Staphylococcal and streptococcal pyrogenic toxins involved in toxic shock syndrome and related illnesses.

Microbiology

Staphylococcal and Streptococcal Pyrogenic Toxins Involved in Toxic Shock Syndrome and Related Illnesses Gregory A. Bohach, David J. Fast, Robert D. Nelson, and Patrick M. Schlievert

Table 1 The Family of Pyrogenic Toxins Group A streptococcal pyrogenic exotoxin' types A, B, C Staphylococcal toxic shock syndrome toxin-] Staphylococcal pyrogenic exotoxin types A. B Staphylococcal enterotoxin types A, B. C,. C:. C,, D, E

'

Critical Reviews in Microbiology Downloaded from informahealthcare.com by RMIT University on 06/22/13 For personal use only.

ABSTRACT Toxic-shock syndrome (TSS) is an acute onset, multiorgan illness which resembles severe scarlet fever. The illness is caused by Staphylococcus awew strains that express TSS toxin1 (TSST-I), enterotoxin B , or enterotoxin C. TSST-1 is associated with menstrual TSS and approximately one-half of nonmenstrual cases; the other two toxins cause nonmenstrual cases, 47% and 3%, respectively. The three toxins are expressed in culture media under similar environmental conditions. These conditions may explain the association of certain tampons with menstrual TSS. Biochemically, the toxins are all relatively low molecular weight and fairly heat and protease stable. Enterotoxins B and C, share nearly 50% sequence homology with streptococcal scarlet fever toxin A; they share no homology with TSST- 1 despite sharing numerous biological properties. Numerous animal models for development of TSS have suggested mechanisms of toxin action, though the exact molecular action is not known. The toxins are all potent pyrogens, induce T lymphocyte proliferation, requiring interleukin 1 release from macrophages, suppress immunoglobulin production, enhance endotoxin shock, and enhance hypersensitivity skin reactions. The genetic control of the toxins has been studied and suggests the exotoxins are variable traits. Some additional properties of TSS S. aureus which facilitate disease causation have been clarified.

1. INTRODUCTION Staphylococcus aureus and group A streptococci express a variety of cell associated and secreted factors that may contribute to their abilities to cause disease. Among the secreted virulence factors ari a cross-species family of pyrogenic toxins which contribute to toxic-shock syndrome (TSS) and related illnesses. These pyrogenic toxins, including the streptococcal scarlet fever toxins serotypes A, B, and C (synonyms streptococcal pyrogenic exotoxins [SPEs], erythrogenic toxin, blastogen A [type A], lymphocyte mitogens. keratinocyte proliferative factor) and staphylococcal enterotoxins (SEs) serotypes A, B, C1, C2, C3, D, and E, pyrogenic exotoxins serotypes A and B, and toxic-shock syndrome toxin-1 (TSSTI ) , are grouped together as a family based upon their shared biochemical, biological, and serological activities, sequence homology, and involvement in related illnesses (Table 1). We refer to the family as pyrogenic toxins based upon their dis-

Synonyms: streptococcal exotoxins, scarlet fever toxins. erythrogenic toxin (type A). blastogen A (type A), keratinocytc proliferative factor, lymphocyte rmtogens.

tinctive fever production, which can easily be distinguished from other pyrogens based upon time of maximal response. Furthermore, each toxin has the capacity to predispose the host to lethal shock by endotoxin. In this review we discuss SPEs, SEs, and TSS toxin-1 (TSST-I) with respect to their association with TSS-like diseases and biochemical, genetic, and biological characterization. We present current evidence that suggests these toxins are, indeed, members of a larger family that are capable of causing TSS-like illnesses.

II. CLINICAL FEATURES OF TSS AND RELATED ILLNESSES Toxic shock syndrome is an acute onset multiorgan illness characterized by fever, hypotension or dizziness, scarlet feverlike rash, desquamation of the skin upon recovery, and a variable multiorgan component, often seen as vomiting and diarrhea, reddening of mucous membranes, and confusion or combativeness (Table 2).'-" Efforts should be made to rule out other causes, such as Kawasaki syndrome and Gram-negative shock. Sporadic cases of TSS have been described in the literature since 1927 where the cases were reported as staphylococcal scarlet fever or adult Kawasaki ~ y n d r o m e . ~ TSS ~'~-'~ was brought to the attention of the medical community as a major illness by Todd et al. in 1978' and was named TSS by those investigators. This group also first reported the association of TSS with S. aureus.

G . A. Bohach earned his B.S. at the University of Pittsburgh. Johnstown, Pennsylvania, his M.T. (A.S.C.P.) at Connemaugh Memorial Hospital, Johnstown, Pennsylvania, and both his M.S. and Ph.D. at West Virginia University, Morgantown. Presently Dr. Bohach is Postdoctoral Fellow, Department of Microbiology, University of Minnesota, Minneapolis. D.J. Fast is with the Department of Microbiology, University of Minnesota, Minneapolis. R. D. Nelson IS with the Depanment of Microbiology and Surgery, University of Minnesota, Minneapolis. P. M. Schlievert earned both his B.A. and Ph.D. at the University of Iowa, Iowa Ciry. Dr.Schlievert is Associate Professor in the Department of Microbiology. University of Minnesota. Minneapolis.

1990

251

Critical Reviews In Table 2 Clinical Features of Toxic Shock Syndrome’ I 2 3. 4.

5. a. b. C.

d. e.


f. g.

Table 3 Subsets of Staphylococcal Toxic Shock Syndrome

Fever, temperature 2 3 8 9°C Rash, diffuse macular erythrodema Desquamation, I to 2 weeks after onsetb Hypotension Involvement of three or more organ systems Gastrointestinal. usually vomiung, and diarrhea Muscular Mucous membrane, reddening Renal Hepatic Hematologic Central nervous system

Nore: Effons should be made to rule out other causes

I

2

of illness.

’ Probable toxic shock syndrome IS considered the same illness except one major cntenon is absent. Desquamatlon IS not necessary

in

cause the illnesses, largely based upon the observation that in many cases the causative organisms remain localized despite the presence of systemic manifestations.

fatal cases

Subsequent to the report of Todd et al., several others have reported clinical descriptions of TSS, and have focused on risk factors, most notably tampon use. Investigators at the Mayo Clinic,* Centers for Disease C ~ n t r o l , and ~ . ~in~ Wisconsin and Minnesota2.E.10.12.I3 (in addition to the Mayo Clinic study) reported large studies of TSS clinical features, noting as a risk factor, use of tampons during menstruation. After establishment of the strict case definition (Table 2) by the collaborative efforts of the Centers for Disease Control and several other scientists, it became clear that a number of TSS patients did not meet all of those criteria for illness. This led to the establishment of another category of illness, referred to as probable TSS,” in which one criterion was absent; individually, each criterion has been absent in some TSS patients. Although it has been known since 1927 that nonmenstrual TSS occurs, major reports of the appearance of such illness became more prevalent after 1982.” Nonmenstrual cases may originate from infection by S. aureus at nearly any body site; reports have been published which include post surgical, diaphragm and contraceptive sponge-associated, post-pmm, fluassociated, and other body site case^.*^.'^ The major subsets of TSS are listed in Table 3. Most recently, Cone and colleagues24and Stevens et al.224 reported streptococcal TSS in several patients. This illness, possibly a severe form of scarlet fever, is now recognized as associated with group A streptococcal infections of nearly any body site, including the vaginal mucosa (two such cases have been reported to this laboratory), although there has been no report of association with tampon use.

A. Factors Associated with TSS Today, nearly all investigators would agree that S. uureus and group A streptococci cause TSS or scarlet fever illnesses. Furthermore, it is generally regarded that a toxin or toxins

252

Menstrual a Vaginal - cervical colonization 1 Tampon associated 2 Not tampon associated b Other body site colonizauon or infection Nonmensuual a Flu-associated (uacheal colonization) b Postsurgical c Postpartum (vaginal-cervical colonization) Diaphragm or contraceptive sponge-associated (vaginal-cervical d colonizauon) e Other body site colonization or infection

1. Staphylococcus aureus TSS S. uureus were originally described as belonging to phage group 1.l These data were confirmed in later studies, although only approximately 60% of TSS isolates belonged to phage group I, with most of those isolates belonging to phage types 29, 52, or 29/52 (referred to as 29/52 c ~ m p l e x ) . ~A~ ~ * ’ majority of the rest of the TSS isolates were nontypable. Interestingly, phage group II isolates were not associated with TSS cases. Since 1960, a large study was conducted which analyzed 29/52 S. aureus isolates, not from TSS cases, for production of TSST-I .25.26.28 The results suggested that in 1972 the TSST1 positive, 29/52 complex strain emerged, peaked first in 1975 and then again in 1977, and fell off early in the 1980s. It was noted in that study that S. aureus strains regularly cycle in 10year intervals, consistent with the results obtained. The study also suggested that high absorbency tampons, most associated with TSS, did not cause the emergence since those tampons were introduced in 1976, clearly after the emergence. Finally, since TSST-I positive strains were present in the 1960s, the TSS strain was not new, but appeared to have emerged. Also, in agreement with these findings were data reported by Vergeront and colleague^^^^^^ in which sera from individuals, obtained in the 1960s, contained antibodies to TSST-I. Our experience recently is that TSS strains are more likely to be nontypable rather than belonging to the phage type 29/52 complex, consistent with the lack of decrease of TSS cases reported to this laboratory and consistent with a cycling of staphylococcal strains. Other factors associated with TSS isolates have also been described. Barbour)’ and other^^^.^^ have noted the lack of hemolysin production by a majority of TSS isolates. Schlievert et al.32also noted vaginal TSS strains make lower amounts of lipase and nuclease and proposed that these S. uureus reside mainly on mucosal surfaces or in surgical incision sites, be-

Volume 17, Issue 4


Microbiology cause they lack the factors necessary to cause boils or other types of skin infections. Todd et al.33 have also noted the lack of hemolysin production and. in addition, showed that TSS isolates express more protease than other S. aureus strains. Numerous studies have been done to associate toxins with development of TSS. in the initial study by Todd and colleagues,' an epidermal toxin was identified as associated with the strains. This toxin was discussed again in a later r e p ~ r t , ~ " but no recent data are available concerning its characteristics or role, if any, in TSS. It at least appears not to be necessary for TSS-like illnesses based upon studies involving isogenic TSST-1 positive and negative pairs of organisms (this is discussed in this review). In another study,35two sodium dodecyl sulfate-extractable proteins were obtained from a majority of TSS S. aureus but not from control isolates. No additional work has been done on these proteins, although their size suggest they may in fact be an enterotoxin, one the mature secreted form and the other the form containing the signal peptide. A likely candidate enterotoxin is type A toxin which is made by many TSS isolates. Schlievert and ass~ciates'~.~' have described two staphylococcal pyrogenic exotoxins, referred to as types A and B. Type A toxin is made by many TSS isolates, although the role, if any, of this toxin in TSS has not been clarified; type B toxin is not made by many TSS isolates. Today, most studies of causative toxins have focused on other members of the pyrogenic toxin family. These toxins, therefore, constitute the major part of this review.

2. Tampons The aspect of staphylococcal TSS that has received the most public attention is the association of the illness with menstruation, and most notably with high absorbency tampons. The association of TSS with tampon use was first reported in Wisconsin' and Minnesota,'* with others following soon thereafter. Early on, the Centers for Disease Control emphasized the major association with "Rely" brand tampons. In contrast, the Tri-State TSS38study showed that the association with TSS correlated with absorbency, regardless of brand, such that the higher the tampon absorbency, the greater the risk. More recent data by the Centers for Disease Controla confirmed the findings in the Tri-State TSS study, except to suggest that polyacrylate-containing tampons of a particular absorbency had less association than nonpolyacrylate tampons of slrmlar absorbency. The reason for the association of tampons with TSS is not completely understood, but has been investigated in many labo r a t o r i e ~ . " ~Schlievert "~ and BlomsteP' first evaluated the physical and chemical factors that affect TSST-1 production. It was shown that toxin was made in large amounts in complex media containing animal protein and only low levels of glucose. Typical of the regulation of many toxins, TSST-I was susceptible to catabolite repression by higher levels of glucose (higher than expected in the vagina). In other media, even low

1990

levels of glucose catabolite repress TSST-1 production (unpublished observation). Toxin was also made across a pH range of 6.5 to 8 , at temperatures of 37 to ?O"C, with more toxin made at 40°C than at 37°C. and under aerobic but not anaerobic conditions. Since TSST-1 is thought to be a necessary factor for development of TSS and the vagina is considered to be anaerobic, these investigators proposed that oxygen may be the factor contributed by tampons. In the beef heart medium used for their studies, CO, content did not affect toxin production, whereas in other media added CO, appears to enhance toxin expression. In a later study by Schlievert et al.,42it was noted that many polyacrylate as well as certain other tampons inhibited TSST- 1 production and in many instances growth of S. aureus; this was particularly noticeable with high absorbency tampons. These effects were shown to result from inhibitory surfactants in some of the products, and later, to result from magnesium binding by the t a m p ~ n s . In " ~that ~ ~ study,": ~ it was suggested that oxygen provided by certain tampons may explain their association with illness. Consistent with the hypothesis made by Schlievert and colleagues, Wagner et al." showed that tampons inserted into the vagina increased the p0,. In addition, other^^'.^^ have noted the requirement for oxygen to obtain TSST-I production, and notably, Todd and colleagues52 observed that staphylococcal abscesses, which were associated with TSS, were also aerobic in nature, rather than the expected anaerobic. Recently, Mills et al.4' have suggested that magnesium binding by tampons may contribute to TSS. In their study and that of Schlievert," it was shown that certain tampons may bind sufficient magnesium to inhibit bacterial growth and thus also toxin production. Mills et al.47noted that at magnesium concentrations of 2 to 5 pg/d toxin was expressed maximally and rapidly fell off at higher magnesium concentrations. In contrast, Schlievert4 showed that the same higher magnesium concentrations did not affect toxin production in this study. In a collaborative study, in attempt to resolve the apparent discrepancy, Kass and colleagues and Schlievert observed that the differences may reside in media used, assay sensitivity, and most importantly, position in the growth phase. TSST-1 is primarily expressed in late logarithmic to early stationary phase and is shut off at a point where S. uureux may still grow for approximately one more log. It was noted that regardless of magnesium concentration, toxin production as a function of stage of growth was constant. Thus, the effect of magnesium was to either delay (in reduced magnesium) or permit typical cell growth (higher magnesium) and thus affect toxin values obtained when only one sampling point was used. Other theories for the possible role of tampons in TSS have been put forward, but are contradicted by many other data. Other pyrogenic toxins have been studied with regard to factors that control their expression, although these toxins do not appear to be associated with menstrual, tampon associated

253

Critical Reviews In


TSS. All pyrogenic toxins appear to be made in high concentrations in complex media and under similar environmental conditions used to make TSST-1. It is important to note that streptococci, however, are aerotolerant anaerobes, and thus oxygen is not necessary to obtain optimal toxin production. Enterotoxin B has also been reported to exhibit catabolite repression by All of the toxins appear to be made primarily in late logarithmic phase, but the streptococcal toxins may be made throughout the growth cycle.54 3. Group A Streptococci Classically, group A streptococci, which make SPEs, are considered to be capable of causing scarlet fever or TSS-like illnesses. Two earlier review^^^.^^ discuss much of the early work on the toxins in detail and thus are not addressed in this review. Factors, other than SPEs, have not been described which are necessary for such illnesses.

