Mol Cell Biochem (2014) 391:167–174 DOI 10.1007/s11010-014-1999-1
Spindle and kinetochore-associated protein 1 is overexpressed in gastric cancer and modulates cell growth Wei Sun • Li Yao • Benchun Jiang Lin Guo • Qiang Wang
•
Received: 30 October 2013 / Accepted: 21 February 2014 / Published online: 14 March 2014 Ó Springer Science+Business Media New York 2014
Abstract Spindle and kinetochore-associated protein 1 (SKA1) is a microtubule-binding subcomplex of the outer kinetochore that is essential for proper chromosome segregation. SKA1 is required for timely anaphase onset during mitosis, when chromosomes undergo bipolar attachment on spindle microtubules leading to silencing of the spindle checkpoint. Recently, SKA1 has been highlighted as a biomarker in some types of cancers, however, the precise role of SKA1 in gastric cancer remains unknown. In order to investigate the role of SKA1 in gastric cancer, the expression levels of SKA1 were analyzed in 56 gastric cancer samples and 54 non-neoplastic samples by immunohistochemistry, and we found SKA1 was significantly overexpressed in gastric cancer tissues. Moreover, we employed lentivirus-mediated short hairpin RNA to knockdown SKA1 in the human gastric cancer cell line MGC80-3. Functional analysis indicated that SKA1 silencing significantly inhibited cell proliferation and colony formation, as determined by MTT and colony formation assays. The depletion of SKA1 in MGC80-3 cells also led to S phase cell cycle arrest. These results suggest that SKA1 could be used for gastric cancer early diagnosis as a biomarker. It is possible to enable a potential therapy based on targeting SKA1.
W. Sun (&) B. Jiang L. Guo Q. Wang Department of General Surgery, Affiliated Shengjing Hospital, China Medical University, Sanhao Street 36#, Shenyang 110004, Liaoning, China e-mail: [email protected] L. Yao Department of Nephrology, The Frist Affiliated Hospital, China Medical University, Shenyang 110001, Liaoning, China
Keywords Spindle and kinetochore-associated protein 1 Gastric cancer Immunohistochemistry Short hairpin RNA Cell growth
Introduction Gastric cancer is the second leading cause of cancer mortality and the fourth most common cancer in the world with *934,000 new cases diagnosed and an anticipated 700,000 deaths annually [1]. In the United States, an estimated 21,000 new cases and 11,000 deaths were expected in 2010 [2]. However, most gastric cancers are diagnosed at advanced or metastatic stages when the tumor is considered unresectable [3, 4], especially in many endemic areas where programs for early detection is limited. For patients with advanced stage gastric cancer, the 5-year survival rate is *20 %. Thus, early diagnosis is important for gastric cancer prevention and treatment. Moreover, large differences in incidence exist between continents. The highest incidenceup to 69 cases per 100,000 people per year is in men in East Asian countries (e.g., Japan, Korea, and China) [5]. Spindle and kinetochore-associated protein 1 (SKA1) is a microtubule (MT)-binding subcomplex of the outer kinetochore (KT) that is essential for proper chromosome segregation. Chromosome alignment and segregation require that all KTs establish stable bioriented attachments to spindle MTs. Central to this process is the ska complex (SKA1, 2 and 3) and its interaction with KMN network [6]. SKA1, together with Ska2 and Ska3, has been proposed to be required for stable KT–MT attachments [7–10]. In this process, Ska complex mainly forms assemblies on MTs that can facilitate the processive movement of microspheres along depolymerizing MTs [10]. Efficient depletion of the Ska complex leads to severe attachment defects
123
168
and unstable K-fibers [7, 8, 10]. Additionally, the Ska complex has also been implicated in silencing of the spindle checkpoint [11] and in maintenance of sister chromatid cohesion [9]. All these observations led us to propose that the Ska complex is required for stabilizing KT–MT attachments and/or checkpoint silencing, therefore making SKA1 a prominent protein possibly affecting cell cycle and mitosis. Cancer growth is a major burden for gastric cancer which means factors affecting cell cycle and proliferation process may mediate cancer cell growth and thus tumorigenesis. Nara et al. [12] have suggested SKA1 as a biomarker for side population cells in carcinomas. In the present study, in order to obtain insight into the association between SKA1 expression and gastric cancer growth, we assessed SKA1 expression in 110 cases of human gastric tissues and found SKA1 was significantly overexpressed in gastric cancer tissues. Moreover, the role of SKA1 in cell growth was examined in the gastric cancer cell line MGC80-3 that was subjected to SKA1 knockdown.
Materials and methods Cell lines and cell culture Gastric cancer cell lines MGC80-3 and SGC-7901 and human embryonic kidney cell line 293T (HEK293T) were obtained from American Type Culture Collection (ATCC, Manassas, VA, USA). Cells were maintained in RPMI1640 (Gibco, Cambrex, MD) supplemented with 10 % heatinactivated fetal bovine serum (FBS) and penicillin/streptomycin at 37 °C in humidified atmosphere of 5 % CO2. HEK293T cells were cultured in DMEM (Hyclone, Logan, UT) supplemented with 10 % heat-inactivated FBS. Tissue specimen 110 cases of gastric cancer tissues including 52 cases of adenocarcinoma and 4 cases of signet-ring cell carcinoma (n = 56) and non-neoplastic tissues (n = 54) were collected from the Department of Gastrointestinal and Pancreatic Surgery of the Affiliated Shengjing Hospital, China Medical University from 2003 to 2005. Patients who received chemotherapy, radiotherapy, and/or biotherapy before surgery were excluded from the study. The pathologic stage of disease was determined according to the American Joint Committee on Cancer (AJCC) TNM staging system. All treatment plans were designed according to the latest National Comprehensive Cancer Network (NCCN) guidelines for gastric cancer.
123
Mol Cell Biochem (2014) 391:167–174
Immunohistochemistry staining (IHC) Paraffin-embedded tissues were subjected to antigen retrieval by heating the slides in an autoclave at 120 °C for 5 min in 0.1 M citric acid buffer (pH 6.0), then incubated with the rabbit anti-SKA1 antibody (1:300, Sigma, St. Louis, MO, USA) at 4 °C overnight. After incubation in anti-rabbit detection reagent for 1 h at room temperature, the sections were developed in 0.05 % diaminobenzidine containing 0.01 % hydrogen peroxidase. For negative controls, the rabbit anti-SKA1 antibody was replaced with normal goat serum by co-incubation at 4 °C overnight preceding the immunohistochemical staining procedure. Hematoxylin was used to co-stain nuclei. Western blot analysis Cells were homogenized in lysis butter (0.1 M Tris buffer (pH 7.4), 0.1 mM EDTA) in the presence of 1 mM dithiothreitol (DTT), 1 mM phenylmethylsulfonyl fluoride, and protease inhibitor cocktail (Roche, IN, USA). The equal amount of sample was loaded in each well of a 7.5 % gel and subjected to SDS-PAGE. Gels were transferred to nitrocellulose membrane. The membrane was then incubated with primary antibodies for 4 °C overnight against SKA1 (1:1,000, Sigma, St. Louis, MO, USA) and GAPDH (1:3,000, Santa Cruz, CA, USA). After washing with TBST, the membrane was incubated with secondary antibody against rabbit and mouse IgGs (1:5,000, Santa Cruz, CA, USA), and the signals were visualized using ECL plus western blotting system. All experiments mentioned above were performed in triplicate unless otherwise noted. RNA extraction and quantitative real-time PCR (qRTPCR) When cells were harvested, the total RNA was extracted using Trizol solution (Invitrogen, Carlsbad, CA, USA). Equal amounts of RNA (1 lg) were reverse-transcribed using the Transcriptor First Strand cDNA synthesis Kit (Roche, IN, USA). The primers used are as follows: SKA1: Forward 50 -TGATGTGCCAGGAAGGTGAC0 3 Reverse 50 -CAAAGGATACAGATGAACAACAGC-30 Actin: Forward 50 -GTGGACATCCGCAAAGAC-30 Reverse 0 5 -AAAGGGTGTAACGCAACTA-30 Primers were synthesized by Shanghai Daweike Biotechnology Co. Ltd (Shanghai, China). PCR cycle conditions were 95 °C for 30 s, and 40 cycles of 95 °C for 5 s and 60 °C for 30 s. The amplification specificity was evaluated with melting curve analysis. Relative mRNA was determined using the formula 2-DCT (CT; cycle threshold) where DCT = CT (target gene) - CT (Actin) as described previously [13].
