Human Pathology (2014) xx, xxx–xxx
www.elsevier.com/locate/humpath
Case study
Squamous cell carcinoma arising in dedifferentiated chondrosarcoma proved by isocitrate dehydrogenase mutation analysis☆ Yaxia Zhang MD, PhD a,⁎, Ana Paz Mejia MS b , H. Thomas Temple MD c , Jonathan Trent MD b,d , Andrew E. Rosenberg MD e a
Anatomic Pathology, Cleveland Clinic, Cleveland, OH 44195 Sylvester Comprehensive Cancer Center, University of Miami, Miami, FL 33136 c Department of Orthopedic Surgery, University of Miami, Miami, FL 33136 d Department of Hematology and Oncology, University of Miami, Miami, FL 33136 e Department of Pathology, University of Miami, FL 33136 b
Received 4 October 2013; revised 26 November 2013; accepted 10 February 2014
Keywords: Chondrosarcoma; Dedifferentiation; IDH; Squamous cell carcinoma
Summary Dedifferentiated chondrosarcoma is a primary bone tumor characterized by the presence of both low-grade cartilaginous and high-grade malignant noncartilaginous components. The high-grade noncartilaginous component is typically a pleomorphic fibroblastic spindle cell sarcoma. Dedifferentiation into a malignant epithelial component is extremely rare. In this report, we present a 74-year-old woman who developed a metastatic squamous cell carcinoma in the right inguinal area 1 year after wide resection of her right proximal femur for a dedifferentiated chondrosarcoma. The dedifferentiated component was composed of poorly differentiated epithelioid cells with foci of squamous cell carcinoma. Mutational analysis was performed, and the isocitrate dehydrogenase 1 R132C mutation was detected in the low-grade chondrosarcoma, dedifferentiated chondrosarcoma as well as the metastatic squamous cell carcinoma. And this mutation was not detected in patient’s normal tissue. Our study supports the theory that both the chondrosarcoma cells and dedifferentiated epithelioid tumor cells arose from the same clonal origin. © 2014 Elsevier Inc. All rights reserved.
1. Introduction Dedifferentiated chondrosarcoma is a distinct variant of chondrosarcoma and accounts for 10% of all chondrosarcomas. It is the most aggressive type of chondrosarcoma and has a poor prognosis [1]. By definition, it is composed ☆ Disclosures: The authors declare no conflict of interest. ⁎ Corresponding author. Anatomic Pathology, Cleveland Clinic, 9500 Euclid Ave/L25, Cleveland, OH 44195. E-mail address: [email protected] (Y. Zhang).
http://dx.doi.org/10.1016/j.humpath.2014.02.016 0046-8177/© 2014 Elsevier Inc. All rights reserved.
of a low-grade cartilaginous neoplasm with an abrupt transition to a high-grade noncartilaginous component, which is almost always mesenchymal in differentiation [2]. The dedifferentiated component usually demonstrates the features of a high-grade pleomorphic fibroblastic sarcoma or osteosarcoma and infrequently rhabdomyosarcoma, leiomyosarcoma, or angiosarcoma. Steps in the molecular pathogenesis of dedifferentiated chondrosarcoma have recently been elucidated, and an important driver is believed to be a mutation of the metabolic enzyme isocitrate dehydrogenase (IDH) genes (IDH1 and IDH2),
2 which has been identified in 56% of dedifferentiated chondrosarcomas [3]. Dedifferentiation of chondrosarcoma into an epithelial component is extraordinarily rare. To date, only 2 cases of primary chondrosarcoma with a distinct squamous cell carcinoma component have been described in the literature [4,5]. Herein, we describe the clinicopathological features of an unusual case in which a dedifferentiated chondrosarcoma with a component of squamous cell carcinoma subsequently metastasized as squamous cell carcinoma. To further determine the relationship between the squamous cell carcinoma and the dedifferentiated chondrosarcoma, mutational analysis was performed on the IDH1 and IDH2 genes from different components of the tumor and the metastasis.
2. Case report 2.1. Clinical features A 73-year-old Hispanic woman presented with a severalweek history of progressive pain in her right femur and inability to walk. A radiograph of the right hip showed a radiolucent lesion with stippled calcifications that produced deep endosteal scalloping in the medial proximal femur. The margins of the tumor were poorly defined, and there was no evidence of a fracture. Magnetic resonance imaging revealed a 20-cm long intramedullary tumor that had low signal intensity on T1-weighted images and high signal intensity on T2-weighted images, which extended from just below the lesser trochanter into the diaphysis (Fig. 1A). The patient underwent complete resection of the right proximal femur
Fig. 1 A, T1-weighted magnetic resonance imaging image shows a 20-cm long intramedullary tumor that extends from just below the lesser trochanter to the middiaphysis. B, Resected proximal femur shows the cartilaginous neoplasm in the medullary cavity with one distinct eccentric red nodule, which represents the dedifferentiated component (arrow).