Table 4 Production of TSST-1 by Strains of S. aureus Body site of culture

No. positivdtotal ( % positive)

Year

Total

1982 1983 1984 1985 1986 1987

Ill 84 71 63 68 82

TOTAL

479

Vagina-Cervix

71/76 37/42 36/38 21/25 24/26 37/39

(93%) (88%) (95%) (84%) (92%) (95%)

226/246 (92%)

Other 18/35 16/42 11/33 16138 27/42 23143

(51%) (38%) (33%) (42%) (64%)

(53%)

1 1 11233 (48%)

which is typical of several other TSST- 1 was the toxin most commonly elaborated by menstrual isolates. A small percentage of isolates coproduced TSST- 1 and SEC 1. B. Toxin Epidemiology and Nomenclature In contrast, less than half of nonmenstrual isolates produced 1. Staphylococcal Toxins TSST-I alone; 19% coproduced TSST-1 and SEC1. Of the The multisystem clinical picture of the illness in the abnonmenstrual isolates, 33% produced SEB or SECl alone, sence of disseminated infection, its similarities to severe strepwhereas production of SEB or SECl alone was not observed tococcal scarlet fever, and failure of patients in advanced stages with menstrual strains. to respond to antibiotic therapy, provided early evidence that The significance of multiple toxin production by TSS isoTSS is toxin mediated. The first toxin shown to be involved lates is unknown. Coproduction of TSST- 1 and SECl is comin TSS is now referred to as toxic shock syndrome toxin-1 mon by human strains and also animal isolates from bovine (TSST-I). This toxin was first identified and characterized in and sheep r n a ~ t i t i s Evidence .~~ suggests that the toxicity re1981 through the independent investigations of Schlievert et sulting from this combination is more potent than TSST- 1 alone al.57and Bergdoll et al.58Because of differences in their initial or TSST-I with other enterotoxins.@ The mutually exclusive experimental observations, the toxin was originally named pyrproduction of TSST-I and SEB is noteworthy. Southern hyogenic exotoxin type C (PEC) and staphylococcal enterotoxin bridization experiments have shown that the lack of TSST-1 F (SEF), respectively, by these two groups of researchers. production by SEB producers is due to the absence of the TSSTWhen PEC and SEF were later shown to be identical in bio1 structural gene (rsr)and is not the result of negative regulatory chemical, biological, and immunological a s s a y ~ ~ and ~ - not ~ ’ . ~ ~ effects.7o to possess emetic activity, an agreement was reached at the The reason for differences in toxin production between First International TSS Symposium held in Madison, WI to vaginal and nonvaginal isolates is not known. It may reflect rename the toxin TSST-I .61 In spite of a few reports to the differences in the toxins’ structure such that TSST-1, but not c0ntTary,s8.62,63 TSST-1 is produced only by S. aureus and not the enterotoxins, is able to damage or transverse the vaginal by coagulase negative staphylococci. This has been confirmed mucosa. Binding and internalization of TSST- 1 through reby extensive studies using immunological and gene probing ceptor-mediated endocytosis by cultured epithelial cells” and techniques.M66 transcytosis of the toxin by human endothelial cells72provide a possible explanation for the systemic effects of this toxin and Most (>90%) of TSS S. aureus isolates from vaginal or damage to vaginal mucosa in TSS.73Although similar studies cervical cultures, usually obtained during menstruation, prohave not been done with SEB and SECI, TSS symptoms in duce TSST-1 .31.57-s9.66.67 However, production of this toxin by experimental models have only been demonstrated with enterTSS S. aureus isolated from other body sites is less comotoxins after intravenous An alternative explanation mon.20-22.68 Since 1982, in an ongoing survey by the authors’ for the difference in toxin production between vaginal and laboratory, less than half of nonmenstrual TSS isolates subnonvaginal isolates is that TSST-I production may be linked mitted for analysis produced TSST-I (Table 4). The majority to other phenotypic characteristics that enable the organism to of these TSST- 1 negative strains produce SEB or SECl . colonize the vagina. TSST-1 positive strains, such as those Table 5 shows the relative frequency of production of TSSTlikely to cause menstrual TSS, produce less hemolysin, lipase, 1, SEB and SECl by 70 randomly selected menstrual and and nuclease than strains which colonize the skin.32However, nonmenstrual TSS isolates in our laboratory. In this survey,

254

Volume 17, Issue 4

Microbiology Table 5 Toxin Production by TSS and Probable TSS Isolates Toxin produced ( % positive)

Source of isolates


Menstrual Nonmenshual

Number tested 39 31

TSST-1 alone 37 15

SEB alone

-

(95%) (48%)

enterotoxin production by skin strains has not been investigated sufficiently to permit any reliable conclusions. To date, TSST-1, SEB, and SECl are the only staphylococcal toxins conclusively implicated in TSS. This statement is based on the results of a limited number of epidemiological surveys showing that S. aureus strains which produce any of these three toxins alone can cause TSS .21.22.68.69 Although some TSS isolates produce other enterotoxins (A, D, and E), TSST1, SEB, or SECl are also coproduced.2.68 It is likely that evaluation of additional isolates will demonstrate roles for other toxins in the illness. 2, Streptococcal Toxins Since the initial description of TSS, its clinical similarities to streptococcal scarlet fever have been noted.w The streptococcal toxins have long been known to induce the symptoms of scarlet f e ~ e r ~and ~ , ’have ~ been designated by a variety of names including erythrogenic toxins, scarlet fever toxins, and blastogen A (type A toxin). Currently, these toxins are known as SPEs. There are three antigenically distinct SPEs (A, B, and C).7678 Because of their similarities, it is not surprising that pyrogenic toxins produced by both organisms can cause TSS. This was the basis for a predicted link between the SPEs and TSS in 1983.79However, it was not until 1987 that a description of two well-defined case reports led to the recognition of a severely toxic streptococcal illness, called streptococcal TSS .24 Because streptococcal TSS has only recently been described, an extensive epidemiological study of the toxins involved has not been completed. However, an ongoing survey of clinical isolates in our laboratory, (Table 6) nearly all of which were from TSS on scarlet fever cases, has enabled several conclusions to be made which may be significant for evaluating the role of SPEs in TSS. The data show that certain toxin profiles are more common than others and that patterns of toxin production among group A streptococci may be changing. Most notably evident is an increase in Occurrence of SPE A production by the organism. Although SPE A was the first SPE indentified, the rarity of strains producing this toxin in recent times was noted in 197g80and was suggested as a likely cause for the decline in severe cases of scarlet fever in the twentieth century. The reemergence of SPE A production by

1990

SECl alone

8

2

(26%)

TSST- 1 and SECl together

-

2

(7%)

6

(5%) (19%)

Table 6 Production of SPEs by Group A Streptococci Percent positive for production of A

B

C

Pre 1976

30

1976-1985’ 1 9 8 6 1987b 1988 through May’

0 10 83

60 70

55 70 70 17

Year

‘

’ ‘

60 17

Includes 10 patients with TSS-like illnesses (no A toxin positives). Includes 7 patients with TSS-like illnesses (2 A toxin positives). All from patients (12) with TSS-lke illnesses.

S. pyogenes in 1986 coincided with the recognition of streptococcal TSS. In fact, toxin analysis of the isolate from the fatal case of the two initial streptococcal TSS reports showed that SPE A was the sole pyrogenic toxin made by this strain.24

C. Biochemical Properties and Purification Techniques 1. TSST-1 Numerous methodologies have been used to obtain highly purified TSST-1 from S. aweus cultures. Two techniques are described in this review. For other methods the interested reader is referred to Table 7 which contains a summary of other important techniques. Schlievert et al.” showed that large amounts of TSST-1 were produced by growing aerated S. aureus cultures until stationary phase in dialyzable beef heart medium. The toxin was purified from resolubilized ethanol precipitates, by preparative isoelectric focusing in a pH gradient of 3.5 to 10. This technique yielded an apparently pure toxin preparation containing a homogenous protein with an isoelectric point of 7.2 and a molecular weight of 22,000. The toxin contained only a single protein when silver stained with no evidence for a multiple subunit composition and thus was not analogous to that observed with several other bacterial exotoxins.8’.82Subsequently, a modification of this method showed that TSST-I

255

Critical Reviews In Table 7 Methods for Purification of Pyrogenic Toxins Toxin TSST- 1

TSST-I

TSST- I


TSST-1

SEB SEC I

SECl SEB

SEB and SEC 1

SPE A SPE A and SPE B SPE A

SPE C

Procedure

Ref.

Ethanol precipitation, isoelechic focusing (successive pH gradients of 3-10 and 6-8). dialysis Batch adsorption (CG-50). ion-exchange chromatography (CM-Sepharosc CLdB), gel filtration chromatography (Sephacryl S-200) Ion-exchange chromatography (CM Sephadex C-25) gel filtration chromatography (Sephadex (3-75) Ion-exchange chromatography (SP-Sephadex C-24) chromatography (PBE90) gel filtration .chromatography (Sephadex 43-75) Batch adsorption (03-50 resin) ion-exchange chromatography (CM-cellulose) Carbowax 20 dialysis ion-exchange chromatography (CM-cellulose) gel filtration chromatography (Sephadex G-75) gel filtration chromatography (Sephadex G-50) Ethanol precipitation Isoelectric focusing (successive pH gradients of 3- 10 and 7-9) Batch absorption (Biorex 70) isoelectric focusing (ph gradient 8-1 I ) gel filtration chromatography (Sephadex G-100) Batch adsorption (CG-50 or CM-cellulose) gel filtration chromatography (Sephadex G-50) removal of alpha toxin (rabbit erythrocyte membranes) chromatofocusing (Pharmolytc 6.5-9) gel filtration chromatography (Sephadex G-50) Ethanol precipitation dissolve in acetate buffered saline discard insoluble material Repeat steps 1-3 Same as reference 106 Ion-exchange chromatography (QAE-Sephadex A-50) Ethanol precipitation ion-exchange chromatography (DEAE-Sepharose CI-6B) (NH4),SO, precipitation ion-exchange chromatography (CM-Sepharose Cl6B ) Same as reference 106 Hyaluronidase treatment isoelechic focusing (successive pH gradients of 3.510 and 6-8)

57

’

58

85 86

88 89

90 91

92 so T A A G G A G A A T T A A A A A T 6 AAT A A A A A A T T A C T A A T G A A T T T T T T T A T C GTA Met A s n LYS L Y S L e u L e u M e t A s n P h e P h e TIC V a l

106 107

A G C CCT T T G T T 6 C T T 6 C 6 A C A A C T GCT A C A G A T T T T A C C CCT G T T CCC S e r P r o Leu L e u L eu A l a T h r I l e A l e T h r A S D P h e T h r P r o Val P r o T T A T C A T C T A A T C I A A T A A T C A A A A C T GCA A A A GCA T C T ACA A A C GAT 4 e u S e r S e r Arn G l n I l e I I e L y s T h r A I O LYS A l a S e r T h r A s n A s p A A T A T A A A G GAT T T G C T A G A C T G G T A T A G T A G T GGG T C T GAC A C T T T T Asn I I C L y s Asp L e u L e u Asp T r p T y r Ser Ser G l y Ser Asp T h r Phe

I09

A C A A A T A G T G A A G T T T T A GAT A A T T C C T T A GGA T C T A T G CGT A T A A A A T h r A s n S e r G l u V a l L e u A s p A s n S e r L e u G l y S e r M e t k r g IIe L y s A A C A C A GAT GGC A G C A T C A G C T T G A T A A T T T T T CCG A 6 T CCT T A T T A T Asn T h r A S P G l y S e r t l e S e r L e u I I e I I c P h e P r o S e r P r o T y r T y r

I08

A G C C C T GCT T T T A C A A A A GGG G A A A A A G T T G A C T T A A A C A C A A A A AGA S e r P r o A l e P h e T h r L y s G l y G l u L y s Val Asp L e u Asn T h r Lys A r g A C T A A A A A A A G C C A A C A T A C T A G C B A A GGA A C T T A T A T C CAT T T C C A A T h r L y s L y r S e r Gln H I S T h r S e r G l u G I y T h r T y r t l e H 1 s P h e G l n

could be resolved into two distinct species, TSST-la and TSSTlb with slightly different isoelectric points (7.08 and 7.18, re~pectively).~~ The alternate forms were observed after refocusing highly purified toxin in narrower pH gradients of 6.0 to 8.0 and then 6.5 to 7.5. Both were immunologically identical and equally active in several biological assays. The reason for this microheterogeneity has not been established but may result from binding to a cofactor, alternate three-dimensional conformations, or modified amino acids. Bergdoll et al.’* reported production of TSST-1 in S. aureus cultures grown in complex media such as that used for promoting enterotoxin synthesis. By using a sequence of purification techniques including adsorption of the toxin on CG50 ion exchange resin, and chromatography on CM-Sepharose followed by Sephacryl S-200 gel filtration, a preparation with 95% purity was obtained. The preparation presumably con-

256

tained a small amount of enterotoxin since it induced emesis and diarrhea in monkeys after intragasmc injection. Hence its original name, staphylococcal enterotoxin F, was assigned. TSST-I obtained by this method had an apparent molecular weight of 20,000 and an isoelectric point of 6.8. Reiser et al.84 later showed, that by using a similar technique, a more purified preparation could be obtained. TSST1 was shown to be negative in monkey feeding tests, had a molecular weight of approximately 24,000 and was heterogenous in isoelecuic focusing assays. The authors described the stability of the toxin in aqueous solution, urea, and in the presence of trypsin, but noted it was susceptible to digestion with pepsin. In 1986, the amino acid sequence of TSST-1 was reported*’ (Figure 1 ) . This published sequence was predicted based upon the nucleotide sequence of the cloned toxin structural gene and confirmed by partial amino acid sequencing of peptides produced by cyanogen bromide cleavage. The toxin was initially synthesized as a precursor molecule with a signal peptide containing 40 amino acids. Cleavage of the signal peptide resulted in production of the mature toxin containing 194 amino acids and a calculated molecular weight of 22,049.

A T A A67 GGC GTT A C A A A T A C T G A A A A A T T A C C T A C T C C A A T A GAA C T A IIe S e r G l y V a l T h r A s n T h r G l u L y r L e u P r o T h r P r o I I e G l u L e u C C T T T A A A A GTT A A G GTT C A T GGT A A A G A T A G C CCC T T A A A G T A T GGG P r o L e u L y s V a l L y s V a l n t s G l y Lys A s p S e r P r o L e u L y s T y r T r v C C A A A G T T C G A T A A A A A A C A A T T A GCT A T A T C A A C T T T A GAC T T T GAA P r o L y s P h e A s p L y s L y s 61n L e u A l e I I e S e r T h r L e u A S P P h e G l u A T T CGT C A T C A G C T A A C T C A A A T A C A T GGA T T A T A T CGT T C A AGC GAT Ile A r g n { s G l n Leu T h r G l n I l e ncs G l y L e u T y r A r g Ser S e r ASP A A A A C G GGT GGT T A T T G G A A A A T A A C A A T G A A T GAC GGA T C C ACA T A T L y s T h r G l y G l y T y r T r p L y s I I e T h r M e t Asn A s p G l y S e r T h r T y r C A A A C T G A T T T A T C T A A A A A G T T T G A A T A C A A T A C T GAA A A A CCA CCT G l n Ser A s p L e u S e r L y s L y s P h e G l u T y r A s n T h r G l u L y s P r o P r o A T A A A T A T T G A T GAA A T A A A A A C T A T A G A A GCA G A A A T T A A T T A A T T T IIe ASn I l e A s p G l u I I e L y s T h r I I e G l u A l a G l u I l e A s n T E R A C CA CT T T

FIGURE 1. Nucleotide and amino acid sequence of rsf and TSST-I. respectively.” The signal peptide is underlined and the Shine-Dalgmo sequence (SD) is indicated.

Volume 17, Issue 4


Microbiology Sequence analysis showed an unusually high percentage (25%) of hydrophobic amino acids, four clusters of proline residues (residues 48 to 56, 95 to 101, 112 to 117, and 179 to 180) and two predicted @turns (residues 35 to 39 and 47 to 50). This sequence agreed well with two previously reported amino acid compositions for the m o I e c ~ l e . Also ~ ~ ~significant *~ was the absence of cysteine residues, thus negating the p s sibility for the presence of a cysteine loop structure, characteristic of the staphylococcal enterotoxins. Recently, a variant TSST-1, purified by similar techniques from sheep mastitis isolates, has been recognized. This toxin appears slightly larger than TSST-Ifrom human sources and has an isoelectric point of 8.9 (as opposed to 7.2 for human TSST- 1 ) .

2. Enterotoxins B and C l Because they have been longer recognized than TSST-1 as significant causes of human illness, due to their role in food poisoning, more techniques have been developed for purification of staphylococcal enterotoxins, including SEB and SECl . Since the pyrogenic toxins have similar physicochemical properties, many techniques for purification of TSST-1 (including those which are discussed previously) are applicable to or arose from modifications of methods developed for the enterotoxins. A few of these are described in this section, while others are listed in Table 7. SEB was first obtained in a highly purified form with high yields by Shantz et al. in 1965.88 The procedure employed binding the toxin in culture supernatant fluids to CG-50 resin followed by additional purification with CM-cellulose chromatography. This technique yielded greater than 60 mg of toxin per I of culture with a purity of greater than 95%. SEB purified in this way had an apparent molecular weight of 35,300 and an isoelectric point of approximately 8.6. Borja and Bergdoll found this same technique to be applicable for purification of SECl .89 A molecular weight value of approximately 34,100 was obtained from sedimentation and diffusion measurements. SECl was shown to have the same isoelectric point, 8.6, as SEB. In our laboratory, we use a preparative isoelectric focusing method similar to that described previously for making TSST1. Isoelectric focusing is particularly useful for purification of SEs B and C1 because their basic nature results in a cathodal migration, whereas most other contaminating exoproteins migrate toward the anode. Cultures of enterotoxigenic S. aureus are processed identically to those used for TSST-I production except, following the initial focusing in a pH 3.5 to 10.0 gradient, the toxin is refocused in a pH gradient of 7.0 to 9.0 to assure purity.w Yields of 8 to 10 mg of either enterotoxin per 1 of culture are typical. SECl and SEB purified by this method have molecular weights of approximately 26,000 and 28,000, respectively. Due to the variety of methods used for determination of

1990

molecular weights of SEB and SECl , numerous discrepancies for these values have appeared in the literature. Most of these inconsistencies were resolved when amino acid sequences for the toxins became available. In 1970, Huang and Bergdoll reported the initial primary structure of SEB.Y3Their results were obtained by amino acid sequence analysis of cyanogen bromide-generated peptides. In 1983, Schmidt and Spero elucidated the complete amino acid sequence of SECl by generation of toxin fragments using a combination of cyanogen bromide, trypsin, and chymotrypsin." These reports indicated that SEB and SECl each contained 239 amino acids and calculated molecular weights of 28,494 and 27,500, respectively. These values have been modified slightly in recent published reports, in which the primary structures of the two toxins were deduced based upon nucleotide sequence data.".% SEB is synthesized initially as a 266 amino acid precursor containing a signal peptide with 27 residues95 (Figure 2). This precursor form of SEB has been previously demonstrated in association with membrane fractions of S. a ~ r e u sCleavage .~~ of the signal peptide results in maturation of the toxin to its extracellular form with 239 amino acids and a calculated molecular weight of 28.336.