Mol Cell Biochem (2014) 391:167–174
Construction of SKA1 short hairpin RNA-expressing lentivirus In order to create shSKA1 stably expressing cell lines, the SKA1 short hairpin RNA (shRNA) (50 -CCGGCCTGACA CAAAGCTCCTAAATCTCGAGATTTAGGAGCTTTGT GTCAGGTTTTTG-30 ) was inserted into the pFH-L vector (Hollybio, Shanghai, China). The non-silencing siRNA (50 TTCTCCGAACGTGTCACGT-30 ) was also used as control. The lentivirus-based shRNA-expressing vectors were constructed and confirmed by DNA sequencing. The generated plasmids were named as pFH-L-shSKA1 or pFH-LshCon. Recombined lentiviral vectors and pVSVG-I/ pCMVDR8.92 packaging vectors were then transfected into HEK293T cells. Supernatants containing either the lentivirus expressing the SKA1 shRNA (Lv-shSKA1) or the control shRNA (Lv-shCon) were harvested 72 h after transfection. The lentiviral particles were purified by ultracentrifugation, and the viral titer was determined according to previous reports [14, 15]. MGC80-3 cells were infected with the lentivirus constructs at a multiplicity of infection (MOI) of 50. As the lentivirus carries green fluorescence protein (GFP), the efficiency of infection was determined by counting GFP-expressing cells under fluorescence microscopy 96 h after infection as described in previous reports [16]. MTT proliferation assay To detect cell viability, 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide (MTT) colorimetric assay was performed. Briefly, MGC80-3 cells were washed with phosphate-buffered saline (PBS) and suspended at a final concentration of 2 9 104 per ml in an assay medium and dispensed into 96-well plates. The plates were incubated at 37 °C for 1–5 days in a humidified CO2 incubator. After the treatment time, 100 ml of MTT (5 mg/ml) was added to each well, the plates were incubated at 37 °C for 4 h, and then 10 % dimethylsulfoxide (100 ml) was added to each well. The absorbance at 490 nm was measured using a synergy 2 multi-mode microplate reader (Bio Tek Instruments, Winooski, VT, USA). Experiments were performed in triplicate. Plate colony formation assay MGC80-3 cells (total of 500 cells per well) were seeded into six-well plates 3 days after lentivirus infection. The medium was changed at 3-day intervals. After 7 days of culture at 37 °C, cells were washed with PBS and fixed with 4 % paraformaldehyde for 30 min at room temperature. The fixed cells were then stained with freshly prepared diluted Giemsa (Merck) for 10 min, washed with
169
water and air-dried. The total number of colonies with more than 50 cells was counted using light microscope and fluorescent microscope. Fluorescence-activated cell sorting analysis (FACS) The DNA contents of cell cycle phases can be reflected by varying propidium iodide (PI) fluorescent intensities. Therefore, cell cycle distribution of Lv-shSKA1- or LvshCon-infected cells was analyzed by flow cytometry assay following PI staining as described [17]. In brief, cells were collected 96 h after infection with lentivirus containing shSKA1 and seeded in six-well plates (2 9 105 cells per well). Cells were allowed to attach overnight and collected. After washing with ice-cold PBS, cells were suspended in about 0.5 ml of 70 % cold alcohol and kept at 4 °C for 30 min. The cells were then treated with 100 mg/ml of DNase–free RNase and incubated for 30 min at 37 °C. PI (50 mg/ml; Sigma-Aldrich) was added directly to the cell suspension. The suspension was filtered through a 50-mm nylon mesh, and total of 10,000 stained cells were analyzed by a flow cytometer (FACS Cali-bur, BD Biosciences). Statistical analysis All data were expressed as mean ± SD of three independent experiments. The Student’s t test and Mann–Whitney test were used to evaluate the differences and p \ 0.05 was considered statistically significant.
Results SKA1 is highly expressed in gastric cancer tissues To investigate the role of SKA1 in gastric tissues, the expression levels of SKA1 were examined in 56 gastric cancer samples and 54 non-neoplastic samples by IHC. Staining results were graded according to positive rate and staining intensity (Fig. 1a–d). The rate of strong positive SKA1 expression (hadro-positive) in gastric cancer tissues (41.07 %) was significantly higher than that in non-neoplastic tissues (20.37 %) (p = 0.019, Table 1). Further statistics showed that SKA1 hadro-positive rate in adenocarcinoma instead of signet-ring cell carcinoma was markedly higher than that in non-neoplastic tissues (Table 2), especially in adenocarcinoma grade II (p = 0.008) and III (p = 0.05) (Table 3). Our results indicated that SKA1 is highly expressed in gastric cancer tissues, especially in adenocarcinoma with higher histological grade.
123
170
Mol Cell Biochem (2014) 391:167–174
Fig. 1 SKA1 IHC staining was classified to four grades according to staining intensity. Representative photographs are shown of negative and positive SKA1 immunostaining in gastric tissues. a No positive staining was observed which represents negative staining result (-). b Less than 30 % cells were observed SKA1 staining positive which
represents weakly positive (-*?). c Less than 70 % cells were positive which represents positive (?). d Over 70 % cells were SKA1 staining positive which represents hadro-positive (??). Scale bar 25 lm
Table 1 IHC staining of Ska1 in both non-neoplasia and gastric cancer tissues
qRT-PCR to detect SKA1 expression in two frequently used gastric cancer cell lines MGC80-3 and SGC-7901. Immunoblot analysis showed that both cell lines express SKA1 (Fig. 2a). Moreover, qRT-PCR analysis revealed that MGC80-3 cells had higher SKA1 mRNA level than that in SGC7901 cells. Actually, the mRNA level of SKA1 in MGC80-3 cells was fivefold that in SGC-7901 cells (Fig. 2b). The discrepancy of SKA1 expression level in different cell lines indicated a differential expression model in cancer cells. In all, these results suggested that MGC80-3 cell line is optimal for subsequent investigation of the role of SKA1 in gastric cancer cell proliferation.
Total
Ska1 –
-*?
?
??
%a
p value
0.019*
Non-neoplasia
54
1
7
35
11
20.37
Gastric cancer
56
3
5
25
23
41.07
* p \ 0.05, Mann–Whitney test a
% means Ska1 hadro-positive percentage
Table 2 IHC staining of Ska1 in non-neoplasia, adenocarcinoma, and signet-ring cell carcinoma Total
%a
Ska1 –
-*?
?
??
p value
Non-neoplasia
54
1
7
35
11
20.37
Adenocarcinoma
52
2
3
24
23
44.23
0.009**
Signet-ring cell carcinoma
4
1
2
1
0
0
0.32
** p \ 0.01, Mann–Whitney test a
% means Ska1 hadro-positive percentage
Table 3 IHC staining of Ska1 in non-neoplasia and different adenocarcinoma histological grades (I, II, and III) Total
Non-neoplasia
%a
Ska1 –
-*?
?