Y. Zhang et al. with negative margins. The diagnosis of dedifferentiated chondrosarcoma was rendered. The patient did not receive any adjuvant treatment and remained disease-free until 1 year later when she developed pain in the right inguinal area that radiated to the right thigh. A computer-aided tomographic scan revealed a right inguinal mass and right pelvic lymphadenopathy. An incisional biopsy revealed metastatic squamous cell carcinoma in the inguinal lymph nodes. The patient then received 3 cycles of chemotherapy including carboplatin and docetaxel, and her course was complicated by chest pain, diarrhea and renal failure. Positron emission tomographic scan did not demonstrate any noticeable regression of the tumor. Subsequently, the patient had a right femoral and external iliac lymphadenectomy that revealed metastatic squamous cell carcinoma in 2 of 8 superficial femoral lymph nodes and 1 of 2 external iliac lymph nodes. The patient was under rehabilitation and recovery from surgery during the last follow-up 4 months after resection of her metastatic squamous cell carcinoma.
2.2. Pathologic features Coronal section of the proximal femur revealed an intramedullary 20-cm long, white-to-bluish gray, glistening lobulated cartilaginous tumor. In the proximal medial portion of the tumor, eroding into but not through the outer surface of the cortex was a 0.8-cm ill-defined distinct hemorrhagic tan component (Fig. 1B, arrow). There was no soft tissue extension. Microscopically, the cartilaginous component consisted of lobules of neoplastic hyaline cartilage that replaced the marrow and grew with an infiltrative pattern encasing preexisting bony trabeculae (Fig. 2A). The cartilage showed moderate hypercellularity, and the chondrocytes demonstrated mild cytologic atypia manifested by nuclear enlargement and hyperchromasia. The distinct tan nodule consisted of sheets of polyhedral cells with well-defined cell borders, moderate amounts of eosinophilic cytoplasm and large vesicular nuclei with prominent nucleoli, and scattered osteoclast type giant cells (Fig. 2B). In one focus, the tumor cells demonstrated the morphologic features of squamous differentiation and grew in small nests, contained intensely eosinophilic keratinized cytoplasm, and were surrounded by desmoplastic stroma (Fig. 2C). Immunohistochemistry showed that the nonkeratinized epithelioid cells focally expressed pancytokeratin (Fig. 2D), whereas the keratinized cells were intensely positive (Fig. 2E). The open biopsy from the inguinal mass and enlarged lymph nodes that developed 1 year later revealed metastatic keratinizing squamous cell carcinoma that was identical in appearance to that present in the dedifferentiated component of the chondrosarcoma (Fig. 2F).
2.3. IDH mutation analysis DNA samples were extracted from formalin-fixed, paraffin-embedded, and decalcified (specimens from bone)
Carcinoma in dedifferentiated chondrosarcoma
3
Fig. 2 A, The low-grade chondrosarcoma permeated the marrow space and encased preexisting bony trabeculae. The chondrocytes are atypical varying in size and shape and contain enlarged hyperchromatic nuclei. B, The dedifferentiated component is composed of sheets of polyhedral cells with distinct cell borders, eosinophilic cytoplasm, and hyperchromatic nuclei. C, Foci of squamous cell carcinoma present in the dedifferentiated component. D and E, Immunohistochemistry shows that the nonkeratinized epithelioid cells focally express pancytokeratin (D), whereas the squamous cell carcinoma is intensely positive. F, The open biopsy of the inguinal mass reveals metastatic keratinizing squamous cell carcinoma.
tissues from the patient (normal skeletal muscle, low-grade chondrosarcoma, dedifferentiated chondrosarcoma, and inguinal metastatic squamous cell carcinoma) using Qiagen DNA purification kit according to the manufacturer’s instructions. Mutation analysis was performed for IDH1 and IDH2 using polymerase chain reaction (PCR) amplification and direct sequencing of DNA as described [6]. A fragment of 129 base pair (Fig. 3A) length spanning the IDH1 codon 132 was amplified using the sense primer IDH1F CGGTCTTCAGAGAAGCCATT and the antisense primer IDH1R CAAAATCACAT TATTGCCAAC. PCR, using standard buffer conditions, 20 ng of DNA, and Taq DNA Polymerase (Bio21042; Bioline), used 35 cycles with denaturing at 95°C for 30 seconds, annealing at 56°C for 40 seconds, and extension at 72°C for 50 seconds in a total volume of 25 μL. For confirmation, the sense primer IDH1fc
ACCAAATGGCACCATACGA and antisense primer IDH1rc TTCATACCTTGCTTAATGGGTGT generating a 254 base pair fragment at the same PCR conditions were used for IDH1. A fragment of 199 base pair (Fig. 3B) length spanning the sequence encoding the catalytic domain of IDH2 including codon 172 was amplified using 60 ng each of the sense primer IDH2F 5′-CCA ATGGAACTATCCGGAAC-3′ and the antisense primer IDH2R 5′-GATGGCTAGGCGAGGAGC-3′. PCR products were purified using QIAquick PCR purification Kit (Qiagen, Germany) according to the manufacturer’s instructions. Purified products were sequenced by capillary Sanger sequencing, and the resulting sequences were analyzed using Finch TV software program. Mutational analysis revealed that a hotspot mutation in the IDH1 gene resulted in a CNT substitution (R132C) in the patient’s low-grade chondrosarcoma, dedifferentiated