195

~ l 6 i I K F I P K ~ S F Y f f F P E P E - ~ F ~ ~ S K Y L ~ l i K ~ T L ~ M l S ~ l251 ~ V Y SPE L T l AK

................................... ................................................... ...................................................

206 ~ i b C i ; i i E M ~ l F U i ~ ~ 6 ~ ~ ~ ~ K ~ ~ ~ ~ M266D ~E M ~1 CI V ~ K S ~ K ~ ~ ~ ~ ~ ~ ; K N 207 ' I E l 6 i I L F I E ~ - 1 6 F U Y ~ A P 6 ~ f ~ S K ~ ~ Y N ~ M V D S K D V K l f V T L T266 T K K EKN 1 B

FIGURE 2. Amino acid sequence homology between SECI, SEB, and SPE A including their signal peptides. Homologous amino acids' (.) and gaps (---) introduced for optimal alignments are indicated. (Data compiled from references 95, 96, 112, and 113.)

The amino acid sequence of SECl deduced from the nucleotide sequence of its structural gene differs from that previously reported by only four residues.".% This toxin is also initially synthesized as a precursor with 266 amino acids (Figure 2). In its mature form (minus the 27 amino acid signal peptide), the toxin contains 239 amino acids with a predicted molecular weight of 27,531 .p6 One physicochemical property that SEB and SECl share with other pyrogenic toxins is their charge microheterogeneity . This characteristic, demonstrated by isoelectric focusing, was

257


Critical Reviews In initially reported by Baird-Parker and Joseph in 1964.98A later study by Chang and Dickie showed that SEB exists as two major electrophoresis forms with isoelectric points of 8.25 and 8.55 and two minor species which focus between pH 7.8 and 8.0.w All four forms of the toxin were biologically active and immunologically identical. Furthermore, refocusing of the most basic form (PI 8.55) resulted in its conversion to an alternate more acidic form. It was subsequently shown that under alkaline conditions, SEB undergoes partial amide hydrolysis resulting in a progressive conversion of the toxin to its more acidic forms.Iw Metzger et al. reported similar findings in their study of SEC1.iOiHowever, others have suggested that toxin aggregation or protein-buffer interactions may also be a source of apparent microheterogeneity.89 It is interesting that microheterogeneity is uniformly observed, characteristic of both staphylococcal and streptococcal pyrogenic toxins. Resolution of TSST-I into two distinct forms was described previously. A similar phenomenon is exhibited by the SPEs and is described later. Much of the available information regarding resistance of SEB and SECl to physical and chemical degradation has been provided from studies of the effect of these agents on their emetic activity. Both toxins are somewhat resistant to pH and temperature extremes and also proteolytic degradation, although SEB is sensitive to pepsin at pH 2.0.88.i02 Each contains a trypsin sensitive site in their cysteine loop, while SECl has an additional cleavage site at lysine residue 57. '03.'04 Evidence also suggests that S. uureus produces a trypsin-like protease that results in a minor amount of intrinsic nicking of SEB and SECl in their mature forms.i05Susceptibility of both toxins to cyanogen bromide and of SECl to chymotrypsin has been described .93.94 3. Streptococcal Pyrogenic Toxins (SPEs) Early investigators attempting to purify SPEs from 3. p y ogenes culture supernatant fluids experienced difficulty in separating the toxins from a variety of contaminating bacterial products including hyaluronic acid. '06 Cunningham et al. successfully purified SPE A and SPE B from the same culture by differential ethanol precipitation, resolubilization in acetatebuffered saline, followed by ion-exchange chromatography on QAE-Sephadex, although very small yields were obtained."' Schlievert et al. later modified this procedure to purify SPE C by removal of hyaluronic acid with hyaluronidase and replacing ion-exchange chromatography with a preparative isoelectric focusing step. Io8 Additional modifications have been added to this procedure in recent years, so that it is now applicable for purification of all three SPEs. The general scheme used for SPE purification in our laboratory is outlined in Figure 3. Additional techniques which have proven useful are indicated in Table 7. The first SPE to be purified and characterized was SPE A. Due to the variety of techniques used, early investigations

258

Culture toxigenic Stre tococcus di a l y r a b l e bee! h e a r t me*

o e n e s in

J.

P r e c l p i t a t c cells and supernatant fluid with four volumes of ethanol ( 4 ° C )

Repeat

t

R e s o l u b l l l z e in 1 l i t e r a c e t a t e - b u f f e r e d s a l i n e ( p H 4.5)

JI JI against

C e n t r f f u g e to remove insoluble material

Dialyze 2 days

distilled water

J.

Lyophillze

4

D i g e s t 300 m g w i t h 10 m g h y a l u r o n i d a s e a in 10 ml w a t e r (37'C) until liquified

Preparative thin-layer Isoelectrlc focusing in p H g r a d i e n t o f 3.5 t o 9.5

$. S c r e e n g e l s l a b s by i n m u n o d i f f u s i o n wlth toxln-specific antisera

J.

Pool positive fractions

J.

R e f o c u s in p H g r a d i e n t of: 4 to 6 for SPE A

7 to 9 f o r SPE B

SPE C

z y m o g r a m prints and immunodiffusion

J.

Dialyze four days against pyrogen-free water

4

Lyophilize FIGURE 3. Purification scheme for the SPEs. Hydwonidase treatment is optional and generally used only when punfying toxins from highly rnucoid strains.

produced conflicting results regarding the physicochemical properties of the toxin. Initial molecular weight values that were reported ranged from 5,500 to 30,500."~1w~'07~'w-iii SPE A is an acidic protein that displays charge microheterogeneity with an isoelectric point of 4.5 to 5.5.Io7Nauciel et al. reported that the two major charged species of SPE A could be converted to a single form by treatment with 2-mercaptoethanol and proposed that the toxin binds to small molecules or proteins by free sulfhydryl group^."^ Recently obtained sequence data indicate that the larger estimated molecular weight values for SPE A are closer to the correct value. i i 2 . i 1 3 Nucleotide sequence analysis of the cloned

Volume 17, Issue 4


Microbiology toxin gene showed that the toxin is synthesized as a 251 amino acid precursor with a calculated molecular weight of 29,244 (Figure 2). Cleavage of its 30 amino acid signal peptide results in production of the mature extracellular form with 221 amino acids and a molecular weight of 25,787. Two early studies on characterization of SPE B produced conflicting molecular weight values, but indicated that this toxin is a basic protein with characteristic charge microheterogeneity. The toxin resolved into three fractions with isoelectric points of 8.0, 8.3, and 9.O.lI4The three forms were immunologically identical, but only the PI 8.3 fraction was completely biologically active when tested in rabbits. SPE B purified by ion-exchange chromatography had a molecular weight of 21,900; whereas, a size of approximately 17,500 Da was obtained for the toxin purified by isoelectric focusing. 1 0 7 ~ 1 1 4 Proteolysis was suspected as the cause of this discrepancy. Recently the structural gene for SPE B was cloned in Escherichia c 0 1 i . ~Although ~~ sequence analysis has not been completed, the cloned toxin has a molecular weight of 29,000 and thus appears to be more stable in E. coli. SPE C was first purified and characterized by Schlievert et al. in 1977.Io8 The toxin, purified by preparative isoelectric focusing and hyaluronidase treatment, consisted of a homogenous protein with a molecular weight of 13,200 and had a single isoelectric point of 6.7. Based upon nucleotide sequence analysis of the cloned toxin gene and its predicted amino acid sequence, Goshom and Schlievert have shown that the actual molecular weight of SPE C is larger than previously reported.'16 The s t ~ c t u r a lgene (Figure 4) codes for a SPE C precursor containing 235 amino acids. The first 27 residues comprise the signal peptide. Mature SPE C consists of 208 amino acids with a calculated molecular weight of 24,354. SDS-polyacrylamide gel electrophoresis of the cloned toxin from E. coli yielded a sirmlar value.

~ A A C C-T3 T5 G A C T A T T T A A A T G G A A C T G C C A C T ~ C T A A A A A C T A A A A T ~ ~ ~ A A T ~ ~ A

TTTATAAAATTTCTAAATAAACAGAAATCTGATTTTTAACTACTTACTGCTATTT

A T A A C A T C A T C A A A A A G T T T T C A T A A T A C A GT I T e A s n I l e Ile L y s ITe V a l P h e Ile I r e T h r V a f AITeA LC Te Gu ATT TCT ACT I l e Ser Thr GAC A T T T C G A S P Ile S c r

T A T T T C ACC T y r Phe T h r A A T GTT A A A Asn Val Lys

A T A ACT Ile T h r ACG ACA Thr Thr

CCT Pro CAC His

TAT TYr ACA Thr

GAT ASP TTA Leu

TAT Tyr AAC Asn

AAA Lys CAA Gln TTT Phe

TAT Tyr TTT Phe AT1

TAT Tyr AAA LyS CTT I l e Leu

AT1 I l e CGA Arg AAT Asn

AGT Ser GAT Asp TCT Ser

GAC Asp AAA Lys TAT Tyr

TAT CAT Tyr His AGT GAT Ser Asp AAA GAT LYS Asp A T 1 GAT Ile Asp

CAA AGT Gln Ser TTA CTT Leu Leu T G C AGG Cys A r g ACT CAA Thr Gin

GAC T C T Asp Ser T A T GCA Tyr Ala GTA A A T Val Asn AAA TAT Lys Tyr

AAG Lys TAC Tyr TTT Phe AGA Arg

TCC Ser GAT Asp CAC

ATG TCT Met S e r G T A GAT Val Asp GGT GAG Gly Glu

TAT Tyr GTT Val TAC Tyr

GCC Ala GGA Gly

GAA Glu CAT His ACC His Thr

GAG Glu TTT Phe ATC

AAA Lys ACT Thr TCA Ser GGG Gly

TCT Ser TTA Leu T A T GGA Ile T y r G l y

G A A T T A C G C c T GCT C A A A A T A A T A A A G T A A A T C A T A A A T T A G f y I l c T h r P r o A l a G l n A s n A s n L y s V a l Asn H i s L y s L e u T T G GGA A A T C T A T T T A T T T C G GGA G A A T C T C A A CAG A A C T T A L e u G l y Asn Leu Phe I l e Ser G l y G l u Ser Gln Gln Asn Leu A A T A A C A A G A T T A T 1 C T A G A A A A G G A T A T C G T A ACT T T C C A G A s n A s n L y S I l e Ih L e u G l u L y s A s p I l e V a l T h r P h e G l n GAA A T 1 GAC T T T A A A A T C AGA A A A T A C C T T A T G GAT A A T T A T G l u Ile A s p P h e L y s I l c A r g L y s T y r L e u Met A s p A s n T y r A A A A T 1 T A T G A C G T A C T T C T C C T T A T G T A A G C GGC AGA A T C L y s Ile T y r A s p A F a T h r S e r P r o T y r V a l S e r G l y A r g I l e G A A A T 1 G C A C A A A A G A T G G A A A C A T GAG C A A A T A GAC T T A G l u I l e G f y T h r L y s A s p G f y L y s His G l u G l n Ile A s p L e u

T T T L A C T C A C C A A A T G A A GGG A C T AGA T C A G A T A T T T T T GCA Phe A s p S e r P r o A s n G l u G l y T h r A r g S e r A s p I l e P h e A l a A A A T A T A A A GAT A A T AGA A T T A T C A A T A T G A A G AAC T T T AGT ~ y Ts y r L j s A s p A s n A r g I I e I l e A s n M e t L y s A s n P h e S e r

CAT T T C GAT A T T T A T C T T G A A A A A TAATTCATCATACACAAAAAACC H I S Phe A s p I l e T y r L e u G l u L y s TER IA I R C C - A T A A T C T G A G C G G T T T T GT C T T A T C T C G G A G C T T T A C C T C C T A A T T T A

111. STRUCTURAL AND IMMUNOLOGICAL RELATEDNESS OF TSS-ASSOCIATED TOXINS

FIGURE 4. Nucleotidc and amino acid sequence of spec and SPE C, rcspectively."6 The signal peptide is underlined. The proposed - 10 and - 3 5 promoter regions and the Shinc-Dalgamo (SD) sequence arc indicated. Downstream palindromic sequences are indicated by arrows.

homology, analyzed by computer alignment of the three proteins, was highly significant. Their carboxyl ends and sequences flanking the enterotoxin cysteine loop are most conserved among all three proteins." The SEB and SECl sequences are also highly homologous in their N-termini,whereas the SPE A sequence is very different in this part of the molecule. Similarly, although the SPE C N-terminal sequence is completely distinct when compared to other pyrogenic toxins, its carboxyl end contains several conserved clusters of amino acids that are also found in SEB and SECI, and it is significantly homologous with the analagous portion of SPE A. 'I6 Data presently available indicate that TSST-1 relatedness to other pyrogenic toxins is minimal. *' Sequence comparisons of the toxin and its structural gene, rst, with other pyrogenic toxin sequences indicate a possible significant degree of similarity to SPE A and enterotoxin A , when computer alignments are used that match conservatively substituted amino acids. I" More

Toxins that are now associated with TSS were originally grouped into the pyrogenic toxin family because of their shared biological and physicochemical properties. Recent evidence suggests that the shared properties of most of these toxins are a direct consequence of sequence homology at the amino acid and nucleotide levels. Schmidt and Spero first demonstrated that SEB and SECl possess significant amino acid homology, despite their immunological distinction.% Subsequently, sequence analysis of the SPE A, SEB, and SECl structural genes and computer alignments of their deduced primary sequences showed that all three toxins were related (Figure 2).95."."2.113 The nucleotide sequence of entCl has 74 and 59% homology with the other two toxin genes, entB and speA, respectively.% Amino acid 1990

259


Critical Reviews In stringent computer algorithms do not demonstrate these simil a r i t i e ~ .Only ~ ~ after sequence data for the other pyrogenic toxins become available and conserved biologically active residues are identified, can the overall relatedness of TSST-1 be assessed. Except for a minor degree of cross-reactivity between some of the staphylococcal enterotoxins,”8.120the pyrogenic toxins have classically been regarded as being immunologically distinct. This general belief was based primarily on results of immunodiffusion assays. Except for a few reports,121~’2z the sensitivity of immunodiffusion assays is generally not sufficient to demonstrate cross-reactivity of hyperimmune antisera with heterologous toxins. However, by using appropriate techniques, immunological cross-reactivity has been demonstrated with SEB, SECl, and SPE A, three toxins with the most significant homology. Spero et al. demonstrated cross-reactivity between SEB and SECl with heterologous antibody by measuring antigen-binding capacity and competitive binding assays. Using a similar technique with trypsin fragments of each toxin, to localize major epitopes, amino terminal peptides reacted predominantly with heterologous antibody. Iz4 Homologous antibody bound most effectively to carboxyl fragments. In addition, mitogenic activity of SECl was localized to the 57 amino acids, while the carboxyl end was emetic in monkeys.‘= Trypsin digestion of SEB resulted in loss of biological activity.”6 These results are difficult to correlate with our present knowledge regarding sequence homology of the pyrogenic toxins. For instance, in general the carboxyl ends of the molecules are consistently most conserved and thus are expected to possess shared antigenic epitopes recognized by heterologous antibodies.w.v6In fact, Thompson et al. produced two crossreactive monoclonal antibodies that bound to the carboxyl fragments of both SEB and SECI.IoSIt is also difficult to interpret the mitogenic activity associated with the amino terminal of SECl . One might predict that shared biological properties such as mitogenicity would be determined by a highly conserved carboxyl portion of the toxin. Indeed, Bohach et al. have shown recently that the major T-cell mitogenic activity and the ability to induce fever and predispose the host to endotoxin shock of SECl reside in a carboxyl end, trypsin-generated fragment.223 Monoclonal antibodies produced against ENT C1 or SPE A can neutralize the mitogenic activity of some heterologous toxins (ENT C1, ENT B, and SPE A).’” Enzyme-linked immunosorbent assays are less sensitive indicators of cross-reactivity. Generally IgM antibodies are more cross-reactive. None of the anti-ENT C1 or anti-SPE A antibodies reacted with either SPE C or TSST- 1.