??
p value
54
1
7
35
11
Adenocarcinoma I
2
0
0
1
1
20.37 50.00
0.32
Adenocarcinoma II
20
1
0
9
10
50.00
0.008**
Adenocarcinoma III
30
1
3
14
12
40.00
0.05*
* p \ 0.05, Mann–Whitney test; ** p \ 0.01, Mann–Whitney test a
% means Ska1 hadro-positive percentage
Expression level of SKA1 in gastric cancer cell lines The expression of SKA1 in gastric cancer cell lines remains unclear. To this end, we performed western blot analysis and
123
Expression level of SKA1 was markedly decreased by infection with Lv-shSKA1 in MGC80-3 cells To suppress SKA1 expression, the lentivirus expressing SKA1 shRNA (Lv-shSKA1) was transfected to gastric cancer cell line MGC80-3. Lentivirus expressing control shRNA (Lv-shCon) was also transfected as negative control. Infection was efficient as over 80 % MGC80-3 cells were observed to be GFP positive in both Lv-shCon and Lv-shSKA1 groups 96 h after transfection (Fig. 3a). To further validate the infection efficiency, we performed qRT-PCR and western blot analysis. As shown in Fig. 3b, the mRNA level of SKA1 was *93 % decreased compared with control group (p = 0.0007). Besides, the protein level of SKA1 was obviously down-regulated after infection with Lv-shSKA1 (Fig. 3c). In all, the shRNAexpressing lentivirus was successfully constructed to knock down SKA1 expression in gastric cancer cells. Depletion of SKA1 inhibited MGC80-3 cell proliferation and colony formation In a view to the role of SKA1 in gastric cancer cell growth, we performed MTT assay to continuously detect cell viability for 5 days. It was shown that the proliferation rate of MGC80-3 cells was decreased from day 3 in Lv-shSKA1
Mol Cell Biochem (2014) 391:167–174
171
Fig. 2 Expression level of SKA1 in gastric cancer cell lines MGC80-3 and SGC-7901. a Western blot analysis showed that both cell lines had high SKA1 expression. b qRT-PCR analysis revealed that MGC80-3 cells had higher SKA1 mRNA level than that in SGC-7901 cells
Fig. 3 Lentivirus stably expressing interference RNA targeting SKA1 was successfully constructed. a Infection was observed to be efficient at 96 h and over 80 % MGC80-3 cells presented to be GFP positive in both Lv-shCon and Lv-shSKA1 groups. Scale bar 50 lm. b qRT-PCR analysis verified that Lv-shSKA1 was successfully infected into MGC80-3 cells. c Western blot analysis validated that SKA1 expression was knocked down after infection with Lv-shSKA1. ***p \ 0.001
group (Fig. 4a). On day 4, the cell numbers were 81.4 % lower in Lv-shSKA1 group compared to control group (p \ 0.001). By day 5, the cell numbers were further decreased by up to 89.6 % when comparing Lv-shSKA1 group with control group (p \ 0.001). Consistent with MTT assay, MGC80-3 cells colony formation was also inhibited after Lv-shSKA1 infection (Fig. 4b, c). As depicted in Fig. 4b, nearly no colonies were formed after infection with Lv-shSKA1 while other groups like control or Lv-shCon group were observed visible colonies. Colonies counting also indicated that SKA1 depletion significantly lowered formed colonies numbers (p = 0.0021 vs. Con and p = 0.0007 vs. Lv-shCon). In fact, nearly no colony was observed in Lv-shSKA1 group while mean 220 colonies in control group and mean 197 colonies were formed in Lv-shCon group, respectively. Our results suggested that knockdown of SKA1 in MGC80-3 cells
significantly inhibits gastric cancer cell proliferation and colony formation. Depletion of SKA1 arrests cell cycle progression in MGC80-3 cells To further examine the effects of SKA1 depletion on cell cycle, MGC80-3 cells were synchronized in three distinct groups (Con, Lv-shCon and Lv-shSKA1) by serum starvation for 72 h. Complete medium containing 10 % serum was then added to each culture, and cell cycle progression was analyzed 24 h later by flow cytometry. As shown in Fig. 5a, the cell percentage in distinct phases of cell cycle (G0/G1 phase, S phase and G2/M phase) was observed significantly different in three groups. MGC80-3 cells in Con or Lv-shCon groups were mostly distributed in G0/G1 phase (p = 0.045 vs. Con and p = 0.0027 vs. Lv-shCon).
123
172
Mol Cell Biochem (2014) 391:167–174
Fig. 4 SKA1 depletion inhibits MGC80-3 cells proliferation and colony formation. a MTT assay was performed. Results showed that cell numbers were significantly decreased when compared with control group on day four and day five. b Colony formation assay showed that MGC80-3 cells colonies formation was also inhibited after infection with Lv-shSKA1. c Colonies counting also indicated
that SKA1 depletion significantly lowered formed colonies numbers (p = 0.00211 vs. con and p = 0.00071 vs. Lv-shCon). Nearly, no colony was observed in Lv-shSKA1 group while mean 220 colonies in control group and mean 197 colonies were formed in Lv-shCon group, respectively. ***p \ 0.001
Fig. 5 Depletion of SKA1 arrests cell cycle progression in MGC80-3 cells. a Cell cycle progression was assayed by flow cytometry in three groups (control, Lv-shCon, and Lv-shSKA1 groups). b FACS results showed that when infected with Lv-shSKA1, MGC80-3 cells were more inclined to redistribute intriguingly in S phase and G2/M phase.
Actually, compared with 28.42 % cells in S phase in control group, 35.12 % MGC80-3 cells were in S phase (p = 0.039) when infected with Lv-shSKA1. Similarly, 19.79 % cells were in G2/M phase in LvshSKA1 group compared with 17.62 % in control group. **p \ 0.01
On the contrary, when infected with Lv-shSKA1, MGC803 cells were more inclined to redistribute intriguingly in S phase (p = 0.039 vs. Con and p = 0.007 vs. Lv-shCon) (Fig. 5b). Actually, the cell percentage of S phase in LvshSKA1 group (35.12 %) was remarkably higher compared to control group (28.42 %). These results indicated that MGC80-3 cells were arrested in S phase of cell cycle after infection with Lv-shSKA1. Taken together, cell growth
inhibition induced by SKA1 depletion could be explained by cell cycle impairment in MGC80-3 cells.
123
Discussion Gastric cancer is a very common disease worldwide and the second most frequent cause of cancer death, affecting about
Mol Cell Biochem (2014) 391:167–174
one million people per year [18–20]. In our study, SKA1, a key factor in interphase mitosis, was shown to be overexpressed in gastric cancer tissues. Gene knockdown using siRNA represents an excellent tool to assess the functional importance of cancer-related genes in vitro. We employed siRNA to knockdown SKA1 expression in MGC80-3 cells and demonstrated that the absence of SKA1 markedly inhibited gastric cancer cell growth along with S phase arresting. These data implied that SKA1 might play a prominent role in the development of gastric cancer. The identification of SKA1 as a critical factor for gastric cancer cell growth is of biological importance. On one hand, last few decades have witnessed great progress in gastric cancer research. Among these is the foundation of H. pylori. However, gastric cancer is complex not only in etiology, but also in diagnosis and treatment. In fact, studies on the oncogenesis of gastric cancer suggest that genetic predisposition, infection, and diet are part of a complex interaction [21]. Recent evidence also showed that gastric cancer originates from DNA damage [22, 23] and germline mutation like E-cadherin gene (CDH1) [24]. Therefore, specific factors that exclusively affect cancer cell proliferation are badly needed to be exploited for early diagnosis of gastric cancer. On the other hand, aberrant cell growth is a major threat for cancer-related death. Inhibition of cell growth by RNAi may provide a promising therapeutic approach for human gastric cancer. Two distinct (although not mutually exclusive) regulation mechanisms of SKA1 in gastric cancer growth are possible: mitotic kinase Aurora B-mediated pathway and KMN network-dependent pathway. The mitotic kinase Aurora B is critical for both error correction through destabilization of incorrect attachments [25] and for checkpoint signaling [26] which is also controlled by Ska complex. In fact, aurora B was reported to antagonize Ska complex localization to KTs [6]. So SKA1 could be regulated by aurora B when getting involved in gastric cancer growth. However, other evidence also pointed out that the conserved KMN network is central to KT–MT attachment at outer KTs [27, 28]. KMN network could manipulate mitosis anaphase onset by interaction with SKA1 and Ska2. Thus KMN network-dependent pathway may be another mechanism for SKA1 regulation of cell growth. But all these evidence are not acquired in gastric cancer cell lines. Further investigation needs to be done to clarify the detailed mechanism of SKA1 in regulating gastric cancer cell growth. In all, these findings suggest SKA1 as a biomarker used for gastric cancer early diagnosis and possibly enable a potential therapeutic based on targeting SKA1. Further investigation regarding the SKA1 regulatory mechanism may help to better understand gastric cancer progression.