4
Y. Zhang et al.
Fig. 3 A, IDH1 PCR amplification from paraffin-embedded tissues. B, IDH2 PCR amplification from paraffin-embedded tissues. C, Using Sanger sequencing, IDH1 R132C mutation (CNT) was detected in the low-grade chondrosarcoma, dedifferentiated chondrosarcoma, and metastatic squamous cell carcinoma (arrows) but not in the patient’s normal skeletal muscle tissue. D, IDH2 hotspot mutation was not detected in any of the samples.
chondrosarcoma as well as the metastatic squamous cell carcinoma, whereas it was not detected in the patient’s skeletal muscle tissue (Fig. 3C). The hotspot R172 in the IDH2 gene was not mutated in any of the samples (Fig. 3D).
3. Discussion Dedifferentiated chondrosarcoma was first described by Dahlin and Beabout [2] in 1971. The dedifferentiated components in this type of tumor are almost always highgrade sarcomas that may show a variety of lines of differentiation, most commonly fibrosarcoma, followed by osteosarcoma, and rarely, leiomyosarcoma, angiosarcoma, and rhabdomyosarcoma. Epithelioid differentiation is extremely rare, and to date, only 3 cases have been reported in the literature, 2 of which showed squamous cell carcinoma. The first case occurred in the proximal humerus of a 68-year-old woman with a low-grade chondrosarcoma that harbored a
distinct epithelioid component [4]. The low-grade chondrosarcoma was composed of stellate tumor cells in a chondroid and partially myxoid matrix. The epithelioid component represented more than 50% of the entire tumor, and the tumor cells varied in shape from polygonal to elongate with eosinophilic cytoplasm, vesicular nuclei, and prominent nucleoli. Scattered foci in which the tumor cells exhibited intercellular bridges and cytoplasmic keratinization with pearl formation were present. Electron microscopy revealed that the epithelioid cells were surrounded by basement membrane material, and the cells contained tonofilaments and desmosomes. The epithelial and cartilaginous components were intermingled with one another, and the epithelial tumor cells were positive for cytokeratin. The patient died 3-and-a-half years after the onset of symptoms and tumor resection without evidence of recurrence or metastasis. The second case was that of a 53-year-old man with a dedifferentiated chondrosarcoma of the femur that was composed of low-grade hyaline chondrosarcoma associated with an undifferentiated spindle sarcoma and foci of squamous carcinoma with keratin pearl formation [5]. The patient died 6 months after resection, and at
Carcinoma in dedifferentiated chondrosarcoma autopsy, multiple metastases containing both chondrosarcoma and squamous cell carcinoma components were present in the heart, lungs, muscles, and lymph nodes. Immunohistochemistry showed that the squamous cell carcinoma was positive for pancytokeratin, high-molecular-weight keratin, and epithelial membrane antigen, and the spindle cell component adjacent to the squamous cell carcinoma was focally and weakly positive for epithelial markers as well as desmin, smooth muscle actin, and S-100 protein. The third case arose in a 26-year-old woman with a 19-cm pelvic dedifferentiated chondrosarcoma, in which the spindle cell population of a fibrosarcoma-like area was intensely positive for both AE1/AE3 and CAM5.2 [7]. It is unknown whether the cytokeratin reactivity represented true epithelial differentiation or a fibroblastic sarcoma expressing keratin, a well-recognized phenomenon [8]. There was no follow-up reported on this patient. The pathogenesis of dedifferentiated chondrosarcoma is slowly becoming understood. It has been hypothesized that the high-grade noncartilaginous component arises in a longstanding low-grade cartilaginous element and that both originate from the same primitive cell clone. Supporting this are the results of Bridge et al [9], who reported the same clonal karyotypic abnormalities in both low-grade and dedifferentiated components in their analysis of 4 cases of dedifferentiated chondrosarcoma with rhabdomyosarcomatous components using combined immunocytochemical and cytogenetic techniques. In addition, it has been shown recently that 56.5% of dedifferentiated chondrosarcomas harbor heterozygous mutations in the metabolic enzymes IDH1 and