A. Genetics of Toxin Production 1. TSST-1

In an initial survey of 13 TSS isolates, Kreiswirth et al. were unable to demonstrate involvement of phage or plasmids in

260

production of TSST-1.27 They proposed that the 1st gene is located on a genetic determinant that is capable of heterologous chromosomal insertion and is unlinked to several well characterized genetic markers. Schutzer et a]. later showed that many strains that produce TSST-1 were lysogenized by temperate bacteriophage. 12* These investigators proposed that lysogeny in S. aureus may be responsible for pathogenesis of TSS. Subsequently, Kreiswirth et a]. provided convincing evidence that lysogeny was not involved in TSST-I production.’29 They also showed that lysogenic phages from toxigenic strains do not carry tsf. fst was cloned, originally in E. coli, from the chromosome of a toxigenic strain of S. aureus. Sequence analysis of the toxin structural gene is discussed above. The gene was later reintroduced into a nontoxigenic strain of 5. aureus via the staphylococcal plasmid pE194,l3Oand TSST-I produced in E. coli or S. aureus clones was identical to the native toxin in physicochemical and immunological assays. 129 TSST- 1 was also produced in Bacillus subtilis.I3’ The tst gene, ligated to a Bacillus plasmid, pBD64,I3* and transformed into B. subtilis expressed fourfold more toxin than the donor staphylococcal strain. Bacillus-derived toxin appeared identical to native TSST1, but was less soluble in water. The TSST-1 genetic element is absent in nontoxigenic S. aureus There appears to be multiple, but a limited number, of integration sites for the element in the staphylococcal chromosome. Based upon the unusually high rate of tryptophan auxotypy observed for TSST- 1 producing strains, it has been suggested that this operon may be a preferred insertion site.’33Several classes of toxigenic clonal derivatives have been identified, based upon phenotypic and Southern hybridization analysis.”’ Restriction enzyme-digested DNA from a variety of clonal types produced several distinct hybridization patterns. Variability in profiles occurred even within the group of tryptophan auxotrophs. Studies on the genetic regulation of TSST-I has resulted in demonstration of one or more trans-acting regulatory elements which control expression of several S. aureus exoproteins. In 1985, Recsei et al. described a Tn551 insertion mutant that produced significantly reduced amounts of TSST- 1 and several other exoproteins including hemolysins (a,p, and 6 ) and staphylokinase.134In contrast, secreted protein A levels were elevated. The regulatory element mapped between the purB and ilv loci and was designated agr (accessory gene regulator). The trans-acting nature of agr was confirmed by showing that TSST1 was not expressed when tst waswmsformed into the mutant on a high copy-number plasmid. The pleotrophic effect was shown to act at the level of transcription.’35 In 1986 working independently, Janzon et al. subsequently described the same or similar regulatory element by mutagenesis of a chromosomal locus, designated exp.136The regulatory effects of exp were similar to agr. These investigators also reported positive exp regulation of serine and metalloproteases, nuclease, and acid

Volume 17, Issue 4

Microbiology


phosphatase and negative control of coagulase. The exp locus was identified using Tn551, cloned in E. coli and shown to code for a 3.5 Kb RNA species."7 2. Enrerotoxins B and C7 Genetic systems for the staphylococcal enterotoxins are diverse. For instance, the gene for SEA (entA) is harbored on a family of heterogeneous phages that appear capable of integration at several chromosomal l ~ c i . ' ~Thus, ~ . ' ~probing ~ experiments for envi reveal considerable polymorphism in lengths of restriction fragments containing the gene. Most enrA phages appear to be defective and cannot be induced. In contrast, enrD is contained on a penicillinase p 1 a ~ m i d . IAlthough ~ studies with entB and entCZ have demonstrated some similarities with the genetic systems for SEA and SED, several differences are evident. Work done primarily on SEB-producers suggests that enrB is transferred by a hitchhiking transposon.'4' In these systems, the mobile gene on a site-specific element has a high transposition frequency. Transposition onto a carrier plasmid is required fGr mobilization. Evidence suggest that the SECl element is under similar regulation. Several conflicting reports concerning the genomic location and mechanism of entB mobility suggested that the genetic system involved is complex. Initial studies provided evidence that entB, in hospital isolates, was plasmid borne and yet is linked to a chromosomal determinant for methicillin resistance (rnec).'42.143A later investigation demonstrated a chromosomal location for the toxin gene in food poisoning isolates.'u Shafer and Iandolo later reported that enrB may be harbored on either the chromosome or a plasmid.145Although transiently associated with rnec, the two genes were not physically linked. Evidence for the role of a small staphylococcal plasmid (pSN2) in regulation of enrB expression'& was disputed by the results of Khan and Novick.i47 Southern hybridization using toxin gene probes revealed a high degree of restriction length polymorphism for enrB and enrCZ. In one report the entB locus was suggested to be invariable.'4* However, a subsequent study of a large number of toxigenic strains, from a variety of sources revealed numerous clonal variations based on toxin profiles and probing results (Figure 5).69 Human strains that were TSST- 1-negative had extensive restriction length polymorphism for e n f C l . In contrast, strains that coproduced TSST-I and SECl displayed little variability, although human and animal strains had clearly distinct hybridization patterns. Strains which coproduce SEB and SECl are rare. However, in at least one strain, both genes are harbored on the same p1asmid.'49 This plasmid, which also encodes penicillin resistance, occasionally integrates into the chromosome. The combined current evidence suggest that the three TSSassociated staphylococcal toxins are contained on mobile ge-

1990

FIGURE 5. Southern blot analysis of Cld-digested DNA from representative enteroroxigenic 5. uurcus isolates showing restriction length p o l y m ~ r p h i s r n . ~ (A and B) Human isolates [SEC', SEB,-. TSST-1 -1; (C) Human isolate [SECI SEB'. TSST-I -1; (D and E) Human isolates [SECl-, SEB'. TSST-I -1; (F-Hj Human isolates [SEC', SEB-, TSST-I 'I; (I-K) Bovine and sheep mastitis isolates [SECI+, SEB-, TSST-I 'I; (L)Convol human isolate [SECI-, SEB-. TSST-I+]. Mol wt markers are given in Kilobases (Kb). +,

netic elements, similar to hitchhiking transposons described previously. Presumably, these elements have a limited number of preferred integration sites, which could explain several observations including restriction length variability, the influence of rsr on e n C l probing profiles, and also the mutually exclusive occurrence or rarity of some toxin combinations (TSST-1 and SEB; SECl and SEB). The structural genes, enrB and entCl, have been cloned and s e q u e n ~ e d . ~ . ~ ~Ranelli . % . ' ~ et ~ al. found that entB is not expressed in E . coli unless placed behind a strong A promoter. 1 4 8 In contrast, the entCl promoter is recognized in E. coli.w The upstream sequences in the proposed - 10 and -35 promoter regions for the two genes differ by only one nucleotide. These differences are not due to the presence of additional regulatory sequences in the e n C l clone since exonuclease deletion of the upstream region does not result in loss of toxin production. Regulation of SEB production by a mechanism similar to catabolite repression has been reported.s3."0 It has long been known that glucose and its catabolites suppress toxin production. However, unlike catabolite repression in Gram-negative organisms, the inhibition is not reversed by cyclic AMP, and glucose analogs added to the media have variable effects."' We have noted a similar inhibition of SECl and TSST-I production by as little as 0.05% glucose. Similarly, glucose represses SECl production by E. coIi clones.'52 The effect on S. uureus is observed more easily in tryptone broth but not in beef heart medium as noted earlier. Although the mechanism of glucose inhibition of pyrogenic toxin production is controversial and has not been well characterized, catabolite repression in other S. aureus systems, primarily those involved in

261

Critical Reviews In


carbohydrate metabolism has been documented. I S 3 It is possible that the lack of production of SEB in E. coli in the studies of Ranelli et a1.,14*thus, results from this catabolite repression. 3. Streptococcal Pyrogenic Exotoxins The role of bacteriophage and lysogeny in regulation and transfer of SPE A production has long been known. In 1927, Frobisher and Brown showed that a filterable agent from toxigenic group A streptococci could confer toxigenicity to nontoxigenic s&ains.'54In 1964, Zabriskie showed that a lysogenic bacteriophage was responsible for this earlier observation. Is' He demonstrated that infection of S. pyogenes strain T25, with phage from strain T12gl resulted in a lysogenic strain T25, (T12gI) with ability to produce SPE. Phage curing techniques promoted loss of toxigenicity. Others have confirmed the findings of Z a b r i ~ k i e . ' ~ " ' ' ~ Johnson and Schlievert later analyzed purified DNA from the lysogenic phage (T12) and showed the genome was 36 kilobases (Kb) in length and circularly permuted. I6O These investigators confirmed that the SPE A structural gene, speA, was carried by phage T12; several overlapping restriction fragments obtained from T12 expressed the toxin when cloned in E. coli (Figure ,).I6' A similar finding was subsequently made by Weeks and Ferretti.16* EcoRI

Pst I

Eco RI

spell

FIGURE 6. Physical map of streptococcal phage T12 circularly permuted 36.0 Kb genome.161T h e spcA sbuctural gene and phage attachment site were localized on the 1.7 Kb Sol I-Hind III restriction f ~ a g m e n t . ~ ~The '.'~' is site of packaging initiation @a)

262

T12 apparently acquired the speA gene from the streptococcal chromosome through an abnormal excision.163DNA sequences homologous to the phage DNA are common in nontoxigenic strains. In addition, speA was mapped adjacent to (within 850 base pairs) of the phage attachment site. Several oiher bacterial toxin genes transferred by phage have also been localized near the phage attachment site. These include diphtheria toxin,'@ staphylococcal SEA,'39 and SPE C (see the following).'65 This suggests that abnormal excision may be a common mechanism by which toxin genes are acquired by phage. Although speA is now a permanent component of the T I 2 phage genome, converting phage are not induced from a high percentage of toxigenic strains. These strains harbor heterogenous remnants of the phage genome that presumably are defective and have lost their excision capability. The speA gene has been expressed in a variety of backgrounds. Following initial cloning in E. coli.l6' the gene was cloned on a high copy-number plasmid in Bacillus subrilis in an attempt to facilitate large-scale toxin production. 1 3 ' Bacillus produces 32-fold more SPE A than the native streptococcus; however, difficulties were encountered in resolubilization of the purified protein. This shortcoming was not encountered when speA was cloned into S. uureus RN4220 using a pBR328pE194 chimeric cloning vector.'" The toxin gene has also been cloned into Streptococcus sunguis.'62SPE A produced by all the hosts described previously is biologically and immunologically identical to streptococcal-derived toxin. Johnson et al. I J 7 and Colon-Mitt et al. 16' first demonstrated that SPE C production in S. pyogenes was transferred by lysogenic conversion. These reports were confirmed by other independent investigators. 159 After the successful cloning of spec by Goshorn et al. from the chromosome of S. pyogenes strain TI 8P, hybridization experiments confirmed that the structural gene was located on the phage genome of SPE C producing streptococci. 165 Genetics factors involved in SPE C production appear similar to those described previously for SPE A and staphylococcal SEA.'39 For instance, it is not possible to induce toxin-converting phage from most group A streptococcal strains that produce SPE C. In addition, as described, spec maps close to the phage attachment site. Two initial independent investigations failed to demonstrate transfer of SPE B production by lysogenic conversion. '" In contrast, a later study suggested that the toxin could be transferred by phage.'59 Genetic mechanisms involved in SPE B production have been poorly characterized. We have recently cloned speB from' the genome of S. pyogenes strain 86-858. and the toxin gene has been subcloned on a 4.5 Kb Bum HIBglII DNA fragment.'15 Subcloning on smaller DNA fragments have been unsuccessful. Additional characterization of speB and SPE B-producing smeptococci is currently underway.

Volume 17, Issue 4

Microbiology


B. Biological Activities 7. Pyrogenicity The rapid onset of a high fever (>38.9”C) is a prominent characteristic of TSS-like illnesses, and the associated exotoxins all induce a potent fever response when injected into rabbits.s5-57.74.78.106.168-171 TSST- 1 induces a gradual fever response that peaks at 4 h regardless of the route of injection. The SPEs also induce a linear fever response which has peaked by 4 h. SEB, however, has been shown to induce a more biphasic fever response, but the major peak is still at 4 h. In contrast, the response to endotoxin is biphasic with peaks at 1 and 317’ h and may be related to the induction of interleukin 1 (IL1) and tumor necrosis factor (TNF).172.173 Both IL- 1 and TNF are thought to induce fever by stimulating the production of PGE, in the preoptic area of the anterior hypothalamt~s.’~~.”~ The increased rate of PGE, synthesis is thought to be due to an increased rate of oxidation of arachidonic acid by the cyclooxygenase pathway. Inhibitors of this enzyme, such as indomethacin and ibuprofen, inhibit fever caused by purified IL-1 and TNF,172.173 and as well, fever induced by TSST-I and S P E S . ” . ’ ~ ~ The linear febrile response to the TSS-associated exotoxins, therefore, suggests that they may be able to cross the blood brain barrier and in part directly stimulate the hypothalamus by stimulating the production of PGE, as has been proposed by Schlievert and co11eagues.28.’68 It is also possible in the case of TSST-I that indirect stimulation of the hypothalamus may occur, leading to fever responses. TSST-1 has been shown to induce both IL-1 and TNF (see the following) which may conaibute to fever. In contrast, SPE induced nonspecific Tcell mitogenicity appears to be independent of monokine production and thus may not cause fever indirectly through these factors. 17J.176

2. Mitogenicity for T-Lymphocytes The pyrogenic toxins are powerful T-cell mi tog en^."^^^^-^^^ Murine and rabbit splenocytes, human cord lymphocytes, and human peripheral blood lymphocytes all proliferate in response to TSST- 1 and enterotoxins using incorporation of 3H-thymidine into cellular DNA to measure growth. The nonspecificity of the mitogenic response is shown by the fact that cord lymphocytes, which presumably have had no prior exposure, proliferate upon exposure to the toxins. The peak mitogenic response occurs after 4 to 5 d of culture, which is slightly longer than that seen with lectin mitogens. Doses of toxins as low as 100 pgiml will cause significant proliferative response in both CD4’ and CD8’ subpopulations of lymphocytes. Blymphocytes do not respond mitogenically to the exotoxins. The SPEs are also potent T-cell mitogens in rabbits and humans but not in mice.Im The role of monocytes in proliferation induced by TSST-1 and enterotoxins is unknown, although their presence is needed for proliferation to occur. 183-188 IL-1 by itself is not sufficient

to trigger a proliferative response of purified lymphocytes to TSST- 1 in the absence of antigen presenting cells. Is’ This suggests that some contact with antigen presenting cell class I1 molecules or another surface antigen or another monokine, in addition to IL-I production, is necessary for a mitogenic re’ sponse to occur maximally. Calvano et al.’83showed that adherence purified monocytes incubated with TSST-1 for 24 h, washed extensively, and irradiated could mediate a proliferative response when autologous T-cells were added back. This experiment also suggests that monocytes are “processing” and then “presenting” TSST-1 in context with an HLA class LI molecule. Another possibility is that the irradiated monocyte is “leaking” some mediator of mitogenesis. TSST-1 has also been shown to activate the turnover of inositol phospholipids, the mobilization of intracellular calcium, and the translocation of protein kinase C in T-lymphocytes in a manner which resembles the mechanism induced by lectin mitogens. The presence of specific receptors on T-lymphocytes, but not on B-lymphocytes may in part explain the presence or absence of a mitogenic response, respectively. B-lymphocytes and monocytes do not appear to have specific receptors for TSST-I using current technology. There are specific receptors for TSST-1 on Tcells and human epithelial cells. CD4’ cells have been shown to express 27.5 x lo6TSST- 1 receptors per cell while CD8’ cells express 9.0 x 106 receptors per cell. The dissociation constants are 2.58 x M and 1.8 x M , respectively. Human epithelial cells have been shown to express 1 x 104 receptors per cell with dissociation M.The epithelial cell receptors seem to be constant 4 x localized in coated pits. Lymphocytes have also been shown to have receptors for staphylococcal SEs A, B, and C.178.181.’98 Buxser et al.lB1 showed that SEB and SEE inhibited the binding of SEA to its receptor suggesting that the enterotoxins have a common receptor. Schlieven et a1.I’’ showed that binding of SPEs, as measured by inhibition of proliferation, could be inhibited by competing sugars. SPE A binding was inhibited by a-methyl-mannopyranoside, while SPE C could be inhibited by galactose. The binding of all three SPEs could be inhibited by mixed gangliosides and by sialic acid which is a component of gangliosides. These experiments suggest that SPE receptors are gangliosides or glycoproteins and therefore, that the SPEs are lectins. The mitogenic and immunosuppressive functions of TSST1 have been shown indirectly to reside in an internal 14,000 mol wt (14K) cyanogen bromide generated fragment in that monoclonal antibodies generated against TSST- 1 which block these functions, bind the 14K-fragment as shown by Western blot analysis.192These antibodies, however, do not block pyrogenicity and enhancement of susceptibility to endotoxin shock which suggests that these activities reside at either terminus or depend on the three-dimensional structure of the intact molecule. In addition, the 14K-fragment retains residual mitogenic activity despite its relatively high insolubility in biologically