173
References 1. Parkin DM, Bray F, Ferlay J, Pisani P (2005) Global cancer statistics, 2002. CA Cancer J Clin 55:74–108 2. Jemal A, Siegel R, Xu J, Ward E (2010) Cancer statistics, 2010. CA Cancer J Clin 60:277–300. doi:10.3322/caac.20073 3. Shridhar R, Almhanna K, Hoffe SE, Fulp W, Weber J, Chuong MD, Meredith KL (2013) Increased survival associated with surgery and radiation therapy in metastatic gastric cancer: a surveillance, epidemiology, and end results database analysis. Cancer 119:1636–1642. doi:10.1002/cncr.27927 4. Wagner AD, Grothe W, Haerting J, Kleber G, Grothey A, Fleig WE (2006) Chemotherapy in advanced gastric cancer: a systematic review and meta-analysis based on aggregate data. J Clin Oncol 24:2903–2909. doi:10.1200/JCO.2005.05.0245 5. Yamaoka Y, Kato M, Asaka M (2008) Geographic differences in gastric cancer incidence can be explained by differences between Helicobacter pylori strains. Intern Med 47:1077–1083 6. Chan YW, Jeyaprakash AA, Nigg EA, Santamaria A (2012) Aurora B controls kinetochore–microtubule attachments by inhibiting Ska complex–KMN network interaction. J Cell Biol 196:563–571. doi:10.1083/jcb.201109001 7. Gaitanos TN, Santamaria A, Jeyaprakash AA, Wang B, Conti E, Nigg EA (2009) Stable kinetochore–microtubule interactions depend on the Ska complex and its new component Ska3/ C13Orf3. EMBO J 28:1442–1452. doi:10.1038/emboj.2009.96 8. Raaijmakers JA, Tanenbaum ME, Maia AF, Medema RH (2009) RAMA1 is a novel kinetochore protein involved in kinetochore– microtubule attachment. J Cell Sci 122:2436–2445. doi:10.1242/ jcs.051912 9. Theis M, Slabicki M, Junqueira M, Paszkowski-Rogacz M, Sontheimer J, Kittler R, Heninger AK, Glatter T, Kruusmaa K, Poser I, Hyman AA, Pisabarro MT, Gstaiger M, Aebersold R, Shevchenko A, Buchholz F (2009) Comparative profiling identifies C13orf3 as a component of the Ska complex required for mammalian cell division. EMBO J 28:1453–1465. doi:10.1038/emboj.2009.114 10. Welburn JP, Grishchuk EL, Backer CB, Wilson-Kubalek EM, Yates JR 3rd, Cheeseman IM (2009) The human kinetochore Ska1 complex facilitates microtubule depolymerization-coupled motility. Dev Cell 16:374–385. doi:10.1016/j.devcel.2009.01.011 11. Hanisch A, Sillje HH, Nigg EA (2006) Timely anaphase onset requires a novel spindle and kinetochore complex comprising Ska1 and Ska2. EMBO J 25:5504–5515. doi:10.1038/sj.emboj. 7601426 12. Nara M, Teshima K, Watanabe A, Ito M, Iwamoto K, Kitabayashi A, Kume M, Hatano Y, Takahashi N, Iida S, Sawada K, Tagawa H (2013) Bortezomib reduces the tumorigenicity of multiple myeloma via downregulation of upregulated targets in clonogenic side population cells. PLoS One 8:e56954. doi:10. 1371/journal.pone.0056954 13. Holen I, Whitworth J, Nutter F, Evans A, Brown HK, Lefley DV, Barbaric I, Jones M, Ottewell PD (2012) Loss of plakoglobin promotes decreased cell–cell contact, increased invasion, and breast cancer cell dissemination in vivo. Breast Cancer Res 14:R86. doi:10.1186/bcr3201 14. Sakoda T, Kasahara N, Hamamori Y, Kedes L (1999) A high-titer lentiviral production system mediates efficient transduction of differentiated cells including beating cardiac myocytes. J Mol Cell Cardiol 31:2037–2047. doi:10.1006/jmcc.1999.1035 15. Soneoka Y, Cannon PM, Ramsdale EE, Griffiths JC, Romano G, Kingsman SM, Kingsman AJ (1995) A transient three-plasmid expression system for the production of high titer retroviral vectors. Nucleic Acids Res 23:628–633
123
174 16. Tiscornia G, Singer O, Verma IM (2006) Production and purification of lentiviral vectors. Nat Protoc 1:241–245. doi:10.1038/ nprot.2006.37 17. Tricoli JV, Bracken RB (1993) ZFY gene expression and retention in human prostate adenocarcinoma. Genes Chromosom Cancer 6:65–72 18. Butte JM, Duarte I, Crovari F, Guzman S, Llanos O (2007) Gastric cancer in patients older than 75 years. Surgical treatment and long-term survival. Cir Esp 82:341–345 19. Hartgrink HH, Jansen EP, van Grieken NC, van de Velde CJ (2009) Gastric cancer. Lancet 374:477–490. doi:10.1016/S01406736(09)60617-6 20. Kamangar F, Dores GM, Anderson WF (2006) Patterns of cancer incidence, mortality, and prevalence across five continents: defining priorities to reduce cancer disparities in different geographic regions of the world. J Clin Oncol 24:2137–2150. doi:10. 1200/JCO.2005.05.2308 21. Hohenberger P, Gretschel S (2003) Gastric cancer. Lancet 362:305–315 22. Ottini L, Falchetti M, Lupi R, Rizzolo P, Agnese V, Colucci G, Bazan V, Russo A (2006) Patterns of genomic instability in gastric cancer: clinical implications and perspectives. Ann Oncol 17(Suppl 7):vii97–102. doi:10.1093/annonc/mdl960 23. Suzuki K, Suzuki I, Leodolter A, Alonso S, Horiuchi S, Yamashita K, Perucho M (2006) Global DNA demethylation in
123
Mol Cell Biochem (2014) 391:167–174
24.
25.
26.
27.
28.
