the STAT3 binding to the perforin promoter (Fig. 5d), which increased the expression of perforin (Fig. 5e, f) in the CD8? CD196? T cells. Specific CD81 CD1961 T cells inhibit LC growth in a mouse model The above results strongly suggest that the CD8? CD196? T cells can inhibit LC growth. To enforce the results, we developed the LC mouse model; the LC-bearing mice were adoptively transplanted with the CD8? CD196? T cells or CD8? CD196- T cells (isolated from the mouse spleen of
123
Discussion Immunization with pathogen antigens has been proved to be an efficient approach to preventing and treating a number of diseases. Because the precise LC antigens have not been determined, so far the effective LC immunization has not been reported in the human LC treatment. The present data show that immunization with LC antigens (the LC extracts) plus TNBS (adjuvant) suppressed LC growth in the LC-bearing mice. The immunization induced an LC-specific CD8? CD196? T cells. This fraction of T cells produced the antitumor cytokine perforin upon activation by the specific antigen to induce LC cell apoptosis. In this study, the antigens used in the immunization are the LC cell extracts, which are a mixture of a number of antigens. It is certain that some of the antigens in this mixture are LC-specific antigens. The present data show that after immunization, the LC growth was efficiently inhibited, indicating that an anti-LC immune response has been induced in the mice. Our strategy is in line with some immunization approaches used in other fields. For example, in the specific antigen immunotherapy for asthma, the allergen vaccines are the raw extracts of mites; the vaccines are also a mixture of a large number of proteins. The specific immune response to suppress asthma can be well induced. This animal model is currently extensively used in the asthma studies [17].
Immunol Res
Fig. 5 Modulation of perforin in CD8? CD196? T cells. a, b RAW264.7 cells (Mac; a mouse macrophage cell line) were cultured in the presence of TNBS (dissolved in 100 % ethanol at 10 mg/ml; the dosage of TNBS is denoted on the X axis of panel A) or vehicle (Ethanol; 1 ll/ml) for 48 h. a The bars indicate the MIP-3a mRNA changes. b The Western blots indicate the protein levels of MIP-3a. C–F, CD8? CD196? T cells were isolated from the naive mouse spleen and cultured with TNBS-conditioned Mac or naive
Mac, or in the presence of MIP-3a (100 ng/ml) for 48 h. c The Western blots indicate the status of STAT3 phosphorylation. d The bars indicate the perforin promoter binding by pSTAT3 (assessed by ChIP). e The bars indicate the perforin mRNA levels. f The Western blots indicate the perforin protein levels. The data of bars are presented as mean ± SD. *p \ 0.01, compared with the medium group. The data are representatives of three independent experiments
Fig. 6 Adoptive transfer with specific CD8? CD196? T cells to suppress LC growth. Naive mice were immunized with LCR/TNBS. CD8? CD196? T cells and CD8? CD196- T cells were isolated from the spleen. LC-bearing mice were adoptively transferred with CD8?
CD196? T cells or CD8? CD196- T cells (106 cell/mouse) on day 5 and day 15, respectively. #Perforin-deficient mice. a–e Representative LC images from the LC-bearing mice. f The bars indicate the tumor size recorded on day 27. Each group consists of six mice
In this study, TNBS was used as an adjuvant in the immunization with LCE. TNBS is a half antigen and is used as a major reagent in the induction of animal models of inflammatory bowel diseases [18]. We observed a fraction of CD8? CD196? T cells in the LC-bearing mice after immunization with LCE/TNBS. Increases in CD4? T
cells and CD8? T cells in the intestine were also reported in the TNBS colitis mouse model [19]. Our data also show that the immunization with LCE/TNBS can induce LCspecific CD8? T cells. This fraction of CD8? CD196? T cells releases antitumor cytokine perforin upon activation. Such a property implicates that these CD8? CD196? T
123
Immunol Res
cells are a fraction of antitumor T cells. The inference is supported by the data of in vitro experiment, and coculturing the specific CD8? CD196? T cells with LL/2 cells induced LL/2 cell apoptosis. CD196 is essential for the ability of B memory cells to respond to a recall response to their cognate antigens [16]. The present data show that a fraction of CD8? T cells also expresses CD196 in LC-bearing mice as well as naive mice. CD196 is the ligand of MIP-3a. The fact implicates that the MIP-3a source cells have the chemotactic effect on CD196positive cells. Besides, MIP-3a is also an inflammatory cytokine; it can regulate the target cell’s activities and induces inflammation; for example, macrophage-derived MIP-3a can induce periodontal ligament cells to express inflammatory substances [20]. Treatment of mice with an anti-MIP-3alpha neutralizing monoclonal antibody significantly reduced TNBS-mediated colitis [19]. Our data are in line with the previous reports by showing that the macrophage-derived MIP-3a ligates CD196 on CD8? T cells to induce the CD8? CD196? T cells to produce perforin; the latter induces LC cell apoptosis. Since the perforin was detected in the culture supernatant, it was necessary to test whether the ‘‘free’’ perforin could induce cancer cell apoptosis. Data from Transwell study confirmed the inference. The released perforin did induce LC apoptosis. Others also found that perforin could bind to target cells [21]. In summary, the present study shows that using TNBS as an adjuvant, immunization with LCE can induce a specific subtype of T cells, the CD8? CD196? T cells with antitumor properties. This fraction of T cells induces LC cell apoptosis and suppresses LC growth in mice. Author contributions JZ, JL, HC, WW, XL, YW, ZW, KZ, YL, YW and HL performed experiments, analyzed data and reviewed the manuscript. LG designed the project, supervised the research and wrote the paper.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
Compliance with ethical standards Conflict of interest
None.