1990

263

Critical Reviews In


compatible solutions. Furthermore, a synthetic decapeptide, corresponding to a segment towards the N-terminus of the 14Kfragment, inhibits the binding of one of the monoclonal antibodies in ELISA and Western analysis.193This peptide also inhibits the monoclonal antibody's ability to block mitogenesis in response to TSST-1. 3. Effects on Monocytes/Macrophages In addition to their effects on T lymphocytes, many of the pyrogenic toxins also act on mononuclear phagocytes and induce the release of IL- 1 and TNF. Exotoxin induced rnonokines may play a role in the pathogenesis of the disease since IL-1 and T N F have both been shown to have multisystem effects.19"'% Human peripheral blood mononuclear cells, adherent human peripheral blood monocytes in the presence of polymyxin B, and thioglycollate elicited rat peritoneal macrophages all produce IL-I when stimulated with TSST1 . 1 8 6 . 1 n 8 . 1 9 7TSST-1 has also been shown to induce TNF-a production by human peripheral blood mononuclear cells. Iw It is not known, however, what role lymphocytes play in the induction of monokines. There is a report in which elumated monocytes produced IL- 1 in response to TSST- 1 loaded liposomes. However, there may have been contaminating lymphocytes as there was no mention of monocyte purity. The concentration of TSST-I needed to induce IL-1 by liposomes is at least 2 logs lower than the concentration needed for soluble TSST- 1. IE7 This is not unexpected since the liposome is phagocytosed, and TSST-1 is delivered directly to the cytoplasm of the cell which may be important since monocytes have not been shown to express specific receptors for TSST-1 as mentioned earlier.

seropositive to TSST-1 even after repeated episodes of the disease.5nTSS patients also have decreased titers to the staphylococcal e n t e r o t o ~ i n sPotential .~~ polyclonal inhibition of immunoglobulin synthesis is indicated by the fact that TSS patients have decreased levels of total serum IgG.205In patients who did develop seropositivity to TSST-1 in this latter study, IgGl and IgG4 levels against TSST-1 were elevated which suggests that these subclasses are important in neutralizing TSST-I. This suppressive effect may be due to toxin stimulated activation of a T-cell subpopulation which results in production of IFN-.I which has been shown to inhibit polyclonal Ig production.*% Enterotoxin A has been shown to stimulate F N production by mouse spleen cells which correlates with the inhibition of immunoglobulin synthesis. 198.202 Interferon production has also been stimulated in human lymphocytes by enterotoxin A.207 The results dealing with immunosuppression, mitogenicity, and production of monokines support the hypothesis that pyrogenic toxins induce a general state of antibody immunosuppression in TSS patients resulting in failure to produce antitoxin antibodies. The early hypothesis that patients who develop TSS have a common immunodeficiency is no longer regarded as true. The importance of protective antibody is shown in that rabbits with systemic immunity to TSST-I are protected against normally lethal combinations of TSST- 1 and endotoxin. 208 Toxin induced immunosuppression also allows growth of opportunistic Gram-negative bacteria, a proposed source of endotoxin in TSS patients.208.209 The finding that TSS patients often have unusual Gram-negative infections supports this idea.

5. Enhancement of Delayed Hypersensitivity Other effects on the immune system by the pyrogenic toxins 4. Immunosuppression have been described. The first is enhancement of delayed type Another effect of the pyrogenic toxins on the immune system is their capacity to nonspecifically suppress the production of hypersensitivity in rabbits that have been given repeated subcutaneous injections of pyrogenic toxin or another sensitizing immunoglobulin, indirectly by stimulating a population of TI y r n p h o c y t e ~Spleen . ~ ~ cells ~ ~ from ~ ~ mice ~ ~ immunized ~ ~ ~ ~ ~ ~ ~agent followed by a challenge dose after 4 to 6 weeks.182,"0 These rabbits develop highly erythematous and edematous skin with SRBC do not secrete immunoglobulin when cultured with reactions that may be explained in terms of an enhanced hynanogram quantities of toxins as measured in a 4-d direct Jerne persensitivity response mediated by nonspecifically activated plaque assay. TSST-1 also inhibits production of all immuT cells of the T, subclass. This effect may in part explain noglobulin classes by pokeweed mitogen stimulated human the rash and mucosal surface reddening in TSS and scarlet peripheral blood cells.z04This suppression is independent of fever illnesses. class 11 antigen restriction in that supernatant fluid from toxin stimulated cells suppresses immunoglobulin production by het6. Alteration of Liver Clearance Function and erologous as well as homologous lymphocytes. Exotoxin must Enhancement of Lethal Endotoxin Shock be added at the beginning of the culture or no inhibitory effect Another effect that TSST-1 bas on the immune system is is seen. In vivo primed T-lymphocytes from mice injected with alteration of the function of the reticuloendothelial system (RES) 1 k g doses of TSST-I will also cause suppression when inafter intravenous exposure to both the exotoxins and endocubated with naive splenocytes and SRBC in the Jeme plaque toxin. 1 6 8 ~ 1 6 9 ~ 1 8 2 ~ 2 0 0 ~ 2 1 1Upon ~z'z injection of both types of toxin, assay. a blockade of RES function was demonstrated by the reduced The inhibition of immunoglobulin production by TSST- 1 ability to clear colloidal carbon or endotoxin. may explain why TSS patients do not make antibody against This is thought to be due to an effect on macrophages, similar the toxin. Cases have occurred in which patients do not become

264

Volume 17, Issue 4


Microbiology endotoxin. Synergistic IL- 1 production occurs when these cells to the mechanism in which the streptococcal pyrogenic exoare pretreated with endotoxin and then stimulated by TSST-I . toxins have been shown to cause a transient decrease in RNA synthesis in Kupffer 7. Inhibition of Pyogenic Response The pyrogenic toxins enhance the susceptibility of rabbits to lethal endotoxin shock by up to ~ O O , O O O - ~ O I ~ ,prob' ~ . ~ ~ * . ~ ' ~TSST-1 producing staphylococci fail to elicit a purulent re' sponse in many TSS cases. Goetz et al. found that TSST-1 ably as a result of alteration of RES clearance function. Rabbits does not directly stimulate neutrophil oxidative metabolism.?'* injected with pyrogenic toxin followed by sublethal doses of Fast et al.'* also found that there is no direct effect of TSSTendotoxin show an initial fever followed by hypothermia, la1 on the chemotactic functions of neutrophils in vilro; rather bored breathing, diarrhea, and finally death. Control rabbits there is an indirect effect of TSST- 1, through stimulation of given exotoxin or endotoxin alone exhibit fever only and do mononuclear phagocytes to release TNF which in turn inhibits not die.z08Rabbits are protected from enhancement to endochemotactic functions. In addition, many TSS isolates fail to toxin shock when immunized with pyrogenic toxin or endomake a hem~lysin,'~ which in our studies is a major factor toxin. Rabbits also show enhanced susceptibility to endogenous leading to inflammation. endotoxin when treated with TSST- 1.209.214 Specific pathogen free rabbits do not die when given TSST-1, but animals that 8. Animal Models are colonized with Pusteurellu multocidu exhibit the same The single or multiple i.v. injection of pyrogenic toxins into symptoms and die when injected with TSST-1. Conventional rabbits can reproduce the symptoms of TSS with the exception rabbits colonized with P. multocidu and treated with polymyxin of rash and desquamation. However, some investigators have B can be protected from the lethal effects of TSST-1. Increased tried to develop a TSS model that more closely simulates the levels of systemic endotoxin have been shown in sera from constant release of toxin that probably occurs during the disconvalescent TSS patients.209Endotoxin levels also increase ease. There are models which utilize chambers to localize viin rabbits given SEB intraven~usly.~'~ able toxin producing ~ t a p h y l o c ~ c c i The . ~ ' ~first - ~of ~ ~these uses The enhancement of endotoxin shock can be blocked by the a perforated polyethylene golf ball implanted subcutaneously. administration of pooled human IgG and methylprednisolone When TSST-1 producing staphylococci are injected into the prior to injection of TSST-1 and endotoxin.z'6 A combination chamber the usual symptoms seen in TSS are observed in of the two can also be given after TSST-1 and endotoxin have contrast to nontoxigenic staphylococci which only induce fever been injected. The protective effect of pooled human IgG can and Rasheed et al.z20used isogenic strains of staphbe explained as a passive immunization since pooled human ylococci in which a TSST-I negative strain was converted to serum has been shown to contain antibodies against both TSSTa TSST-1 positive strain using a bacteriophage containing the 1 and endotoxin. The protective effect of methylprednisolone, TSST-I (rsr) gene. They achieved the same symptoms seen an antiinflammatory agent, is unknown, although it may inwith clinical isolates. volve a membrane stabilizing effect resulting in decreased The second model utilizes a diffusion chamber implanted in endotoxin toxicity. Its protective effect, as a glucocorticoid, the rabbit uterus which allows diffusion of proteins while keepmay also be due to the inhibition of TNF production when ing the bacteria l ~ c a l i z e d . These ~' investigators achieved TSS given prior to toxin administration. Other antiinflammatory symptoms using isogenic pairs of staphylococci, one with the agents such as ibuprofen and indomethacin have no protective tst gene on a plasmid and one toxin negative. Toxin negative effect, suggesting that the products of the cyclooxygenase pathstrains and strains containing the plasmid with the tsr gene way of arachidonic acid metabolism are not involved in the deleted had no effect on the rabbits. lethality even though their involvement in fever is well Another rabbit model utilizes a subcutaneous infusion pump established. to administer TSST-I at a constant rate over 7 d.222A total Another example of enhancement occurs when renal tubular dose of 150 pg reproduced the typical TSS symptoms and was cells are exposed to TSST-1 and e n d o t o ~ i n . Incubation ~'~ of uniformly fatal. It was also observed that concurrent adminrat renal tubular cells with either a ng/ml TSST-1 or 0.1 ng/ istration of polymyxin B did not protect from morbidity or ml endotoxin or lipid A resulted in minimal cytotoxicity. In mortality. contrast, when the renal cells are exposed to TSST-I for 20 min and then to endotoxin, there is a significant degree of IV. FUTURE CONSIDERATIONS cytotoxicity. The lethal effect is blocked by cyclooxygenase inhibitors as well as agents which decrease oxidative metabolism and receptor mediated endocytosis. Based upon the biological activities of the pyrogenic toxins and the symptoms seen in the host, it is possible to construct The secretion of IL-1 can also be enhanced by treatment with both TSST- 1 and endotoxin. 197 Thioglycolate elicited rat at least three overlapping models for disease production. The first of these, as proposed originally by Schlievert and colperitoneal macrophages make IL-1 in response to TSST-1 and

1990

265


Critical Reviews In leagues. is shown in Figure 6 . The other two models differ in that, after induction of either IL- 1 and TNF from macrophages or interleukin 2 and y interferon from T cells by pyrogenic toxins, these latter mono- or lymphokines induce the major symptoms. This is based upon both the induction of cytokines by the toxins and the capacities of the cytokines to induce similar symptoms. Future studies will be done to more clearly establish which of these models, if any, is most correct. Studies are additionally necessary to elucidate the molecular mechanism of action of the toxins. Thus far, studies of the effects of the toxins on T lymphocytes suggest that these proteins may act like hormones in that they may simply bind to the cell surface through interaction with an unknown surface receptor and induce the signals necessary for induction of cell proliferation. No ADP-ribosylating or other enzymatic function has been identified for the toxins. Unlike the toxin effects on T cells, other cells such as Kupffer and renal tubular shown enhanced susceptibility to the lethal effects of endotoxin after preexposure to the pyrogenic toxins. This effect appears to depend on internalization of the exotoxins, and as suggested for the streptococcal toxins, may in part depend on inhibition of RNA synthesis. In renal tubular cells, the final lethal effect appears to result from accumulation of hydrogen peroxide. Studies are presently being done to associate toxin structure with production of biological activities; these should continue into the future and will ultimately depend on determining the three-dimensional structure of the toxins. Such studies should make use of the shared activities of the toxins to help identify conserved regions which may be necessary for activities. Through use of synthetic peptides, toxin fragments, or alteration of toxin structure through site specific mutagenesis, it may be possible to precisely locate structures associated with specific effects. In our laboratory, we have specifically focused on localization of the mitogenic activity of the toxins since the effect is more likely to result from cell surface binding by a toxin domain of limited three-dimensional structure. Also, the toxins nonspecifically suppress B cell function after T-cell mitogenicity, and it may be possible in the future to prepare nonimmunogenic reagents (from the toxins) that could be administered repeatedly to patients who have abnormally high or unregulated B-cell responses, and in this way control their antibody responses. Finally, since the toxins tremendously amplify,,T responses and the T cells affected are functionally activated, the toxins may be useful in augmenting such responses in Tcell deficient patients. We have found thus far that toxin fragments, generated through cyanogen bromide or trypsin cleavage still retain complete mitogenic activity, and are now attempting to further localize the sites by way of synthetic peptides. Several other avenues of future research can be identified including in vivo models to study tampon involvement in TSS

266

,

and genetic regulation of toxin expression. Since the streptococcal toxins predispose the host to quite specific heart damage, studies should be done to determine the role, if any, of the toxins in rheumatic fever. Several indirect lines of evidence suggest there may be a role. The SPEs are made by group A Streptococci only, and rheumatic fever is also restricted to many other streptococcal factors are made group A infections;@' by other groups of streptococci not associated with rheumatic fever. All rheumatogenic streptococci make SPEs, notably type C toxin, and this toxin is the least immunogenic.80Thus, repeated infections with streptococci, considered necessary for development of rheumatic fever, would repeatedly expose the Strong patient to SPE C's heart damage-enhancing acti~ity.'~.'~~ hyaluronidase-producing group A streptococci have not been associated with development of rheumatic fever, and such saains do not make S P E S . Responsiveness ~ of lymphocytes to blastogen A (SPE A) correlates with rheumatic fever. Rheumatic fever is considered to be an autoimmune disease, and nearly all of the SPE effects are on cells of the immune system. Finally, an initial effect of SPEs in the host is to cause suppression of B-cell responses, but once SPEs are removed from the system, amplification of antibody synthesis to other antigens occurs. FEVER

-1 ALTER*TK)N OF L E U K O C m FUNCTON

Endotorin

PVROGENIC TOXIN

CHANGES

RES FUNCTION

I

flGURE 7. Model for h e development of toxic-shock syndrome-lkeillnesses

REFERENCES 1. Todd, J., Fishaut, M., Kapral, F., and Welch, T., Toxic-shock syndrome associated with phage-group1 staphylococci, Loncer. 2, 11 16.