gastrointestinal cancer is age dependent and precedes genomic damage. Cancer Cell 9:199–207. doi:10.1016/j.ccr.2006.02.016 Guilford PJ, Hopkins JB, Grady WM, Markowitz SD, Willis J, Lynch H, Rajput A, Wiesner GL, Lindor NM, Burgart LJ, Toro TT, Lee D, Limacher JM, Shaw DW, Findlay MP, Reeve AE (1999) E-cadherin germline mutations define an inherited cancer syndrome dominated by diffuse gastric cancer. Hum Mutat 14:249–255. doi:10.1002/(SICI)1098-1004(1999)14:3\249:AIDHUMU8[3.0.CO;2-9 Nezi L, Musacchio A (2009) Sister chromatid tension and the spindle assembly checkpoint. Curr Opin Cell Biol 21:785–795. doi:10.1016/j.ceb.2009.09.007 Santaguida S, Vernieri C, Villa F, Ciliberto A, Musacchio A (2011) Evidence that Aurora B is implicated in spindle checkpoint signalling independently of error correction. EMBO J 30:1508–1519. doi:10.1038/emboj.2011.70 Cheeseman IM, Chappie JS, Wilson-Kubalek EM, Desai A (2006) The conserved KMN network constitutes the core microtubule-binding site of the kinetochore. Cell 127:983–997. doi:10.1016/j.cell.2006.09.039 Santaguida S, Musacchio A (2009) The life and miracles of kinetochores. EMBO J 28:2511–2531. doi:10.1038/emboj.2009. 173
Spindle and kinetochore-associated protein 1 is overexpressed in gastric cancer and modulates cell growth Wei Sun • Li Yao • Benchun Jiang Lin Guo • Qiang Wang
•
Received: 30 October 2013 / Accepted: 21 February 2014 / Published online: 14 March 2014 Ó Springer Science+Business Media New York 2014
Abstract Spindle and kinetochore-associated protein 1 (SKA1) is a microtubule-binding subcomplex of the outer kinetochore that is essential for proper chromosome segregation. SKA1 is required for timely anaphase onset during mitosis, when chromosomes undergo bipolar attachment on spindle microtubules leading to silencing of the spindle checkpoint. Recently, SKA1 has been highlighted as a biomarker in some types of cancers, however, the precise role of SKA1 in gastric cancer remains unknown. In order to investigate the role of SKA1 in gastric cancer, the expression levels of SKA1 were analyzed in 56 gastric cancer samples and 54 non-neoplastic samples by immunohistochemistry, and we found SKA1 was significantly overexpressed in gastric cancer tissues. Moreover, we employed lentivirus-mediated short hairpin RNA to knockdown SKA1 in the human gastric cancer cell line MGC80-3. Functional analysis indicated that SKA1 silencing significantly inhibited cell proliferation and colony formation, as determined by MTT and colony formation assays. The depletion of SKA1 in MGC80-3 cells also led to S phase cell cycle arrest. These results suggest that SKA1 could be used for gastric cancer early diagnosis as a biomarker. It is possible to enable a potential therapy based on targeting SKA1.
W. Sun (&) B. Jiang L. Guo Q. Wang Department of General Surgery, Affiliated Shengjing Hospital, China Medical University, Sanhao Street 36#, Shenyang 110004, Liaoning, China e-mail: [email protected] L. Yao Department of Nephrology, The Frist Affiliated Hospital, China Medical University, Shenyang 110001, Liaoning, China
Keywords Spindle and kinetochore-associated protein 1 Gastric cancer Immunohistochemistry Short hairpin RNA Cell growth
Introduction Gastric cancer is the second leading cause of cancer mortality and the fourth most common cancer in the world with *934,000 new cases diagnosed and an anticipated 700,000 deaths annually [1]. In the United States, an estimated 21,000 new cases and 11,000 deaths were expected in 2010 [2]. However, most gastric cancers are diagnosed at advanced or metastatic stages when the tumor is considered unresectable [3, 4], especially in many endemic areas where programs for early detection is limited. For patients with advanced stage gastric cancer, the 5-year survival rate is *20 %. Thus, early diagnosis is important for gastric cancer prevention and treatment. Moreover, large differences in incidence exist between continents. The highest incidenceup to 69 cases per 100,000 people per year is in men in East Asian countries (e.g., Japan, Korea, and China) [5]. Spindle and kinetochore-associated protein 1 (SKA1) is a microtubule (MT)-binding subcomplex of the outer kinetochore (KT) that is essential for proper chromosome segregation. Chromosome alignment and segregation require that all KTs establish stable bioriented attachments to spindle MTs. Central to this process is the ska complex (SKA1, 2 and 3) and its interaction with KMN network [6]. SKA1, together with Ska2 and Ska3, has been proposed to be required for stable KT–MT attachments [7–10]. In this process, Ska complex mainly forms assemblies on MTs that can facilitate the processive movement of microspheres along depolymerizing MTs [10]. Efficient depletion of the Ska complex leads to severe attachment defects
123
168
and unstable K-fibers [7, 8, 10]. Additionally, the Ska complex has also been implicated in silencing of the spindle checkpoint [11] and in maintenance of sister chromatid cohesion [9]. All these observations led us to propose that the Ska complex is required for stabilizing KT–MT attachments and/or checkpoint silencing, therefore making SKA1 a prominent protein possibly affecting cell cycle and mitosis. Cancer growth is a major burden for gastric cancer which means factors affecting cell cycle and proliferation process may mediate cancer cell growth and thus tumorigenesis. Nara et al. [12] have suggested SKA1 as a biomarker for side population cells in carcinomas. In the present study, in order to obtain insight into the association between SKA1 expression and gastric cancer growth, we assessed SKA1 expression in 110 cases of human gastric tissues and found SKA1 was significantly overexpressed in gastric cancer tissues. Moreover, the role of SKA1 in cell growth was examined in the gastric cancer cell line MGC80-3 that was subjected to SKA1 knockdown.
Materials and methods Cell lines and cell culture Gastric cancer cell lines MGC80-3 and SGC-7901 and human embryonic kidney cell line 293T (HEK293T) were obtained from American Type Culture Collection (ATCC, Manassas, VA, USA). Cells were maintained in RPMI1640 (Gibco, Cambrex, MD) supplemented with 10 % heatinactivated fetal bovine serum (FBS) and penicillin/streptomycin at 37 °C in humidified atmosphere of 5 % CO2. HEK293T cells were cultured in DMEM (Hyclone, Logan, UT) supplemented with 10 % heat-inactivated FBS. Tissue specimen 110 cases of gastric cancer tissues including 52 cases of adenocarcinoma and 4 cases of signet-ring cell carcinoma (n = 56) and non-neoplastic tissues (n = 54) were collected from the Department of Gastrointestinal and Pancreatic Surgery of the Affiliated Shengjing Hospital, China Medical University from 2003 to 2005. Patients who received chemotherapy, radiotherapy, and/or biotherapy before surgery were excluded from the study. The pathologic stage of disease was determined according to the American Joint Committee on Cancer (AJCC) TNM staging system. All treatment plans were designed according to the latest National Comprehensive Cancer Network (NCCN) guidelines for gastric cancer.
123
Mol Cell Biochem (2014) 391:167–174
Immunohistochemistry staining (IHC) Paraffin-embedded tissues were subjected to antigen retrieval by heating the slides in an autoclave at 120 °C for 5 min in 0.1 M citric acid buffer (pH 6.0), then incubated with the rabbit anti-SKA1 antibody (1:300, Sigma, St. Louis, MO, USA) at 4 °C overnight. After incubation in anti-rabbit detection reagent for 1 h at room temperature, the sections were developed in 0.05 % diaminobenzidine containing 0.01 % hydrogen peroxidase. For negative controls, the rabbit anti-SKA1 antibody was replaced with normal goat serum by co-incubation at 4 °C overnight preceding the immunohistochemical staining procedure. Hematoxylin was used to co-stain nuclei. Western blot analysis Cells were homogenized in lysis butter (0.1 M Tris buffer (pH 7.4), 0.1 mM EDTA) in the presence of 1 mM dithiothreitol (DTT), 1 mM phenylmethylsulfonyl fluoride, and protease inhibitor cocktail (Roche, IN, USA). The equal amount of sample was loaded in each well of a 7.5 % gel and subjected to SDS-PAGE. Gels were transferred to nitrocellulose membrane. The membrane was then incubated with primary antibodies for 4 °C overnight against SKA1 (1:1,000, Sigma, St. Louis, MO, USA) and GAPDH (1:3,000, Santa Cruz, CA, USA). After washing with TBST, the membrane was incubated with secondary antibody against rabbit and mouse IgGs (1:5,000, Santa Cruz, CA, USA), and the signals were visualized using ECL plus western blotting system. All experiments mentioned above were performed in triplicate unless otherwise noted. RNA extraction and quantitative real-time PCR (qRTPCR) When cells were harvested, the total RNA was extracted using Trizol solution (Invitrogen, Carlsbad, CA, USA). Equal amounts of RNA (1 lg) were reverse-transcribed using the Transcriptor First Strand cDNA synthesis Kit (Roche, IN, USA). The primers used are as follows: SKA1: Forward 50 -TGATGTGCCAGGAAGGTGAC0 3 Reverse 50 -CAAAGGATACAGATGAACAACAGC-30 Actin: Forward 50 -GTGGACATCCGCAAAGAC-30 Reverse 0 5 -AAAGGGTGTAACGCAACTA-30 Primers were synthesized by Shanghai Daweike Biotechnology Co. Ltd (Shanghai, China). PCR cycle conditions were 95 °C for 30 s, and 40 cycles of 95 °C for 5 s and 60 °C for 30 s. The amplification specificity was evaluated with melting curve analysis. Relative mRNA was determined using the formula 2-DCT (CT; cycle threshold) where DCT = CT (target gene) - CT (Actin) as described previously [13].