IDH2 [3]. In our case, the fact that the metastatic squamous cell carcinoma harbored precisely the same R132C hotspot mutation in the IDH1 gene as in both the low-grade chondrosarcoma and dedifferentiated components supports the clonal origin of the different components of the dedifferentiated chondrosarcoma. Furthermore, our findings suggest that a common primitive mesenchymal tumor cell progenitor may have the ability to differentiate or express features of a line of an epithelial differentiation. This socalled mesenchymal-to-epithelial transition during sarcomagenesis is observed less frequently and is less well understood, comparing with the reciprocal process of epithelial-mesenchymal transition during carcinogenesis [10]. Mesenchymal-to-epithelial transition is a fundamental developmental process that is important in the embryogenesis of vascular, urinary, and genital tissues [11]. The in vitro studies have suggested that chondrosarcoma cells possess the ability to transition from a mesenchymal to an epithelial-like phenotype. However, the molecular foundation of this process remains to be identified [12,13]. A variety of molecular alterations are believed to be important in the molecular genesis of squamous cell carcinoma, including TP53 mutations, CCND1 amplifica-
5 tion, CDKN2A/B deletions, PIK3CA mutations, and many others [14]. To date, IDH hotspot mutations have not been reported in primary squamous cell carcinoma; therefore, our case also suggests the existence of a different unique pathway of tumorigenesis for this rare example of squamous cell carcinoma [15].
References [1] Bruns J, Fiedler W, Werner M, Delling G. Dedifferentiated chondrosarcoma—a fatal disease. J Cancer Res Clin Oncol 2005; 131:333-9. [2] Dahlin DC, Beabout JW. Dedifferentiation of low-grade chondrosarcomas. Cancer 1971;28:461-6. [3] Amary MF, Bacsi K, Maggiani F, et al. IDH1 and IDH2 mutations are frequent events in central chondrosarcoma and central and periosteal chondromas but not in other mesenchymal tumours. J Pathol 2011; 224:334-43. [4] Ling LL, Steiner GC. Primary multipotential malignant neoplasm of bone: chondrosarcoma associated with squamous cell carcinoma. HUM PATHOL 1986;17:317-20. [5] Shiraishi J, Mukai M, Yabe H, et al. Primary bone carcinosarcoma: chondrosarcoma and squamous cell carcinoma with keratin pearl formation. Pathol Int 2005;55:504-9. [6] Hartmann C, Meyer J, Balss J, et al. Type and frequency of IDH1 and IDH2 mutations are related to astrocytic and oligodendroglial differentiation and age: a study of 1,010 diffuse gliomas. Acta Neuropathol 2009;118:469-74. [7] Dervan PA, O'Loughlin J, Hurson BJ. Dedifferentiated chondrosarcoma with muscle and cytokeratin differentiation in the anaplastic component. Histopathology 1988;12:517-26. [8] Romeo S, Bovee JV, Kroon HM, et al. Malignant fibrous histiocytoma and fibrosarcoma of bone: a re-assessment in the light of currently employed morphological, immunohistochemical and molecular approaches. Virchows Arch 2012;461:561-70. [9] Bridge JA, DeBoer J, Travis J, et al. Simultaneous interphase cytogenetic analysis and fluorescence immunophenotyping of dedifferentiated chondrosarcoma. Implications for histopathogenesis. Am J Pathol 1994;144:215-20. [10] Yang J, Eddy JA, Pan Y, et al. Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug. Mol Cell Proteomics 2010;9:2405-13. [11] Chaffer CL, Thompson EW, Williams ED. Mesenchymal to epithelial transition in development and disease. Cells Tissues Organs 2007;185: 7-19. [12] Ouyang P. An in vitro model to study mesenchymal-epithelial transformation. Biochem Biophys Res Commun 1998;246:771-6. [13] Fitzgerald MP, Gourronc F, Teoh ML, et al. Human chondrosarcoma cells acquire an epithelial-like gene expression pattern via an epigenetic switch: evidence for mesenchymal-epithelial transition during sarcomagenesis. Sarcoma 2011;2011:598218. [14] Lechner M, Frampton G, Fenton T, et al. Targeted next-generation sequencing of head and neck squamous cell carcinoma identifies novel genetic alterations in HPV+ and HPV− tumors. Genome Med 2013;5: 49. [15] Tang JY, Chang CC, Lin PC, Chang JG. Isocitrate dehydrogenase mutation hot spots in acute lymphoblastic leukemia and oral cancer. Kaohsiung J Med Sci 2012;28:138-44.