1978. 2. Davis, J. P., Chesney, P. J., Wand, P. J., Laventure, M., and Investigation and Laboratory Team, Toxic-shock syndrome: Epidemiologic features, recurrence, risk factors and prevention, N . Engl. 1. Med.. 303, 1429, 1980. 3. Shands, K. N., Schmid, C. P., Dan, B. B., Blum, D.,Cuidotti,

Volume 17,Issue 4


Microbiology R. J., Hargrett, N. T.. Anderson, R. L., Hill, D. L., Broome, C. V., Band, J. D.,and Fraser, D. W., Toxic-shock syndrome in menstruating women: Its association w i h tampon use and Sraphylococcus aureus and the clinical features of 52 cases, N. Engl. J. Med., 303, 1436. 1980. 4. McKenna, U. G., Meadows, J. A., Brewer, N. S., Wilson, W. P., and Perrault, J., Toxic-shock syndrome. a newly recognized disease entity: Repon of 1 I cases, Mayo Clin. Proc.. 5 5 , 663, 1980. 5. Schlossberg, D., Kandra, J., and Kreiser, J., Possible Kawasaki disease in a 20-year-old woman, Arch. Dennurol.. 115. 1435, 1979. 6. Helms, C. M., Lengeling, R. W., Pinsky, R. L., Meyers, M. G., Koontz, F. K., Klassen, L. W., and Wintermeyer, L. A., Toxicshock syndrome: A retrospective study of 25 cases from Iowa, Am. 1. Med. Sci.. 282, 50, 1981. 7. Chesney, P. J., Davis, J. P., h r d y , W. K., and Chesney, R. W., Clinical manifestatlons of toxic-shock syndrome, JAMA. 246, 741, 1981. 8. Tofte,R. W. and Williams, D. N., Toxic-shock syndrome: Clinical and laboratory features in 15 patients, Ann. Inrern. Med.. 96, 149, 1981. 9. Fisher, R. F., Coodpasture, H. C., Peterie, J. D., and Voth, D. W., Toxic-shock syndrome in menstruating women, Ann. Inrern. Med.. 94. 156, 1981. 10. Tofte, R. W. and Williams, D. N., Clinical and laboratory manifestations of toxic-shock syndrome, Ann. Intern. Med., 96, 843. 1982. 1 1 . Reingold, A. L., Hargrett, N. T., Dan, B. B., Shands, K. M., Strickland, B. Y., and Broome, C. V., Nonmensbual toxic-shock syndrome. A review to 130 cases, Ann. Inrern. Med.. 96, 871, 1982. 12. Davis, J. P., Osterholm, M. T., Helms, C. M., Vergeront, J. M., Wintermeyer, L. A., Forfang, J. C., Judy, L. A., Rondeau, J., Schell, W. L., and the Investigation Team, Tri-state toxic-shock syndrome study. ll. Clinical and laboratory findings, J. Infecr. Dis.. 145, 441. 1982. 13. Davis, J. P., Osterholm, M. T., Helms, C. M., Vergeroot, J. M., Wintermeyer, L. A., Forfang, J. C., Judy, L. A., Rondeau, J., ScheU, W. L., and the Investigation Team, Tri-state toxic shock syndrome study: Evaluation of case definition and prevention of recurrence, Ann. Inrern. Med., 96, 903, 1982. 14. Chesney, P. J., Bergdoll, M. S., Davis, J. P., and Vergeront, J. M., The disease specbum, epidemiology, and etiology of toxicshock syndrome, Ann. Rev. Microbiol.. 38. 315. 1984. 15. Stevens, F. A., l l ~ eoccurrence of Stuphylococcus uureus infection with a scarlatiniform rash, JAMA. 88. 1957. 1927. 16. Aranow, H., Jr. and Wood, W. B., Jr., Staphylococcic infection simulating scarlet fever, JAMA. 119. 1491, 1942. 17. Dunnet, W. B. and Schallibaum, E. M., Scarlet-fever-like illness due to staphylococcal infection, Lancer. 2, 1227. 1960. 18. Feldman, C. A., Staphylococcal scarlet fever, N. Engl. J. Med.. 267. 877, 1962. 19. McClosky, R. V., Scarlet fever and necrotizing vasculitis caused by coagulase-positive hemolytic Sruphylococcw uureus. phage type 85, Ann. Intern. Med., 15, 85, 1973. 20. Garbe, P. L., Arko, R. J., Reingold, A. L., Graves, L. M.,Hayes, P. M., Hightower, A. W., Chandler, F. W., and Broome, C. V., Sraphylococcus aureus isolates from patients with nonmenstrual toxic shock syndrome: Evidence for additional toxins, JAMA. 253. 2538, 1985. 21. Schlievert, P. M., Staphylococcal enterotoxin B and toxic-shock syndrome syndrome toxin-1 are significantly associated with non-mensmal TSS, Lancer. I , 1149, 1986. 22. Crass, B. A. and Bergdoll, M. S., Involvement of staphylococcal enterotoxins in nonmenstrual toxic shock syndrome, J . Clin. Microbiol.. 23, 1138. 1986. 23. McDonald, K. L., Osterholm, M. T., Hedberg, C. W., Schrock,

1990

C. G., Peterson, G . F., Jentzen, J. M., Leonard, S. A., and Schlievert, P. M., Toxic shock syndrome. A newly recognized complication of influenza and influenza-like illness, JAMA. 257, 1053. 1987. 24. Cone, L. A., Woodard, D. R., Schlievert, P. M., and Tomory, G . S., Clinical and bacteriologic obsemations of a toxic shock-like syndrome due to Sfreprococcus pyogenes, N. Engl. J. Med., 3 17, 146. 1987. 25. Altemeier, W. A., Lewis, S. A., Schlievert, P. M., and Bjornson, H. S., Studies of h e staphylococcal causation of toxic-shock syndrome, Surg. Gynecol. Obsrer., 153, 481, 1981. 26. Altemeier, W. A., Lewis, S. A., Schlievert, P. M., Bergdoll, M. S., Bjomson, H. S., S t a n d , J. L., and Crass, B. .4., Sraphylococcus aureus associated with toxic shock syndrome. Phage typing and toxin capability testing, A m . Irucrn. Med., %. 978, 1982. 27. Kreisairth, B. N., Novick, R. P.,Schlievert, P. M., and Bergdoll, M. S., Genetic studies on staphylococcal strains from patients with toxic-shock syndrome, Ann. Inrern. Med.. 96, 974. 1982. 28. Poiodexter, N. J. and Schlievert, P. M., The biochemical and Immunological properties of toxic-shock syndrome toxin-l (TSST-I ) and association with TSS, J. Toxicol. Toxin Rev., 4. I . 1985. 29. Vergeront, J. M., Stolz, S. J., Crass, B. A., Nelson, D. B., Davis, J. P., and Bergdoll, M. S., Prevalence of serum antibody to staphylococcal enterotoxin F among Wisconsin residents: Implications for toxic-shock syndrome, J. Infen. Dis.,148, 692. 1983. 30. Stolz, S. J., Davis, J. P., Vergeront, J. M.,Crass, B. A., Chesney, P. J., Wand, P. J., and Bergdoll, M. S., Development of serum antibody to toxic shock toxin among individuals with toxic-shock syndrome in Wisconsin, 1.Infecr. Dis.. 151, 883, 1985. 3 I . Barbour, A. G., Vaginal isolates of Sruphylococcus uureus associated with toxic-shock syndrome, Infecr. Immun.. 33, 442, 1981. 32. Schlievert, P. M., Osterholm, M. T.,Kelly, J. A., and Nishimura. R. D., Toxin and enzyme characterization of Sruphylococcus aureus isolates from patients with and without toxic-shock syndrome, Ann. Iruern. Med.. 96,937, 1982. 33. Todd, J. K., Fraoco-BurT, A., Lawellin, D. W., and Vasil, M. L.. Phenotypic distinctiveness of Sruphylococcus aurcus strains associated with toxic-shock syndrome, Infecr. Immun.. 45. 339, 1984. 34. Kapml, F. A., Epidermal toxin production by Sraphylococcus uureus strains from patients with toxic-shock syndrome. Ann. Inrern. Med., 96. 972. 1982. 35. Cohen, M. L. and Falkow, S., Protein antigens from SruphylococcLLt aureus strains associated with toxic-shock syndrome, Science, ? I I , 842, 1981. 36. Schlievert, P. M.,Scbocttle, D. J., and Watson, D. W., Punfication and physicochemical and biological characterization of a staphylococcal pymgenic exotoxin, Infecr. Imun., 23, 609. 1979. 37. Schlievert, P. M., Punfication and characterization of staphylococcal pymgenic exotoxin type B, Biochemisrry, 19, 6204. 1980. 38. Osterholm, M. T., Davis, J. P., Gibson, R. W., Mmdel, J. S., Wintermeyer, L. A., Helms, C. M., Forfang, J. C., Rondau, J., Vergeront, J. M., and the Investigation Team, Tri-state toxic-shock syndrome study. I. Epidemiologic findings, J. Infecr. Dis.. 145, 431, 1982. 39. Centen for Disease Control, Follow-up on toxic-shock syndrome, MMWR. 29, 4 4 1 . 1980. 40. Bcrkley, S. F., Hightower, A. W., Broome, C. V., and Reingold, A. L., The relationship of tampon characteristics to menstrual toxic shock syndrome, JAMA. 258, 917, 1987. 41. Schlievert, P. M. and Blomster, D. A., Production of staphylococcal pyrogenic exotoxin type C: Influence of physical and chemical factors. J. Infect. Dis.. 147. 236. 1983. 42. Schlievert, P. M., Blomster, D. A., and Kelly, J. A., Toxic-shock syndrome Sruphylococcus aureus; Effect of tampons on toxic-shock

267

Critical Reviews In syndrome toxin-I production. Obsrer. Gynecol.. 64,666, 1984. 43. Tierno. P. M. and Hanna, B. A., Enzymic hydrolysis of tampon carboxymethylcellulose and toxic shock syndrome, Luncer. I , 1379, 1983. 44. Tierno, P. M., Hanna, B. A., and Davis, M. B., Growth of toxicshock syndrome strain of Sraphylococcus aurela after enzymatic deg-

radation of “Rely” tampon component, hncer, I , 615. 1983. J. J. and Widder, J. S., Hydrolysis of carboxymethylcellulose tampon material, Luncet. I . 1041, 1983. 46. Bonventre, P. F., Carboxymethylcellulose, tampons and staphylococci. Luncet. I . 873, 1983. 47. Mills, J. T., Parsonnet, J., Hickman, R. K., Kendrick, M.,Tsai, Y. C., and Knss, E. H.,Control of production of toxic shock syndrome toxin-1 (TSST-I) by magnesium ion, 1. Infect. Dis., 151. 1158, 1985. 38. Schlievert, P. M., Effect of magnesium on production of toxic shock syndrome toxin- 1 by Staphylococcus aureus, 1. Infect. DIS., 152.6 18,


45. Kirkland,

and Taylor, M. R., Case report: toxic shock syndrome associated with TSST-I producing coagulase-negative staphylococci. Am. J. Med Sci.. 292, 310, 1986. 64. Kreiswirtb, B. N., Schlievert, P. M., and Novick, R. P., Evaluation of coagulase-negative staphylococci for ability to produce toxic shock syndrome toxin 1, 1. Clin. Microbiol.. 25, 2028, 1987 ’ 65. Parsonnet, J., Harrison, A. E., Spencer, S. E., Reading, A., Parsonnet, K. C., and Kass, E. H., Nonproduction of toxic shock syndrome toxin 1 by coagulase-negative staphylococci, J . Clin. Microbiol., 25. 1370, 1987. 66. Schllevert, P. M. and Kelly, J. A., Staphylococcal pyrogenic exotoxin type C. Further characterization, Ann. fnrern. Med.. 96. 982. 1982. 67. Bergdoll, M. S., Crass, B. A., Reiser, R. F., Robbins, R. N., Lee, A. C.-M., Cesney, P. J., Davis, J. P., Veregont, J. M., and Wand,

P. J., An enterotoxin-like protein in Sraphylococcus aureus strains from patients with toxic-shock syndrome, Ann. fnrern. Med., 96,969,

1985.

N., Reiser, R. F., Hebl, G. L., and Bergdoll, M. S., Production of toxic shock syndrome toxin 1 by Staphylococcus aureus as determined by tampon disk-membrane-agar method, 1. Clin. Microbiol., 25, 1446. 1987. 50. Wagner, G., B o b , L., and Wagner, P., Tampon induced changes in vaginal oxygen and carbon dioxide tensions, Am. J. Obsret. Gynecol.. 148. 147. 1984. 51. Kass, E. H., Kendrick, M. I., Tsai, Y.-C., and Parsonnet, J., Interaction of magnesium ion, oxygen tension, and temperature in the production of toxic shock syndrome toxin-I by Sraphylococcusaureus. J. Infect. Dir.. 155, 812. 1987. 52. Todd, J. K., Todd, B. H., Franeo-Buff, A., Smith, C. M., and Lawellio, D. W., Influence of focal growth conditions on the pathogenesis of toxic shock syndrome, J. Infect. Dis.. 155. 673, 1987. 53. Morse, S. A. and Baldwin, J. N., Factors affecting the regulation of staphylococcal enterotoxin B. Infecr. Immun..7, 839, 1973. 54. Houston, C. W. and Ferretti, J. J., Enzyme-linked immunosorbent assay for detection of type A streptococcal exotoxin: kinetics and regulation during growth of Streptococcus pyogenes. Infect. Immun., 33. 49. Robbins, R.

862, 1981. 55. Kim, Y. B., and Watson,

D. W., Streptococcal exotoxins: Biological and pathological properties, in Streptococci and Streptococcal Diseases. W a n n d e r . L. W . and Matsen. J. M.,Eds.. Academic Press, Orlando, FL, 1972, 33. 56. Watson, D. W. and Kim, Y. B., Erythrogenic toxins, in Microbial Toxins, Vol. 3. Montie, T. C.. Kadis, S.. and Ajl, S. J.. Eds.. Academic Press. Orlando, FL, 1970, 173. 57. Schlievert, P. M., Shands, K. N., Dan, B. B., Schmid, G. P., and Nishimura, R. D., Identificarion and characterization of an exotoxin from Sruphylococcus aureus associated with toxic shock syndrome, 1. Infect. Dis.. 143, 509, 1981. 58. Bergdoll, M. S., Crass, B. A., Reiser, R. F., Robbm, R. N., and Davis, J. P., A new staphylococcal enterotoxin, enterotoxin F. associated with toxic-shock-syndrome Staphylococcus aureus isolates. Luncer, I . 1017, 1981. 59. Bonventre, P. F., Weckbach, L., Staneck, J., W e v e r t , P. M., and Thompson, M., Production of staphylococcal enterotoxin F and pyrogenic exotoxin C by Staphylococcus aureus isolates From toxic shock syndrome-associated sources, Infect. Immun.,40, 1023. 1983. 60. Bergdoll, M. S. and Schlievert, P. M., Toxic shock syndrome toxin one, ASM News, 50, 525, 1984. 61. Bergdoll, M. S. and Schlievert, P. M., Toxic shock syndrome toxin, h n c e t . 2. 691. 1984. 62. Crass, B. A. and Bergdoll, M.S.,Involvement of coagulase-negative staphylococci in toxic shock syndrome. J. Clin. Microbiol., 23, 43, 1986. 63. Kahler, R. C., Boy-,

268

J. B., Bergdoll, M. S., Lockwood, W. R.,

1982. 68. Crass, B. A. and Bergdoll, M. S., Toxin involvement in toxic shock syndrome, J . Infecr. Dis., 153, 918, 1986. 69. Bohacb, G. A., Kreiswirth, B. N., Novick, R. P.. and Schlievert, P. M., Analysis of toxic shock syndrome isolates producing staphylococcal enterotoxins B and C1 using southern hybridization and immunological assays, Rev. Infecr. Dis., 1 1 , S75, 1989. 70. Kreiiswirth, B., Rojan, S. J., Schlievert, P. M., and Novick, R.

TSST-I is encoded by a variable genetic element, Rev. Infecr. Dis

,

1 1 , S83. 1989.

R., and Bergdoll, M. S., Staphylococcal toxic shock toxin specifically binds to cultured human epithelial cells and is rapidly internalized, Infect. Immun..4 5 ,

71. Kushnaryov, V. M., MacDonald, H. S., Reiser,

566, 1984. 72. Kushnaryov, V. M., MacDonald, H. S., Reiser, R. F., and Berg-

doll, M. s., Reaction of TSST-I with endothelium of human umbilical cord vein, Rev. Infect. Dis., 1 1 , S282, 1989. 73. Larkin, S. M., Williams, D. N., Osterholrn, M. T., Tone, R. W., and Posplaky, Z., Toxic shock syndrome: clinical, laboratory. and pathologic findings in nine fatal cases, Ann. Intern. Med.. 96, 858,

1982. 74. Beisel, W. R., Pathophysiology of staphylococcal enterotoxin. type

75. 76.

77.

78.

79.

80.

B, (SEB) toxemia after the intravenous administration to monkeys, Toxicon, 10, 433, 1972. Dick, G. F. and Dick, G. H., A skin test for susceptibility to scarlet fever, JAMA, 82, 265, 1924. Hooker, S. B. and Follensby, E. M., Studies on scarlet fever 11. Different toxins produced by hemolytic streptococci of scarlarind origin, 1. Immunol., 27, 177, 1934. Stock, A. H. and Lynn, R. J., Preparation and properties of partially purified erythrogenic toxin B of group A streptococci. J . Immunol.. 86, 561. 1961. Watson, D. W., Host-parasite factors in group A streptococcal infections. Pymgenic and other effects of immunologic distinct exotoxins related to scarlet fever toxins, J . Exp. Med., 1 I I , 1960. Willoughby, R. and Creenberg, R. N., The toxic shock syndrome and streptococcal pyrogenic exotoxins. Ann. Intern. Med.. 98, 559, 1983. Schlievert, P. M., Bettin, K. M., and Watson, D. W., Production of pyrogenic exotoxin by groups of streptococci: association with group A, 1. Infecr. Dis. 140. 676. 1979. Collier, R. J., Diphteria toxin: mode of action and sfn~cture,Bacreriol. Rev., 39. 54, 1975. Finklestein, R. A., Cholera, CRC Crit. Rev. Microbiol., 2. 533, 1973 Blomster-Hautnmaa, D. A., Kreiswirth, B. N., Novick, R. P., and Schlievert, P. M., Resolutioa of highly purified toxic-shock syndrome toxin 1 into two distinct proteins by isoelectric focusing. Biochemistry. I

8 1. 82. 83.