Mol Cell Biochem (2014) 391:167–174
Construction of SKA1 short hairpin RNA-expressing lentivirus In order to create shSKA1 stably expressing cell lines, the SKA1 short hairpin RNA (shRNA) (50 -CCGGCCTGACA CAAAGCTCCTAAATCTCGAGATTTAGGAGCTTTGT GTCAGGTTTTTG-30 ) was inserted into the pFH-L vector (Hollybio, Shanghai, China). The non-silencing siRNA (50 TTCTCCGAACGTGTCACGT-30 ) was also used as control. The lentivirus-based shRNA-expressing vectors were constructed and confirmed by DNA sequencing. The generated plasmids were named as pFH-L-shSKA1 or pFH-LshCon. Recombined lentiviral vectors and pVSVG-I/ pCMVDR8.92 packaging vectors were then transfected into HEK293T cells. Supernatants containing either the lentivirus expressing the SKA1 shRNA (Lv-shSKA1) or the control shRNA (Lv-shCon) were harvested 72 h after transfection. The lentiviral particles were purified by ultracentrifugation, and the viral titer was determined according to previous reports [14, 15]. MGC80-3 cells were infected with the lentivirus constructs at a multiplicity of infection (MOI) of 50. As the lentivirus carries green fluorescence protein (GFP), the efficiency of infection was determined by counting GFP-expressing cells under fluorescence microscopy 96 h after infection as described in previous reports [16]. MTT proliferation assay To detect cell viability, 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide (MTT) colorimetric assay was performed. Briefly, MGC80-3 cells were washed with phosphate-buffered saline (PBS) and suspended at a final concentration of 2 9 104 per ml in an assay medium and dispensed into 96-well plates. The plates were incubated at 37 °C for 1–5 days in a humidified CO2 incubator. After the treatment time, 100 ml of MTT (5 mg/ml) was added to each well, the plates were incubated at 37 °C for 4 h, and then 10 % dimethylsulfoxide (100 ml) was added to each well. The absorbance at 490 nm was measured using a synergy 2 multi-mode microplate reader (Bio Tek Instruments, Winooski, VT, USA). Experiments were performed in triplicate. Plate colony formation assay MGC80-3 cells (total of 500 cells per well) were seeded into six-well plates 3 days after lentivirus infection. The medium was changed at 3-day intervals. After 7 days of culture at 37 °C, cells were washed with PBS and fixed with 4 % paraformaldehyde for 30 min at room temperature. The fixed cells were then stained with freshly prepared diluted Giemsa (Merck) for 10 min, washed with
169
water and air-dried. The total number of colonies with more than 50 cells was counted using light microscope and fluorescent microscope. Fluorescence-activated cell sorting analysis (FACS) The DNA contents of cell cycle phases can be reflected by varying propidium iodide (PI) fluorescent intensities. Therefore, cell cycle distribution of Lv-shSKA1- or LvshCon-infected cells was analyzed by flow cytometry assay following PI staining as described [17]. In brief, cells were collected 96 h after infection with lentivirus containing shSKA1 and seeded in six-well plates (2 9 105 cells per well). Cells were allowed to attach overnight and collected. After washing with ice-cold PBS, cells were suspended in about 0.5 ml of 70 % cold alcohol and kept at 4 °C for 30 min. The cells were then treated with 100 mg/ml of DNase–free RNase and incubated for 30 min at 37 °C. PI (50 mg/ml; Sigma-Aldrich) was added directly to the cell suspension. The suspension was filtered through a 50-mm nylon mesh, and total of 10,000 stained cells were analyzed by a flow cytometer (FACS Cali-bur, BD Biosciences). Statistical analysis All data were expressed as mean ± SD of three independent experiments. The Student’s t test and Mann–Whitney test were used to evaluate the differences and p \ 0.05 was considered statistically significant.
Results SKA1 is highly expressed in gastric cancer tissues To investigate the role of SKA1 in gastric tissues, the expression levels of SKA1 were examined in 56 gastric cancer samples and 54 non-neoplastic samples by IHC. Staining results were graded according to positive rate and staining intensity (Fig. 1a–d). The rate of strong positive SKA1 expression (hadro-positive) in gastric cancer tissues (41.07 %) was significantly higher than that in non-neoplastic tissues (20.37 %) (p = 0.019, Table 1). Further statistics showed that SKA1 hadro-positive rate in adenocarcinoma instead of signet-ring cell carcinoma was markedly higher than that in non-neoplastic tissues (Table 2), especially in adenocarcinoma grade II (p = 0.008) and III (p = 0.05) (Table 3). Our results indicated that SKA1 is highly expressed in gastric cancer tissues, especially in adenocarcinoma with higher histological grade.
123
170
Mol Cell Biochem (2014) 391:167–174
Fig. 1 SKA1 IHC staining was classified to four grades according to staining intensity. Representative photographs are shown of negative and positive SKA1 immunostaining in gastric tissues. a No positive staining was observed which represents negative staining result (-). b Less than 30 % cells were observed SKA1 staining positive which
represents weakly positive (-*?). c Less than 70 % cells were positive which represents positive (?). d Over 70 % cells were SKA1 staining positive which represents hadro-positive (??). Scale bar 25 lm
Table 1 IHC staining of Ska1 in both non-neoplasia and gastric cancer tissues
qRT-PCR to detect SKA1 expression in two frequently used gastric cancer cell lines MGC80-3 and SGC-7901. Immunoblot analysis showed that both cell lines express SKA1 (Fig. 2a). Moreover, qRT-PCR analysis revealed that MGC80-3 cells had higher SKA1 mRNA level than that in SGC7901 cells. Actually, the mRNA level of SKA1 in MGC80-3 cells was fivefold that in SGC-7901 cells (Fig. 2b). The discrepancy of SKA1 expression level in different cell lines indicated a differential expression model in cancer cells. In all, these results suggested that MGC80-3 cell line is optimal for subsequent investigation of the role of SKA1 in gastric cancer cell proliferation.
Total
Ska1 –
-*?
?
??
%a
p value
0.019*
Non-neoplasia
54
1
7
35
11
20.37
Gastric cancer
56
3
5
25
23
41.07
* p \ 0.05, Mann–Whitney test a
% means Ska1 hadro-positive percentage
Table 2 IHC staining of Ska1 in non-neoplasia, adenocarcinoma, and signet-ring cell carcinoma Total
%a
Ska1 –
-*?
?
??
p value
Non-neoplasia
54
1
7
35
11
20.37
Adenocarcinoma
52
2
3
24
23
44.23
0.009**
Signet-ring cell carcinoma
4
1
2
1
0
0
0.32
** p \ 0.01, Mann–Whitney test a
% means Ska1 hadro-positive percentage
Table 3 IHC staining of Ska1 in non-neoplasia and different adenocarcinoma histological grades (I, II, and III) Total
Non-neoplasia
%a
Ska1 –
-*?
?