www.elsevier.com/locate/humpath
Case study
Squamous cell carcinoma arising in dedifferentiated chondrosarcoma proved by isocitrate dehydrogenase mutation analysis☆ Yaxia Zhang MD, PhD a,⁎, Ana Paz Mejia MS b , H. Thomas Temple MD c , Jonathan Trent MD b,d , Andrew E. Rosenberg MD e a
Anatomic Pathology, Cleveland Clinic, Cleveland, OH 44195 Sylvester Comprehensive Cancer Center, University of Miami, Miami, FL 33136 c Department of Orthopedic Surgery, University of Miami, Miami, FL 33136 d Department of Hematology and Oncology, University of Miami, Miami, FL 33136 e Department of Pathology, University of Miami, FL 33136 b
Received 4 October 2013; revised 26 November 2013; accepted 10 February 2014
Keywords: Chondrosarcoma; Dedifferentiation; IDH; Squamous cell carcinoma
Summary Dedifferentiated chondrosarcoma is a primary bone tumor characterized by the presence of both low-grade cartilaginous and high-grade malignant noncartilaginous components. The high-grade noncartilaginous component is typically a pleomorphic fibroblastic spindle cell sarcoma. Dedifferentiation into a malignant epithelial component is extremely rare. In this report, we present a 74-year-old woman who developed a metastatic squamous cell carcinoma in the right inguinal area 1 year after wide resection of her right proximal femur for a dedifferentiated chondrosarcoma. The dedifferentiated component was composed of poorly differentiated epithelioid cells with foci of squamous cell carcinoma. Mutational analysis was performed, and the isocitrate dehydrogenase 1 R132C mutation was detected in the low-grade chondrosarcoma, dedifferentiated chondrosarcoma as well as the metastatic squamous cell carcinoma. And this mutation was not detected in patient’s normal tissue. Our study supports the theory that both the chondrosarcoma cells and dedifferentiated epithelioid tumor cells arose from the same clonal origin. © 2014 Elsevier Inc. All rights reserved.
1. Introduction Dedifferentiated chondrosarcoma is a distinct variant of chondrosarcoma and accounts for 10% of all chondrosarcomas. It is the most aggressive type of chondrosarcoma and has a poor prognosis [1]. By definition, it is composed ☆ Disclosures: The authors declare no conflict of interest. ⁎ Corresponding author. Anatomic Pathology, Cleveland Clinic, 9500 Euclid Ave/L25, Cleveland, OH 44195. E-mail address: [email protected] (Y. Zhang).
http://dx.doi.org/10.1016/j.humpath.2014.02.016 0046-8177/© 2014 Elsevier Inc. All rights reserved.
of a low-grade cartilaginous neoplasm with an abrupt transition to a high-grade noncartilaginous component, which is almost always mesenchymal in differentiation [2]. The dedifferentiated component usually demonstrates the features of a high-grade pleomorphic fibroblastic sarcoma or osteosarcoma and infrequently rhabdomyosarcoma, leiomyosarcoma, or angiosarcoma. Steps in the molecular pathogenesis of dedifferentiated chondrosarcoma have recently been elucidated, and an important driver is believed to be a mutation of the metabolic enzyme isocitrate dehydrogenase (IDH) genes (IDH1 and IDH2),
2 which has been identified in 56% of dedifferentiated chondrosarcomas [3]. Dedifferentiation of chondrosarcoma into an epithelial component is extraordinarily rare. To date, only 2 cases of primary chondrosarcoma with a distinct squamous cell carcinoma component have been described in the literature [4,5]. Herein, we describe the clinicopathological features of an unusual case in which a dedifferentiated chondrosarcoma with a component of squamous cell carcinoma subsequently metastasized as squamous cell carcinoma. To further determine the relationship between the squamous cell carcinoma and the dedifferentiated chondrosarcoma, mutational analysis was performed on the IDH1 and IDH2 genes from different components of the tumor and the metastasis.
2. Case report 2.1. Clinical features A 73-year-old Hispanic woman presented with a severalweek history of progressive pain in her right femur and inability to walk. A radiograph of the right hip showed a radiolucent lesion with stippled calcifications that produced deep endosteal scalloping in the medial proximal femur. The margins of the tumor were poorly defined, and there was no evidence of a fracture. Magnetic resonance imaging revealed a 20-cm long intramedullary tumor that had low signal intensity on T1-weighted images and high signal intensity on T2-weighted images, which extended from just below the lesser trochanter into the diaphysis (Fig. 1A). The patient underwent complete resection of the right proximal femur
Fig. 1 A, T1-weighted magnetic resonance imaging image shows a 20-cm long intramedullary tumor that extends from just below the lesser trochanter to the middiaphysis. B, Resected proximal femur shows the cartilaginous neoplasm in the medullary cavity with one distinct eccentric red nodule, which represents the dedifferentiated component (arrow).