Volume 17, Issue 4

Microbiology 25, 54, 1986. 84. Reiser, R. F., Robbins, R. N., Khoe, G. P., and Bergdoll, M. S.,

Purification and physicochemical properties of toxic-shock toxin, Bioc h e m i s p . 22, 3907, 1983. 85. Notermam, S. and Dufreme, J. D., A simple purification method for enterotoxin F produced by Sraphylococcus aureus and some properties of the toxin, Anron Van Leeuwenhoek. J . Microbiol. Serol., 48, 447, 1981. 86. Igarashi, H., Fujikawa, H., Usami, H.,Kawabata, A., and Morita,

T., Purification and characterization of Sraphylococcus aureus FRI 1169 and 587 toxic shock syndrome exotoxins. fnfecr. fmmun.,44. 175, 1984. 87. Blomter-Hautamaa, D. A., Kreiswirth, B. N., Kornblum, J. S.,


Novick, R. P., and Schlievert, P. M., The nucleotidc and panial amino acid sequence of toxic shock syndrome toxin- 1, J. Biol. Chem., 261, 15783, 1986. 88. Schantz, E. J., Rwssler, W. G., Wagman, J., Spero, L., Dunnery,

D. A., and Bergdoll, M. S., Punfication of staphylococcal enterotoxin B. Biochemisrry, 4. 1011, 1965. 89. Borja, C. R. and Bergdoll, M. S., Purification and characterization of enterotoxin C produced by Sraphylococcus aureus strain 137. Biochemistry, 6. 1467. 1967. 90. Bohach, G. A. and Schlievert, P. M., Expression of staphylococcal enterotoxin C1 in Escherichia coli. Infect. Immun., 5 5 , 428, 1987. 91. Malconian, A. K., Randrois, J. P., and Fleurette, J., Modified method for production and purification of Sraphylococcus aureus enterotoxin B, Appl. Environ. Microbiol.. 45, 1140, 1983. 92. Ende, I. A., Terplan, G., Kickhofen, B., and Hammer, D. K., Chromatofocusing: a new method for purification of staphylococcal enterotoxins B and C1, Appl. Environ. Microbiol., 46. 1323. 1983. 93. Huang, I.-Y. and Bergdoll, M. S., The primary structure of staphylococcal enterotoxin B. III. The cyanogen bromide peptidcs of reduced and aminoethylated enterntoxin B, and the complete amino acid sequence, J . Biol. Chem.. 245. 3518. 1970. 94. Schmidt, J. J. and Spero, L., The complete amino acid sequence of staphylococcal enterotoxin CI. J . Biol. Chem., 258, 6300, 1983. 95. Jones, C. L. and Khan, S. A., Nucleotide sequence of the entcrotoxin B gene from Sraphylococcus aureus. 1. Bacreriol.. 166, 29, 1986. 96. Bohach, G. A. and Schlievert, P. M., Nucleotide sequence of the staphylococcal enterotoxin C1 gene and relatedness to other pyrogenic toxins, Mol. Gen. Genet., 209, 15, 1987. 97. Tweten, R. K. and Iandalo, J. J., Punfication and partial characterization of a putative precursor to staphylococcal enterotoxin B. fnfecr. Immun.. 34, 900, 1981. 98. Baird-Parker, A. C. and Joseph, R. L., Fractionation of staphylococcal enterotoxin B, Narure. 202. 570. 1964. 99. Chang, P. C. and Dickie, N., Fractionation of staphylococcal enterotoxin B by iscelectric focusing. Biochim. Biophys. Acra, 236, 367, 1971. 100. Spero, L., Waken, J.

R.,and Metzger, J. F., Microheterogeneity of staphylococcal enterotoxin B. Biochim. Biophys. Acra. 336. 79.

1974. 101. Metzger, J. F., Johnson,A. D., and Spero, L., Intrinsic and chem-

structure and acuvity of staphylococcal enterotoxin C. J Blol. Chem., 251. 5580, 1976. 105. Thompson, N. E., Ketterhagen,

M.J., and Bergdoll, M. S., Monoclonal antibodies to staphylococcal enterotoxins B and C. Cross-reactlvity and localization ofepitopes on trypuc fragments, Infecr. Immun.,

45, 281. 1984.

106. h, Y. B. and Watson, D. W., A punfied group A streptococcal pyrogenic exotoxin. Physicochemical and biological properties including the enhancement of susceptibility to endotoxin shock. J. Exp. .Wed., 131. 611, 1970. 107. Cunningham, C. M., Bmumian, E. L., and Watson, D. W., Further purificahon of group A streptococcal pyrogenic exotoxin and characterization of the purified toxm. Infecr. Immun.. 14, 767, 1976. 108. Schlievert, P. M., Bettin, K. M., and Watson, D. W., Punficaoon and characterization of group A streptococcal pyrogenic exotoxin type C, fnfecr. fmmun.,16, 673, 1977. 109. Gerlach, D., Knoll, H., and Kohler, W., Purification and charac-

terization of erythrogenic toxins. I. Investigation of e m g e n i c toxin A produced by Srreprococcus pyogenes main NY-5. Zbl. Bakr H y g . I. Abr. Orig.. A247, 177, 1980.

1 10. Nauciel, C., Rapmud, M., and Bizzini, B., Punficaoon et properues de la toxinc erythrogene du strcptocoquc. Ann. fnsr. Pasreur Paris. 114. 796, 1%8. 111. Naudel, C., BLPcs, J., Mangab, R., and Raynnud, M., Evidence for two molecular forms of streptococcal erythrogcnic toxin. Conversion to a single form by 2-mercaptoethanol, E w . J , Biochem., 1 1 , 160,1969. 112. Weeks, C. R. and Ferretti, J. J., Nucleotide sequence of the type A streptococcal exotoxin (erythrogenic toxin) gene from Srreprococcus pyogenes bacteriophage T12. fnfecr. Immun.. 52. 144. 1986. 113. Johnson, L. P., L’Italien, J. L., and Schlievert, P. M., Streptococcal pyrogenic exotoxin type A (scarlet fever toxin) is related to Sraphylococcus aureus enterotoxin B. Mol. Gen. Genet.. 203, 354. 1986. 114. Bnrsumian, E. L., Cunningham, C. M., Schlievert, P. M. and Watson, D. W., Heterogeneity of group A streptococcal pyrogenic exotoxin type B, fnfecr. fmmun., 20. 512. 1978. 115. Bohach, G. A., Hauser, A. R., and Schlievert, P. M., Cloning of

the gene, speB, for streptococcal pyrogenic exotoxin type B in Escherichia coli. fnfecr. Immun.. 56, 1665. 1988. 116. Goshorn, S. C. and Schlievert, P. M., Nuclcotide sequence of streptococcal pyrogenic exotoxin type C, fnfecr. fmmun., 56, 2518, 1988. 117. Betley, M.J. and Mekalanos. J. J., Nucleotide sequence of the type A staphylococcal enterotoxin gene, 1.Bacreriol.. 170. 34, 1988. 118. Bergdoll, M. S., Borja, C. R., Robbins, R. N., and Weiss, K. F., Identification of enterotoxin E, Infecr. Immun.. 4, 593, 1971. 119. Avena, R. M. and Bergdoll, M. S., Purification and some physicochemical properties of enterotoxin c, Sraphylococcus aureus stmn 361, Biochemisrry. 6. 1474, 1967. 120. Reiser, R. F., Robbins, R. N., Noleto, A. L., Khw, G. P., and Bergdoll, M. S., Identification. purification, and some physicochemical properties of staphylococcal enterotoxin C3. fnfecr. fmmun.. 45. 625, 1984. 121. Lee, A. C.-M., Robbins, R. N., Reiser. R. F., and Bergdoll, M. S., Isolation of specific and common antibodies to staphylococcal enterotoxins B. C1 and C2. fnfecr. fmmun.,27, 431. 1980. 122. Hynes, W. L., Weeks, C. R., Iandolo, J. J., and Ferretti, J. J., Immunologic cross-reactivity of type A streptococcal exotoxin (erythrogenic toxin) and staphylococcal enterotoxins B and CI, Infecr. fmmun., 55. 837. 1987. 123. Spero, L., Morlock, B. A., and Metzger, J. F., On the crossreactivity of staphylococcal enterotoxins A. B, and C1, J. fmmunol.. 120, 86, 1978.

ically produced microheterogeneity of Sraphylococcus aureus enterotoxin type C , fnfecr. fmmun., 12, 93, 1975. 102. Borja, C. R. and Bergdoll, M. S., Staphylococcal enterotoxin C. Il. Some physical, immunological, and toxic properties, Biochemisrq, 8. 75, 1969. 103. Spero, L., Warren, J. R., and Metzger, J. F., Effect of single peptide bond scission by trypsin on the structure and activity of staphylococcal enterotoxin B, J . Biol. Chem.. 248. 7289, 1973. 104. Spero, L., Griffin, B. Y., Middlebrook, J. L., and Metzger, J. F., Effect of single and double peptide bond scission by trypsin on the

1990

269


Critical Reviews In 124. Spero, L. and Morlock, B. A., Cross-reactions between tryptic polypeptides of staphylococcal enterotoxins B and CI. 1.Immunol.. 122. 1285, 1979 125. Spero, L. and Morlock, B. A., Biological activities of the peptides of staphylococcal enterotoxin C formed by limited tryptic hydrolysis, J. Biol. Chem.. 253, 8787. 1978. 126. Spero, L., Meager, J. F., Warren, J. R., and Griffin, B. Y., Biological activity and complementation of the two peptides of staphylococcal enterotoxin B formed by limited cryptic hydrolysis, J. Biol. Chem , 250, 5026. 1975. 127. Bohach, G. A., Hovde, C. J., Handley, J. P., and Schlievert, P. M., Cross-neutralization of staphylococcal and streptococcal pyrogenic toxins by monoclonal and polyclonal antibodies, Infect. Immun., 56. 400. 1988. 128. Schutzer, S. E., Fischetti, V. A., and Zabriskie, J. B., Toxic shock syndrome and lysogeny in Staphylococcus aureus, Science. 220. 316, 1983. 129. Kreiswirth, B. N., Lofdahl, S., Betley, M. J., O’Reilly, M., Schlievert, P. M., Bergdoll, M. S., and Novick, R. P., The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage, Nature, 305, 709, 1983. 130. Horinouchi, S. and Weisblum, B., Nucleotide sequence and functional map of pE194, a plasmid that specifies inducible resistance to macrolide. Iincosamide. and streptogramin type B antibiotics, J . Bacteriol., 150. 804. 1982. I3 I . Kreiswirth, B. N., Handley, J. P., Schlievert, P. M., and Novick, R. P., Cloning and expression of streptococcal pyrogenic exotoxin A and staphylococcal toxic shock syndrome toxin- I in Bacillus subtilis. Mol. Gen. Genet., 208. 84, 1987. 132. Okubo, S., Yansgida, T., Fujita, D. J., Ohlsson-Wiilhelm, B. M., The genetics of bacteriophage SPOI. Biken J . . 15, 81, 1972. 133. Chu, M. C., Melish, M. E., and James, J. F., Tryptophan auxotypy associated with Sraphylococcur aureus that produce toxic-shock syndrome toxin. J . Infecr. Dis.. 151, 1157. 1985. 134. Reoei, P., Kreiswirth, B., O’Reilly, M.,Schlievert, P.,Gruss, A., and Novick, R. P., Regulation of exoprotein gene expression by agr. in The Staphylococci. Jeljaszewicz, J.. Ed., Zbl. Bakt. Suppl. 14. 1985. 701. 135. Recsei, P.,Kreiswirth, B., O’Reilly, M., Schlievert, P. M., Gruss, A., and Novick, R. P.,Regulation of exoprotein gene expression in Staphylococcus aureus by agr. Mol. Gen. Genet.. 202, 58, 1986. 136. Janzon, L., Lofdahl, S., and Arvidson, S., Evidence for a coordinate transcriptional control of a alpha-toxin and protein A in Staphylococcus aureus. FEMS Microbiol. Lcrr.. 33, 193. 1986. 137. Morfeldt, E., Janzon, L., Arvidson, S., and Lofdahl, S., Cloning of a chromosomal locus (exp) which regulates the expression of several exoprotein genes in Sraphylococcus aureus. Mol Gen. Genet., 21 1, 435. 1988. 138. Betley, M. J., Lofdahl, S., Kreiswirth, B. N., Bergdoll, M. S., and Novick, R. P., Staphylococcal enterotoxin A gene is associated with a variable genetic element, Proc. Natl. Acad. Sci., 81, 5179. 1984. 139. BetJey, M. J. and Mekalanos, J. J., Staphylococcal enterotoxin A is encoded by phage, Science. 229. 185. 1985. 140. Bazles, K. W. and Iandolo, J., The cloning and expression of staphylococcal enterotoxin D from Sraphylococcus aureus 485, Absrr. Annu. Meer. Am. SOC. Microbiol.. B187, 56. 1987. 141. Novick, R. P., Khan, S. A., Murphy, E., Iordanescu, I., Edelman, J., Krolewski. J., and Rush, M., Hitchhiking transposons and other mobile genetic elements and site-specific recombination systems in staphylococci. Cold Spring Harbor Symp. Quanf. Biol., 45. 67. 1980. 142. Dornbusch, K., Genetic aspects of methicillin resistance and toxin production in a strain of Staphylococcus aureus. Ann. N . Y . Acad. Sci.. 182. 91, 1971.

270

143. Shalita, Z., Hertman. I., and Sarid, S., Isolation and characterizatlon of a plasmid involved with enterotoxin B production in Staphylococcus aureus. J . Bacreriol.. 129. 317. 1977. 144. Shafer. W. M. and Iandolo. J. J.. Chromosomal locus for staphylococcal enrerotoxin B. Infect. Immun., 20, 273, I978 145. Shafer, W. M. and Iandolo, J. J., Genetics of staphylococcal en’ terotoxin B in methicillin-resistant isolates of Sraph,vlococcus aureus. Infecr. Immun.. 25, 902, 1979. 146. Dyer, D. W. and Iandolo, J. J., Plasmid-chromosomal transition of genes important in staphylococcal enterotoxin B expression, Infect. Immun.. 33, 450, 1981. 147. Khan, S. A. and Novick, R. P.,Structural analysis of plasmid pSN2 inStaphylococcus aureus: No involvement in enterotoxin B production. J. Bacreriol.. 149, 642. 1982. 148. Ranelli, D. M., Jones, C. L., Johns, M. B., Mussey, G. J., and Khan, S. A., Molecular cloning of staphylococcal enterotoxin B gene in Escherichia coli and Staphylococcus aureus. Proc. :Vatl. Acad. Scr., 82. 5850, 1985. 149. Altboum, Z., Hertman. I., and Sarid, S., Penicillinase plasmidlinked genetic determinants for enterotoxins B and CI production In Staphylococcus aureus. Infect. Immun..47. 5 14. 1985. 150. Morse, S. A., Mah, R. A., and Dobrogosz, W. J.. Regulation of staphylococcal enterotoxin B. 1.Bacreriol.. 98. 4, 1969. 151. Iandolo, J. J. and Shafer, W. M., Regulation of staphylococcal enterotoxin B, Infecr. Immun.. 16. 610, 1977. 152. Bohach, G. A. and Schlievert, P. M., unpublished observations. 153. Oskowian, B. and Stewart, G . C., Cloning and characterization of the repressor gene of the Sraphylococcus aureus lactose operon. 1. Bacreriol., 169. 5459, 1987. 154. Frobisher, M. and Brown, J. H., Transmissible toxigenicity of streptococci. Bull. Johns Hopkins Hosp.. 4 1. 167. 1927. 155. Zabriskk, J. B., The role of temperate bacteriophage in the production of erythrogenic toxin by group A streptococci. J. Exp. Med.. 119. 761. 1964. 156. Nida, S. K., Houston, C. W., and Ferretti, J. J., Erythrogenic toxin production by group A streptococci, in Pathogenic Srreprococci. Parker, M. T.,Ed., Reedbooks. Chensey. Surrey. England, 1979. 66. 157. Johnson, L. P., Schlievert, P. M., and Watson, D. W., Transfer of group A streptococcal pyrogenic exotoxin production to nontoxigenic strains by lysogenic conversion, Infect. Immun.. 28. 254, 1980. 158. McKane, L. and Ferretti, J. J., Phage-host interactions and the production of type A streptococcal exotoxin in group A streptococci. Infecr. Immun..34. 915, 1981. 159. Nida. S. K. and Ferretti, J. J., Phage influence on the synthesis of extracellular toxins in group A streptococci, Infecr. Immun.. 36. 745. 1982. 160. Johnson, L. P. and Schlievert, P. M., A physical map of the group A streptococcal pyrogenic exotoxin bacteriophage TI2 genome, Mol. Gen. Gener., 189, 251, 1983. 161. Johnson, L. P. and Schlievert, P. M., Group A sueptococcal phage TI2 carries the structural gene for pyrogenic exotoxin type A , Mol. Gen. Gener., 194. 52, 1984. 162. Weeks, C. R. and Ferretti, J. J., The gene for type .4 streptococcal exotoxin (erythrogenic toxin) is located in bacteriophage TI 2 , Infecr. Immun., 46, 531, 1984. 163. Johnson, L. P.,Tomai, M. A., and Schlievert, P. M., Bacteriophage involvement in group A streptococcal pyrogenic exotoxin A production. J . Bacreriol.. 166, 623, 1986. 164. Laird, W. and Groman, N., Orientation of the tox gene in the prophage of corynebacteriophage beta, J . Virol.. 19, 228. 1976. 165. Goshorn, S. C., Bohach, G . A., and Schlievert, P. M., Cloning and characterization of the gene, s p e c , for pyrogenic exotoxin type C from Streptococcus pyogenes. Mol. Gen. Gener.. 212. 66. 1988. 166. Bohach, G. A. and Schlievert, P. M., unpublished observations.