??
p value
54
1
7
35
11
Adenocarcinoma I
2
0
0
1
1
20.37 50.00
0.32
Adenocarcinoma II
20
1
0
9
10
50.00
0.008**
Adenocarcinoma III
30
1
3
14
12
40.00
0.05*
* p \ 0.05, Mann–Whitney test; ** p \ 0.01, Mann–Whitney test a
% means Ska1 hadro-positive percentage
Expression level of SKA1 in gastric cancer cell lines The expression of SKA1 in gastric cancer cell lines remains unclear. To this end, we performed western blot analysis and
123
Expression level of SKA1 was markedly decreased by infection with Lv-shSKA1 in MGC80-3 cells To suppress SKA1 expression, the lentivirus expressing SKA1 shRNA (Lv-shSKA1) was transfected to gastric cancer cell line MGC80-3. Lentivirus expressing control shRNA (Lv-shCon) was also transfected as negative control. Infection was efficient as over 80 % MGC80-3 cells were observed to be GFP positive in both Lv-shCon and Lv-shSKA1 groups 96 h after transfection (Fig. 3a). To further validate the infection efficiency, we performed qRT-PCR and western blot analysis. As shown in Fig. 3b, the mRNA level of SKA1 was *93 % decreased compared with control group (p = 0.0007). Besides, the protein level of SKA1 was obviously down-regulated after infection with Lv-shSKA1 (Fig. 3c). In all, the shRNAexpressing lentivirus was successfully constructed to knock down SKA1 expression in gastric cancer cells. Depletion of SKA1 inhibited MGC80-3 cell proliferation and colony formation In a view to the role of SKA1 in gastric cancer cell growth, we performed MTT assay to continuously detect cell viability for 5 days. It was shown that the proliferation rate of MGC80-3 cells was decreased from day 3 in Lv-shSKA1
Mol Cell Biochem (2014) 391:167–174
171
Fig. 2 Expression level of SKA1 in gastric cancer cell lines MGC80-3 and SGC-7901. a Western blot analysis showed that both cell lines had high SKA1 expression. b qRT-PCR analysis revealed that MGC80-3 cells had higher SKA1 mRNA level than that in SGC-7901 cells
Fig. 3 Lentivirus stably expressing interference RNA targeting SKA1 was successfully constructed. a Infection was observed to be efficient at 96 h and over 80 % MGC80-3 cells presented to be GFP positive in both Lv-shCon and Lv-shSKA1 groups. Scale bar 50 lm. b qRT-PCR analysis verified that Lv-shSKA1 was successfully infected into MGC80-3 cells. c Western blot analysis validated that SKA1 expression was knocked down after infection with Lv-shSKA1. ***p \ 0.001
group (Fig. 4a). On day 4, the cell numbers were 81.4 % lower in Lv-shSKA1 group compared to control group (p \ 0.001). By day 5, the cell numbers were further decreased by up to 89.6 % when comparing Lv-shSKA1 group with control group (p \ 0.001). Consistent with MTT assay, MGC80-3 cells colony formation was also inhibited after Lv-shSKA1 infection (Fig. 4b, c). As depicted in Fig. 4b, nearly no colonies were formed after infection with Lv-shSKA1 while other groups like control or Lv-shCon group were observed visible colonies. Colonies counting also indicated that SKA1 depletion significantly lowered formed colonies numbers (p = 0.0021 vs. Con and p = 0.0007 vs. Lv-shCon). In fact, nearly no colony was observed in Lv-shSKA1 group while mean 220 colonies in control group and mean 197 colonies were formed in Lv-shCon group, respectively. Our results suggested that knockdown of SKA1 in MGC80-3 cells
significantly inhibits gastric cancer cell proliferation and colony formation. Depletion of SKA1 arrests cell cycle progression in MGC80-3 cells To further examine the effects of SKA1 depletion on cell cycle, MGC80-3 cells were synchronized in three distinct groups (Con, Lv-shCon and Lv-shSKA1) by serum starvation for 72 h. Complete medium containing 10 % serum was then added to each culture, and cell cycle progression was analyzed 24 h later by flow cytometry. As shown in Fig. 5a, the cell percentage in distinct phases of cell cycle (G0/G1 phase, S phase and G2/M phase) was observed significantly different in three groups. MGC80-3 cells in Con or Lv-shCon groups were mostly distributed in G0/G1 phase (p = 0.045 vs. Con and p = 0.0027 vs. Lv-shCon).
123
172
Mol Cell Biochem (2014) 391:167–174
Fig. 4 SKA1 depletion inhibits MGC80-3 cells proliferation and colony formation. a MTT assay was performed. Results showed that cell numbers were significantly decreased when compared with control group on day four and day five. b Colony formation assay showed that MGC80-3 cells colonies formation was also inhibited after infection with Lv-shSKA1. c Colonies counting also indicated
that SKA1 depletion significantly lowered formed colonies numbers (p = 0.00211 vs. con and p = 0.00071 vs. Lv-shCon). Nearly, no colony was observed in Lv-shSKA1 group while mean 220 colonies in control group and mean 197 colonies were formed in Lv-shCon group, respectively. ***p \ 0.001
Fig. 5 Depletion of SKA1 arrests cell cycle progression in MGC80-3 cells. a Cell cycle progression was assayed by flow cytometry in three groups (control, Lv-shCon, and Lv-shSKA1 groups). b FACS results showed that when infected with Lv-shSKA1, MGC80-3 cells were more inclined to redistribute intriguingly in S phase and G2/M phase.
Actually, compared with 28.42 % cells in S phase in control group, 35.12 % MGC80-3 cells were in S phase (p = 0.039) when infected with Lv-shSKA1. Similarly, 19.79 % cells were in G2/M phase in LvshSKA1 group compared with 17.62 % in control group. **p \ 0.01
On the contrary, when infected with Lv-shSKA1, MGC803 cells were more inclined to redistribute intriguingly in S phase (p = 0.039 vs. Con and p = 0.007 vs. Lv-shCon) (Fig. 5b). Actually, the cell percentage of S phase in LvshSKA1 group (35.12 %) was remarkably higher compared to control group (28.42 %). These results indicated that MGC80-3 cells were arrested in S phase of cell cycle after infection with Lv-shSKA1. Taken together, cell growth
inhibition induced by SKA1 depletion could be explained by cell cycle impairment in MGC80-3 cells.
123
Discussion Gastric cancer is a very common disease worldwide and the second most frequent cause of cancer death, affecting about
Mol Cell Biochem (2014) 391:167–174
one million people per year [18–20]. In our study, SKA1, a key factor in interphase mitosis, was shown to be overexpressed in gastric cancer tissues. Gene knockdown using siRNA represents an excellent tool to assess the functional importance of cancer-related genes in vitro. We employed siRNA to knockdown SKA1 expression in MGC80-3 cells and demonstrated that the absence of SKA1 markedly inhibited gastric cancer cell growth along with S phase arresting. These data implied that SKA1 might play a prominent role in the development of gastric cancer. The identification of SKA1 as a critical factor for gastric cancer cell growth is of biological importance. On one hand, last few decades have witnessed great progress in gastric cancer research. Among these is the foundation of H. pylori. However, gastric cancer is complex not only in etiology, but also in diagnosis and treatment. In fact, studies on the oncogenesis of gastric cancer suggest that genetic predisposition, infection, and diet are part of a complex interaction [21]. Recent evidence also showed that gastric cancer originates from DNA damage [22, 23] and germline mutation like E-cadherin gene (CDH1) [24]. Therefore, specific factors that exclusively affect cancer cell proliferation are badly needed to be exploited for early diagnosis of gastric cancer. On the other hand, aberrant cell growth is a major threat for cancer-related death. Inhibition of cell growth by RNAi may provide a promising therapeutic approach for human gastric cancer. Two distinct (although not mutually exclusive) regulation mechanisms of SKA1 in gastric cancer growth are possible: mitotic kinase Aurora B-mediated pathway and KMN network-dependent pathway. The mitotic kinase Aurora B is critical for both error correction through destabilization of incorrect attachments [25] and for checkpoint signaling [26] which is also controlled by Ska complex. In fact, aurora B was reported to antagonize Ska complex localization to KTs [6]. So SKA1 could be regulated by aurora B when getting involved in gastric cancer growth. However, other evidence also pointed out that the conserved KMN network is central to KT–MT attachment at outer KTs [27, 28]. KMN network could manipulate mitosis anaphase onset by interaction with SKA1 and Ska2. Thus KMN network-dependent pathway may be another mechanism for SKA1 regulation of cell growth. But all these evidence are not acquired in gastric cancer cell lines. Further investigation needs to be done to clarify the detailed mechanism of SKA1 in regulating gastric cancer cell growth. In all, these findings suggest SKA1 as a biomarker used for gastric cancer early diagnosis and possibly enable a potential therapeutic based on targeting SKA1. Further investigation regarding the SKA1 regulatory mechanism may help to better understand gastric cancer progression.