Y. Zhang et al. with negative margins. The diagnosis of dedifferentiated chondrosarcoma was rendered. The patient did not receive any adjuvant treatment and remained disease-free until 1 year later when she developed pain in the right inguinal area that radiated to the right thigh. A computer-aided tomographic scan revealed a right inguinal mass and right pelvic lymphadenopathy. An incisional biopsy revealed metastatic squamous cell carcinoma in the inguinal lymph nodes. The patient then received 3 cycles of chemotherapy including carboplatin and docetaxel, and her course was complicated by chest pain, diarrhea and renal failure. Positron emission tomographic scan did not demonstrate any noticeable regression of the tumor. Subsequently, the patient had a right femoral and external iliac lymphadenectomy that revealed metastatic squamous cell carcinoma in 2 of 8 superficial femoral lymph nodes and 1 of 2 external iliac lymph nodes. The patient was under rehabilitation and recovery from surgery during the last follow-up 4 months after resection of her metastatic squamous cell carcinoma.
2.2. Pathologic features Coronal section of the proximal femur revealed an intramedullary 20-cm long, white-to-bluish gray, glistening lobulated cartilaginous tumor. In the proximal medial portion of the tumor, eroding into but not through the outer surface of the cortex was a 0.8-cm ill-defined distinct hemorrhagic tan component (Fig. 1B, arrow). There was no soft tissue extension. Microscopically, the cartilaginous component consisted of lobules of neoplastic hyaline cartilage that replaced the marrow and grew with an infiltrative pattern encasing preexisting bony trabeculae (Fig. 2A). The cartilage showed moderate hypercellularity, and the chondrocytes demonstrated mild cytologic atypia manifested by nuclear enlargement and hyperchromasia. The distinct tan nodule consisted of sheets of polyhedral cells with well-defined cell borders, moderate amounts of eosinophilic cytoplasm and large vesicular nuclei with prominent nucleoli, and scattered osteoclast type giant cells (Fig. 2B). In one focus, the tumor cells demonstrated the morphologic features of squamous differentiation and grew in small nests, contained intensely eosinophilic keratinized cytoplasm, and were surrounded by desmoplastic stroma (Fig. 2C). Immunohistochemistry showed that the nonkeratinized epithelioid cells focally expressed pancytokeratin (Fig. 2D), whereas the keratinized cells were intensely positive (Fig. 2E). The open biopsy from the inguinal mass and enlarged lymph nodes that developed 1 year later revealed metastatic keratinizing squamous cell carcinoma that was identical in appearance to that present in the dedifferentiated component of the chondrosarcoma (Fig. 2F).
2.3. IDH mutation analysis DNA samples were extracted from formalin-fixed, paraffin-embedded, and decalcified (specimens from bone)
Carcinoma in dedifferentiated chondrosarcoma
3
Fig. 2 A, The low-grade chondrosarcoma permeated the marrow space and encased preexisting bony trabeculae. The chondrocytes are atypical varying in size and shape and contain enlarged hyperchromatic nuclei. B, The dedifferentiated component is composed of sheets of polyhedral cells with distinct cell borders, eosinophilic cytoplasm, and hyperchromatic nuclei. C, Foci of squamous cell carcinoma present in the dedifferentiated component. D and E, Immunohistochemistry shows that the nonkeratinized epithelioid cells focally express pancytokeratin (D), whereas the squamous cell carcinoma is intensely positive. F, The open biopsy of the inguinal mass reveals metastatic keratinizing squamous cell carcinoma.
tissues from the patient (normal skeletal muscle, low-grade chondrosarcoma, dedifferentiated chondrosarcoma, and inguinal metastatic squamous cell carcinoma) using Qiagen DNA purification kit according to the manufacturer’s instructions. Mutation analysis was performed for IDH1 and IDH2 using polymerase chain reaction (PCR) amplification and direct sequencing of DNA as described [6]. A fragment of 129 base pair (Fig. 3A) length spanning the IDH1 codon 132 was amplified using the sense primer IDH1F CGGTCTTCAGAGAAGCCATT and the antisense primer IDH1R CAAAATCACAT TATTGCCAAC. PCR, using standard buffer conditions, 20 ng of DNA, and Taq DNA Polymerase (Bio21042; Bioline), used 35 cycles with denaturing at 95°C for 30 seconds, annealing at 56°C for 40 seconds, and extension at 72°C for 50 seconds in a total volume of 25 μL. For confirmation, the sense primer IDH1fc
ACCAAATGGCACCATACGA and antisense primer IDH1rc TTCATACCTTGCTTAATGGGTGT generating a 254 base pair fragment at the same PCR conditions were used for IDH1. A fragment of 199 base pair (Fig. 3B) length spanning the sequence encoding the catalytic domain of IDH2 including codon 172 was amplified using 60 ng each of the sense primer IDH2F 5′-CCA ATGGAACTATCCGGAAC-3′ and the antisense primer IDH2R 5′-GATGGCTAGGCGAGGAGC-3′. PCR products were purified using QIAquick PCR purification Kit (Qiagen, Germany) according to the manufacturer’s instructions. Purified products were sequenced by capillary Sanger sequencing, and the resulting sequences were analyzed using Finch TV software program. Mutational analysis revealed that a hotspot mutation in the IDH1 gene resulted in a CNT substitution (R132C) in the patient’s low-grade chondrosarcoma, dedifferentiated