18.
References 19. 1. Chen W, Zheng R, Zhang S, Zhao P, Li G, Wu L, He J. Report of incidence and mortality in China cancer registries, 2009. Chin J Cancer Res. 2013;25:10–21. 2. Siegel RND, Jemal A. Cancer statistics, 2013. CA Cancer J Clin. 2013;63:11–3. 3. Akhurst TMM, Hicks RJ. Lung cancer. PET Clin. 2015;10: 147–58. 4. Holt GEPE, Raez LE. Immunotherapy as a strategy for the treatment of non-small-cell lung cancer. Therapy. 2011;8:43–54. 5. Feng BSCX, He SH, Zheng PY, Foster J, Xing Z, Bienenstock J, Yang PC. Disruption of T-cell immunoglobulin and mucin domain molecule (TIM)-1/TIM4 interaction as a therapeutic
123
20.
21.
strategy in a dendritic cell-induced peanut allergy model. J Allergy Clin Immunol. 2008;122:55–61. Yao X, Wang W, Li Y, Huang P, Zhang Q, Wang J, et al. IL-25 induces airways angiogenesis and expression of multiple angiogenic factors in a murine asthma model. Respir Res. 2015;16:39. Dungan LS, McGuinness NC, Boon L, Lynch MA, Mills KH. Innate IFN-gamma promotes development of experimental autoimmune encephalomyelitis: a role for NK cells and M1 macrophages. Eur J Immunol. 2014;44:2903–17. Kosaka A, Ohkuri T, Ikeura M, Kohanbash G, Okada H. Transgene-derived overexpression of miR-17-92 in CD8? T-cells confers enhanced cytotoxic activity. Biochem Biophys Res Commun. 2015;458:549–54. Wang BQZC, Gao W, Wang XF, Zhang HL, Yang PC. Cancerderived matrix metalloproteinase-9 contributes to tumor tolerance. J Cancer Res Clin Oncol. 2011;137:1525–33. Yu QLX, He Y. Preferential recruitment of Th17 cells to cervical cancer via CCR6-CCL20 pathway. PLoS ONE. 2015;10: e0120855. Ferraccioli GZG. The potential role of Th17 in mediating the transition from acute to chronic autoimmune inflammation: rheumatoid arthritis as a model. Discov Med. 2011;11:413–24. Annunziato FSV, Maggi L, Cosmi L, Liotta F, Romagnani S. Reasons for rarity of Th17 cells in inflammatory sites of human disorders. Semin Immunol. 2013;25:299–304. Li X, Zhou Q, Yang WB, Xiong XZ, Du RH, Zhang JC. Pleural mesothelial cells promote expansion of IL-17—producing CD8? T cells in tuberculous pleural effusion. J Clin Immunol. 2013;33:775–87. Zou Y, Li WY, Wan Z, Zhao B, He ZW, Wu ZG, et al. Huangqin-Tang ameliorates TNBS-induced colitis by regulating effector and regulatory CD4(?) T cells. BioMed Res Int. 2015;2015:102021. Kato K, Nomoto M, Izumi H, Ise T, Nakano S, Niho Y, et al. Structure and functional analysis of the human STAT3 gene promoter: alteration of chromatin structure as a possible mechanism for the upregulation in cisplatin-resistant cells. Biochim Biophys Acta. 2000;1493:91–100. Elgueta R, Marks E, Nowak E, Menezes S, Benson M, Raman VS, et al. CCR6-dependent positioning of memory B cells is essential for their ability to mount a recall response to antigen. J Immunol. 2015;194:505–13. Torres R, Serra-Pages M, Plaza J, Herrerias A, Costa-Farre C, Marco A, et al. Activation of the Prostaglandin E2 receptor EP2 prevents house dust mite-induced airway hyperresponsiveness and inflammation by restraining mast cells activity. Clin Exp Allergy. 2015;45:1590–600. Robinson AM, Sakkal S, Park A, Jovanovska V, Payne N, Carbone SE, et al. Mesenchymal stem cells and conditioned medium avert enteric neuropathy and colon dysfunction in guinea pig TNBS-induced colitis. Am J Physiol Gastrointest Liver Physiol. 2014;307:G1115–29. Katchar K, Kelly CP, Keates S, O’Brien MJ, Keates AC. MIP3alpha neutralizing monoclonal antibody protects against TNBSinduced colonic injury and inflammation in mice. Am J Physiol Gastrointest Liver Physiol. 2007;292:G1263–71. Lee SK, Pi SH, Kim SH, Min KS, Lee HJ, Chang HS, et al. Substance P regulates macrophage inflammatory protein 3alpha/ chemokine C-C ligand 20 (CCL20) with heme oxygenase-1 in human periodontal ligament cells. Clin Exp Immunol. 2007;150:567–75. Law RH, Lukoyanova N, Voskoboinik I, Caradoc-Davies TT, Baran K, Dunstone MA, et al. The structural basis for membrane binding and pore formation by lymphocyte perforin. Nature. 2010;468:447–51.