173
References 1. Parkin DM, Bray F, Ferlay J, Pisani P (2005) Global cancer statistics, 2002. CA Cancer J Clin 55:74–108 2. Jemal A, Siegel R, Xu J, Ward E (2010) Cancer statistics, 2010. CA Cancer J Clin 60:277–300. doi:10.3322/caac.20073 3. Shridhar R, Almhanna K, Hoffe SE, Fulp W, Weber J, Chuong MD, Meredith KL (2013) Increased survival associated with surgery and radiation therapy in metastatic gastric cancer: a surveillance, epidemiology, and end results database analysis. Cancer 119:1636–1642. doi:10.1002/cncr.27927 4. Wagner AD, Grothe W, Haerting J, Kleber G, Grothey A, Fleig WE (2006) Chemotherapy in advanced gastric cancer: a systematic review and meta-analysis based on aggregate data. J Clin Oncol 24:2903–2909. doi:10.1200/JCO.2005.05.0245 5. Yamaoka Y, Kato M, Asaka M (2008) Geographic differences in gastric cancer incidence can be explained by differences between Helicobacter pylori strains. Intern Med 47:1077–1083 6. Chan YW, Jeyaprakash AA, Nigg EA, Santamaria A (2012) Aurora B controls kinetochore–microtubule attachments by inhibiting Ska complex–KMN network interaction. J Cell Biol 196:563–571. doi:10.1083/jcb.201109001 7. Gaitanos TN, Santamaria A, Jeyaprakash AA, Wang B, Conti E, Nigg EA (2009) Stable kinetochore–microtubule interactions depend on the Ska complex and its new component Ska3/ C13Orf3. EMBO J 28:1442–1452. doi:10.1038/emboj.2009.96 8. Raaijmakers JA, Tanenbaum ME, Maia AF, Medema RH (2009) RAMA1 is a novel kinetochore protein involved in kinetochore– microtubule attachment. J Cell Sci 122:2436–2445. doi:10.1242/ jcs.051912 9. Theis M, Slabicki M, Junqueira M, Paszkowski-Rogacz M, Sontheimer J, Kittler R, Heninger AK, Glatter T, Kruusmaa K, Poser I, Hyman AA, Pisabarro MT, Gstaiger M, Aebersold R, Shevchenko A, Buchholz F (2009) Comparative profiling identifies C13orf3 as a component of the Ska complex required for mammalian cell division. EMBO J 28:1453–1465. doi:10.1038/emboj.2009.114 10. Welburn JP, Grishchuk EL, Backer CB, Wilson-Kubalek EM, Yates JR 3rd, Cheeseman IM (2009) The human kinetochore Ska1 complex facilitates microtubule depolymerization-coupled motility. Dev Cell 16:374–385. doi:10.1016/j.devcel.2009.01.011 11. Hanisch A, Sillje HH, Nigg EA (2006) Timely anaphase onset requires a novel spindle and kinetochore complex comprising Ska1 and Ska2. EMBO J 25:5504–5515. doi:10.1038/sj.emboj. 7601426 12. Nara M, Teshima K, Watanabe A, Ito M, Iwamoto K, Kitabayashi A, Kume M, Hatano Y, Takahashi N, Iida S, Sawada K, Tagawa H (2013) Bortezomib reduces the tumorigenicity of multiple myeloma via downregulation of upregulated targets in clonogenic side population cells. PLoS One 8:e56954. doi:10. 1371/journal.pone.0056954 13. Holen I, Whitworth J, Nutter F, Evans A, Brown HK, Lefley DV, Barbaric I, Jones M, Ottewell PD (2012) Loss of plakoglobin promotes decreased cell–cell contact, increased invasion, and breast cancer cell dissemination in vivo. Breast Cancer Res 14:R86. doi:10.1186/bcr3201 14. Sakoda T, Kasahara N, Hamamori Y, Kedes L (1999) A high-titer lentiviral production system mediates efficient transduction of differentiated cells including beating cardiac myocytes. J Mol Cell Cardiol 31:2037–2047. doi:10.1006/jmcc.1999.1035 15. Soneoka Y, Cannon PM, Ramsdale EE, Griffiths JC, Romano G, Kingsman SM, Kingsman AJ (1995) A transient three-plasmid expression system for the production of high titer retroviral vectors. Nucleic Acids Res 23:628–633
123
174 16. Tiscornia G, Singer O, Verma IM (2006) Production and purification of lentiviral vectors. Nat Protoc 1:241–245. doi:10.1038/ nprot.2006.37 17. Tricoli JV, Bracken RB (1993) ZFY gene expression and retention in human prostate adenocarcinoma. Genes Chromosom Cancer 6:65–72 18. Butte JM, Duarte I, Crovari F, Guzman S, Llanos O (2007) Gastric cancer in patients older than 75 years. Surgical treatment and long-term survival. Cir Esp 82:341–345 19. Hartgrink HH, Jansen EP, van Grieken NC, van de Velde CJ (2009) Gastric cancer. Lancet 374:477–490. doi:10.1016/S01406736(09)60617-6 20. Kamangar F, Dores GM, Anderson WF (2006) Patterns of cancer incidence, mortality, and prevalence across five continents: defining priorities to reduce cancer disparities in different geographic regions of the world. J Clin Oncol 24:2137–2150. doi:10. 1200/JCO.2005.05.2308 21. Hohenberger P, Gretschel S (2003) Gastric cancer. Lancet 362:305–315 22. Ottini L, Falchetti M, Lupi R, Rizzolo P, Agnese V, Colucci G, Bazan V, Russo A (2006) Patterns of genomic instability in gastric cancer: clinical implications and perspectives. Ann Oncol 17(Suppl 7):vii97–102. doi:10.1093/annonc/mdl960 23. Suzuki K, Suzuki I, Leodolter A, Alonso S, Horiuchi S, Yamashita K, Perucho M (2006) Global DNA demethylation in
123
Mol Cell Biochem (2014) 391:167–174
24.
25.
26.
27.
28.
gastrointestinal cancer is age dependent and precedes genomic damage. Cancer Cell 9:199–207. doi:10.1016/j.ccr.2006.02.016 Guilford PJ, Hopkins JB, Grady WM, Markowitz SD, Willis J, Lynch H, Rajput A, Wiesner GL, Lindor NM, Burgart LJ, Toro TT, Lee D, Limacher JM, Shaw DW, Findlay MP, Reeve AE (1999) E-cadherin germline mutations define an inherited cancer syndrome dominated by diffuse gastric cancer. Hum Mutat 14:249–255. doi:10.1002/(SICI)1098-1004(1999)14:3\249:AIDHUMU8[3.0.CO;2-9 Nezi L, Musacchio A (2009) Sister chromatid tension and the spindle assembly checkpoint. Curr Opin Cell Biol 21:785–795. doi:10.1016/j.ceb.2009.09.007 Santaguida S, Vernieri C, Villa F, Ciliberto A, Musacchio A (2011) Evidence that Aurora B is implicated in spindle checkpoint signalling independently of error correction. EMBO J 30:1508–1519. doi:10.1038/emboj.2011.70 Cheeseman IM, Chappie JS, Wilson-Kubalek EM, Desai A (2006) The conserved KMN network constitutes the core microtubule-binding site of the kinetochore. Cell 127:983–997. doi:10.1016/j.cell.2006.09.039 Santaguida S, Musacchio A (2009) The life and miracles of kinetochores. EMBO J 28:2511–2531. doi:10.1038/emboj.2009. 173