4
Y. Zhang et al.
Fig. 3 A, IDH1 PCR amplification from paraffin-embedded tissues. B, IDH2 PCR amplification from paraffin-embedded tissues. C, Using Sanger sequencing, IDH1 R132C mutation (CNT) was detected in the low-grade chondrosarcoma, dedifferentiated chondrosarcoma, and metastatic squamous cell carcinoma (arrows) but not in the patient’s normal skeletal muscle tissue. D, IDH2 hotspot mutation was not detected in any of the samples.
chondrosarcoma as well as the metastatic squamous cell carcinoma, whereas it was not detected in the patient’s skeletal muscle tissue (Fig. 3C). The hotspot R172 in the IDH2 gene was not mutated in any of the samples (Fig. 3D).
3. Discussion Dedifferentiated chondrosarcoma was first described by Dahlin and Beabout [2] in 1971. The dedifferentiated components in this type of tumor are almost always highgrade sarcomas that may show a variety of lines of differentiation, most commonly fibrosarcoma, followed by osteosarcoma, and rarely, leiomyosarcoma, angiosarcoma, and rhabdomyosarcoma. Epithelioid differentiation is extremely rare, and to date, only 3 cases have been reported in the literature, 2 of which showed squamous cell carcinoma. The first case occurred in the proximal humerus of a 68-year-old woman with a low-grade chondrosarcoma that harbored a
distinct epithelioid component [4]. The low-grade chondrosarcoma was composed of stellate tumor cells in a chondroid and partially myxoid matrix. The epithelioid component represented more than 50% of the entire tumor, and the tumor cells varied in shape from polygonal to elongate with eosinophilic cytoplasm, vesicular nuclei, and prominent nucleoli. Scattered foci in which the tumor cells exhibited intercellular bridges and cytoplasmic keratinization with pearl formation were present. Electron microscopy revealed that the epithelioid cells were surrounded by basement membrane material, and the cells contained tonofilaments and desmosomes. The epithelial and cartilaginous components were intermingled with one another, and the epithelial tumor cells were positive for cytokeratin. The patient died 3-and-a-half years after the onset of symptoms and tumor resection without evidence of recurrence or metastasis. The second case was that of a 53-year-old man with a dedifferentiated chondrosarcoma of the femur that was composed of low-grade hyaline chondrosarcoma associated with an undifferentiated spindle sarcoma and foci of squamous carcinoma with keratin pearl formation [5]. The patient died 6 months after resection, and at
Carcinoma in dedifferentiated chondrosarcoma autopsy, multiple metastases containing both chondrosarcoma and squamous cell carcinoma components were present in the heart, lungs, muscles, and lymph nodes. Immunohistochemistry showed that the squamous cell carcinoma was positive for pancytokeratin, high-molecular-weight keratin, and epithelial membrane antigen, and the spindle cell component adjacent to the squamous cell carcinoma was focally and weakly positive for epithelial markers as well as desmin, smooth muscle actin, and S-100 protein. The third case arose in a 26-year-old woman with a 19-cm pelvic dedifferentiated chondrosarcoma, in which the spindle cell population of a fibrosarcoma-like area was intensely positive for both AE1/AE3 and CAM5.2 [7]. It is unknown whether the cytokeratin reactivity represented true epithelial differentiation or a fibroblastic sarcoma expressing keratin, a well-recognized phenomenon [8]. There was no follow-up reported on this patient. The pathogenesis of dedifferentiated chondrosarcoma is slowly becoming understood. It has been hypothesized that the high-grade noncartilaginous component arises in a longstanding low-grade cartilaginous element and that both originate from the same primitive cell clone. Supporting this are the results of Bridge et al [9], who reported the same clonal karyotypic abnormalities in both low-grade and dedifferentiated components in their analysis of 4 cases of dedifferentiated chondrosarcoma with rhabdomyosarcomatous components using combined immunocytochemical and cytogenetic techniques. In addition, it has been shown recently that 56.5% of dedifferentiated chondrosarcomas harbor heterozygous mutations in the metabolic enzymes IDH1 and IDH2 [3]. In our case, the fact that the metastatic squamous cell carcinoma harbored precisely the same R132C hotspot mutation in the IDH1 gene as in both the low-grade chondrosarcoma and dedifferentiated components supports the clonal origin of the different components of the dedifferentiated chondrosarcoma. Furthermore, our findings suggest that a common primitive mesenchymal tumor cell progenitor may have the ability to differentiate or express features of a line of an epithelial differentiation. This socalled mesenchymal-to-epithelial transition during sarcomagenesis is observed less frequently and is less well understood, comparing with the reciprocal process of epithelial-mesenchymal transition during carcinogenesis [10]. Mesenchymal-to-epithelial transition is a fundamental developmental process that is important in the embryogenesis of vascular, urinary, and genital tissues [11]. The in vitro studies have suggested that chondrosarcoma cells possess the ability to transition from a mesenchymal to an epithelial-like phenotype. However, the molecular foundation of this process remains to be identified [12,13]. A variety of molecular alterations are believed to be important in the molecular genesis of squamous cell carcinoma, including TP53 mutations, CCND1 amplifica-
5 tion, CDKN2A/B deletions, PIK3CA mutations, and many others [14]. To date, IDH hotspot mutations have not been reported in primary squamous cell carcinoma; therefore, our case also suggests the existence of a different unique pathway of tumorigenesis for this rare example of squamous cell carcinoma [15].
References [1] Bruns J, Fiedler W, Werner M, Delling G. Dedifferentiated chondrosarcoma—a fatal disease. J Cancer Res Clin Oncol 2005; 131:333-9. [2] Dahlin DC, Beabout JW. Dedifferentiation of low-grade chondrosarcomas. Cancer 1971;28:461-6. [3] Amary MF, Bacsi K, Maggiani F, et al. IDH1 and IDH2 mutations are frequent events in central chondrosarcoma and central and periosteal chondromas but not in other mesenchymal tumours. J Pathol 2011; 224:334-43. [4] Ling LL, Steiner GC. Primary multipotential malignant neoplasm of bone: chondrosarcoma associated with squamous cell carcinoma. HUM PATHOL 1986;17:317-20. [5] Shiraishi J, Mukai M, Yabe H, et al. Primary bone carcinosarcoma: chondrosarcoma and squamous cell carcinoma with keratin pearl formation. Pathol Int 2005;55:504-9. [6] Hartmann C, Meyer J, Balss J, et al. Type and frequency of IDH1 and IDH2 mutations are related to astrocytic and oligodendroglial differentiation and age: a study of 1,010 diffuse gliomas. Acta Neuropathol 2009;118:469-74. [7] Dervan PA, O'Loughlin J, Hurson BJ. Dedifferentiated chondrosarcoma with muscle and cytokeratin differentiation in the anaplastic component. Histopathology 1988;12:517-26. [8] Romeo S, Bovee JV, Kroon HM, et al. Malignant fibrous histiocytoma and fibrosarcoma of bone: a re-assessment in the light of currently employed morphological, immunohistochemical and molecular approaches. Virchows Arch 2012;461:561-70. [9] Bridge JA, DeBoer J, Travis J, et al. Simultaneous interphase cytogenetic analysis and fluorescence immunophenotyping of dedifferentiated chondrosarcoma. Implications for histopathogenesis. Am J Pathol 1994;144:215-20. [10] Yang J, Eddy JA, Pan Y, et al. Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug. Mol Cell Proteomics 2010;9:2405-13. [11] Chaffer CL, Thompson EW, Williams ED. Mesenchymal to epithelial transition in development and disease. Cells Tissues Organs 2007;185: 7-19. [12] Ouyang P. An in vitro model to study mesenchymal-epithelial transformation. Biochem Biophys Res Commun 1998;246:771-6. [13] Fitzgerald MP, Gourronc F, Teoh ML, et al. Human chondrosarcoma cells acquire an epithelial-like gene expression pattern via an epigenetic switch: evidence for mesenchymal-epithelial transition during sarcomagenesis. Sarcoma 2011;2011:598218. [14] Lechner M, Frampton G, Fenton T, et al. Targeted next-generation sequencing of head and neck squamous cell carcinoma identifies novel genetic alterations in HPV+ and HPV− tumors. Genome Med 2013;5: 49. [15] Tang JY, Chang CC, Lin PC, Chang JG. Isocitrate dehydrogenase mutation hot spots in acute lymphoblastic leukemia and oral cancer. Kaohsiung J Med Sci 2012;28:138-44.