Volume 17, Issue 4

Microbiology 167. Colon-Whitt, A., Whitt, R. S., and Cole, R. M., Production of an erythrogenic toxin (streptococcal pyrogenic exotoxin) by a nonlysoin Parhogcnic Streprococci. Reedgenized group A st~~ptococcus, books, England. 1979. 64. 168. Schlievert, P. M. and Watson, D. W., Group A streptococcal pyr-

ogenic exotoxin: Pyrogenicity. alteration of blood-brain bamer, and separation of sites for pyrogenicity; and enhancement of lethal cndotoxin shock. Infect. Immun.,21, 753, 1978. 169. Schlievert, P. M. and Watson, D. W., Biogenic m i n e involvement in pyrogenicity and enhancement of lethal endotoxin shock by group A streptococcal pyrogenic exotoxin, Proc. SOC.Exp. Biol. Med., 162,


269. 1979. 170. Clark, W. G. and Borison, H. L., F’yrogenic effect of purified staphylococcal enterotoxin. J . Pharmacol. Exp. Ther.. 142. 237, 1963. 171. Brunson, K. W. and Watson, D. W., Pyrogenic specificity of strep-

tococcal exotoxins. staphylococcal enterotoxin and gram-negative endotoxin. Infect. Immun..10, 347, 1974. 172. Dinarello, C. A. and Wolff, S. M., Molecular basis of fever in humans, Am. J. Med.. 72, 799, 1982. 173. Dinarello, C. A., Cannon, J. G . , Wolff, S. M., Bernheim, H. A., Beutler, B., Cerami, A., Figori, I. S., Palladino, M. A., and O’Connor, J. V., Tumor necrosis factor (cachectin)is an endogenous pyrogen and induces production of interleukin I , J . Exp. Med., 163, 1433, 1986. 174. Schlievert, P. M., Bettin, K. M., and Watson, D. W., Effect of antipyretics on group A streptococcal pyrogcnic exotoxin fever pro-

togenic response of human, munne. and rabbit lymphocytes. J. Infect. Dis.. 151, 65. 1985. 186. Parsonnet, J., Hickman, R. K., Eardley, D. D., and Pier, G. B., Induction of human interlcukin-1 by toxic-shock syndrome toxin- I , J , Infccr. Dis.. 151. 514. 1985. 187. Koff, W. C., Cerny, E. H., Reeves, M. W., and Lachman, L. B., Inerleuk~n-I released by liposorne-encapsulated macrophage activaton, The Physiologic. Metabolic, and Immunologic .4Cnotu of Interleukin-I. Alan R. Liss, New York. 1985. 309. 188. Pusonnet, J., Gillis, Z. A., and Pier, G. B., Induction of interleulunI by S-S of Staphylococcus aureus from patients with nonmcnsmal toxic shock syndrome, 1.Infecr. Dis., 154. 5 5 . 1986. 189. Chatila, T., Wood, N., Parsonnet, J., and Geha, R. S., Toxic shock syndrome toxin- 1 induces inositol phospholipid turnover, protein kinase C mslocation, and calcium mobifization in human T lymphocytes, J. Immunol., 140, 1250. 1988. 190. Poindexter, N. J. and Schlievert, P. M., Binding of toxic-shocksyndrome toxin-1 to human peripheral blood mononuclear cells, J Infect. Dis.. 156. 122. 1987. 191. Schlievert, P. M., Schoettle, D. J., and Watson, D. W.. Ganglioside and monosaccharide inhibition of nonspecific lymphocyte mitogcnicity by group A streptococcal pyrogenic cxotoxins. Infect. Immun.. 27, 276, 1980. 192. Blomster-Hautamaa, D. A., Novick, R. P., and Schlievert, P. M., Localization of biologic functions of toxic shock syndrome toxin-] by

use of monoclonal antibodies and cyanogcn brormde-generated fragments, J. Immwol., 137, 3572. 1986. 193. Murphy, B. G., Kreiiswirth, B. N., Novick, R. P., and Schlievert, P. M., Localization of a biologically important epitope on toxic-shocksyndrome toxin-]. J . Infecr. Dis.. 158, 549, 1988. 194. Dinarello, C. A., Biology of interleukin-I, Fascb Jr., 2, 108. 1988 195. Beutler, B. A., Milsark, I. W., and Cerami, A., Cachecriniturnor necrosis factor: production. distribution, and metabolic fate in vivo. J. Immunol.. 135. 3972. 1985. 196. Tracey, K. J., Lowry, S. F., Fahey, T. J., III, Albert, J. D., Fong, Y., Hessc, D., Beutler, B., Manogue, K. R., Calvaoo, S., Wei, H.,Cerami, A., and Shires, G. T., Cachectin/tumor necrosis factor induces lethal shock and stress hormone responses in the dog. Surg. Gynrcol. Obstct.. 164. 415. 1987. 197. Beuhold, D. H., Best, G. K., Bonventre, P. F., and Thompson, M., Synergistic induction of Interleukin-I by endotoxin and toxic shock syndrome toxin-1 using rat macrophages, Infect. Immun..55. 2865.

duction and ability to enhance lethal endotoxin shock. Proc. SOC.E r p . Biol. Med.. 157. 472, 1977. 175. Schlievert, P. M., Schoettle, D. J., and Watson, D. W., Nonspecific T-lymphocyte mitogenesis by pyrogenic cxotoxins from group A streptococci and Sraphylococcus aureus. Infect. Immun., 25, 1075, 1979. 176. Regehann, W. E., Gray, E. D., and Wannamaker, L. W., Characterization of the human cellular immune response to purified group A streptococcal blastogen A, J. Immunol., 128. 1631. 1982. 177. Peavey, D. L., Adler, W. H., and Smith, R. T., The mitogenic effects of endotoxin and staphylococcal entcrotoxin B on mouse spleen cells and human peripheral lymphocytes, 1. Immunol.. 105. 1453. 1970. 178. Warren, J.

R., Leatherman, D. L., and Metzger, J. F.. Evidence for cell-receptor activity in lymphocyte stimulation of staphylococcal infection, J. Immunol., 115, 49, 1975. 179. Johnson, H. M., Stanton. G. J., and Baron, S., Relative ability of mitogens to stimulate production of interferon by lymphoid cells and to induce suppression of the in virro immune response. Proc. SOC. Exp. Biol. Med., 154. 138. 1977. 180. Barsumian, E. L., Schlievert, P. M., and Watson, D. W., Nonspecific and specific mitogenicity by group A streptococcal pyrogenic exotoxins. Infect. Immun.,22, 681, 1978. 18 I . Buxser, S., Bonventre, P. F., and Archer, D. L., Specific receptor binding of staphylococcal enterotoxins by rnurine splenic lymphocytes. Infect. Immun.,33, 827, 1981. 182. Schlievert, P. M., Alteration of immune function by staphylococcal pyrogenic exotoxin C: possible role in toxic-shock-syndrome. J . Infect. Dis.. 147. 391, 1983. 183. Calvano, S. E., Quimby, F. W., Antonacci, A. C., Reiser, R. F., Bergdoll, M. S., and Dineen, P., Analysis of the mitogenic effects of toxic shock toxin on human peripheral blood mononuclear cells m wrro. Clin. Immunol. Immunoparhol., 33, 99, 1984. 184. Ikejima, T., Dinarello, C. A., Gill, D. M., and Wolff, S. M., Induction of human interleulun- I by a product of Staphylococcus aureus associated with toxic shock syndrome, 1. Clin. Invesr., 73, 1312. 1984. 185. Poindexter, N. J. and Schlievert, P. M., Toxic-shock syndrome toxin-l induced proliferation of lymphocytes: comparison of the mi-

1987. 198. Ezepchuck,

Y. V., Noskova, V. P., Aspetov, R. D., Novolchatsky. A. S., and Noskov, A. N., Binding of staphylococcal enterotoxin A (SEA) with human splenic lymphocytes. Infect. Immun.. IS. 285.

1983. 199. Fast, D. J., Schllevert, P. M., and Nelson, R. D., Non-purulent response to toxic shock syndrome toxin- 1 producing Staphylococcus

aureus: relationship to toxin-stimulated production of tumor necrosis factor. J. I m u n o l . , 140. 949. 1988. 200. Cunninghnm, C. M. and Watson, D. W., Alteration of clearance function by group A streptococcal pyrogenic exotoxin and its relation to suppression of the antibody response, Infect. Immun.. 19. 51. 1978. 201. Cunnlngham, C. M. and Watson, D. W., Suppression of the antibody response by group A streptococcal pyrogenic exotoxin and characterization of the cells involved, Infecr. Immun.,19. 470. 1978. 202. Smith, B. G. and Johnson, H. M., The effect of staphylococcal entcrotoxins on the primary in vitro immune response. J. Imrnunol , 115, 575, 1975. 203. Schlievert, P. M., Activation of murinc T-suppressor lymphocytes by group A streptococcal and staphylococcal pyrogenic exotoxins. Infecr. Immun.,28. 876, 1980.

1990

271


Critical Reviews In 204. Poindexter, N. J. and Schlievert, P. M., Suppression of immunoglobulin-secreting cells from human peripheral blood by toxic-shocksyndrome toxin-I, J. fnfecr. Dis.. 153, 772. 1986. 205. Christensson, B., Johansson, P. J. H., and Oxelius, V.-A., Imbalanced Semm IgG subclass pattern in toxic shock syndrome patients: deficiency of specific IgG1 and IgG4 subclass antibodies to toxic shock syndrome toxin-1, Clin. Exp. Immunol.. 66, 443, 1986. 206. Finkelman, F. D., Katona, 1. M., Musmann, T. R., and Coffman, R. L., IFN-regulates the isotypes of Ig secreted during in vivo humoral immune responses, 1. Immunol., 140, 1022. 1988. 207. Langford, M. P., Stanton, C. J., and Johnson, H. M., Biological effects of staphylococcal enterotoxin A on human peripheral lymphocytes. Infect. fmmun.. 22. 62. 1978. 208. Schlievert, P. M., Enhancement of host susceptibility to lethal endotoxin shock by staphylococcal pyrogenic exotoxin type C,Infecr. Immun., 36, 123. 1982. 209. Stone, R. L. and Schlievert, P. M., Evidence for involvement of endotoxin in toxic shock syndrome, J. Infect. Dis.,155, 682, 1987. 210. Schlievert, P. M., Bettin, K. M., and Watson, D. W., Reinterpretation of the Dick test: role of group A streptococcal pyrogenic exotoxins, fnfecr. Immun.. 26, 467, 1979. 21 I . Fujikawa, H., Igarashi, H., Usami, H., Tanaka, S., and Tamura, H., Clearance of endotoxin from blood of rabbits injected with staphylococcal toxic shock syndrome toxin-I, Infect. Immun.. 52. 134. 1986. 212. Schlievert, P. M., Bettin, K. M., and Watson, D. W., Inhibition of ribonucleic acid synthesis by group A streptococcal pyrogenic exotoxin, fnfecr. fmmun.. 27, 542, 1980. 213. Sugiyama, H.,McKissic, E. M., Bergdoll, M. S., and Heller, B., Enhancement of bacterial endotoxin lethality by staphylococcal enterotoxin, 1.Infecr. Dis.. 1 14, I 1 I , 1964. 214. de Azavedo, J. C. S. and Arbuthnott, J. P., Toxicity of staphylococcal toxic shock syndrome toxin-l in rabbits, fnfecr. fmmun.. 46, 314. 1984. 215. Pettit, G. W., Elwell, M. R., and Jahrling, P. B., Possible endctoxemia in rabbits after intravenous injection of Sraphylococcus aureus enterotoxin B. 1. Infect. Dis.. 135, 646. 1977. 216. Peterson, P. K., Schlievert, P. M., Conroy, W., Kelly, J. A., Spika, V., and Quie, P. G., Protection against staphylococcal pyrogenic exotoxin C enhanced endotoxin lethality with methyl prednisolone and immunoglobulin G, 1. fnfecr. Dis., 147. 358, 1983. 217. Keane, W. F., Gekker, G., Schlievert, P. M., and Peterson, P. K., Enhancement of endotoxin-induced isolated renal tubular cell injury by toxic-shock syndrome toxin-I, Am. 1. Parhol.. 122, 169, 1986. 218. Goetz, M. B., Proctor, R. A., Reiser, R. F., and Bergdoll, M. S., Effects of Staphylococcus aureus enterotoxin F on human neutrophil metabolism, J . fnfecr. Dis.. 148. 674, 1983. 219. Arko, R. J., Rasheed, J. K., Brwmc, C. V., Chandler, F. W., and Paris, A. L., A rabbit model of toxic shock syndrome: Clinicopathological features, J. Infect. Dis.. 8, 205, 1984. 220. Rasheed, J. K., Arko, R. J., Feeley, J. C., Chandler, F. W., Thornsberry, C., Gibson, R. J., Cohen, M. L., Jeffries, C. D., and Brwme, C. V., Acquired ability of Staphylococcus aureus to produce toxic shock-associated protein and resulting illness in a rabbit model, fnfecr. fmmun.,41, 598, 1985. 221. de Azavedo, J. C. S., Foster, T. J., Hartigan, P. J., Arbuthnott, J. P., O’Reilly, M.,Kreiswirth, B. N., and Novick, R. P., Expression of the cloned toxic shock syndrome toxin 1 gene (rsr) in vivo with a rabbit uterine model, Infect. Immun., 50. 304, 1985. 222. Parsonnet, J., Gillis, Z. A., Richter, A. G., and Pier, G. B., A rabbit model of toxic shock syndrome that uses a constant, subcutaneous infusion of toxic shock syndrome toxin I . fnfecr. fmmun., 55, 1070. 1987.

272

223. Bohach, G. A., Handley, J. P., and Schlievert. P. M., Blologlcal and immunological properties of the carboxyl terminus of staphylococcal enterotoxin CI. fnfecr. fmmun.. 57, 23, 1989. 224. Stevens, D. L., Tanner, M. H., Winship, J., Swarts, R., Ries. K. M., Schlievert, P. M., and Kaplan, E., Reappearance of scarlet fever toxin A among streptococci in the Rocky Mountain West: Association with tissue invasion and the toxic-shock-like syndrome, N Engl. J. Med.. 321. I , 1989.

Volume 17, Issue 4

Streptococcal Toxic Shock syndrome.

Pediatric streptococcal toxic shock syndrome.

Streptococcal toxic shock syndrome following total thyroidectomy.

[Staphylococcal toxic shock syndrome after breast surgery].

Group A beta-hemolytic streptococcal toxic shock-like syndrome.

Streptococcal toxic shock syndrome complicating a peritonsillar abscess.

Symmetrical Peripheral Gangrene complicating Staphylococcal Toxic Shock Syndrome.

Staphylococcal toxic shock syndrome caused by tampon use.

[Staphylococcal toxic shock syndrome at a chronic hemodialysis].

Staphylococcal toxic shock syndrome: superantigen-mediated enhancement of endotoxin shock and adaptive immune suppression.

Toxic streptococcal syndrome.

Streptococcus suis-related prosthetic joint infection and streptococcal toxic shock-like syndrome in a pig farmer in the United States.

Necrotizing fasciitis and streptococcal toxic shock syndrome secondary to varicella in a healthy child.

Molecular analysis of pyrogenic exotoxins from Streptococcus pyogenes isolates associated with toxic shock-like syndrome.

Toxic shock syndrome and tampons.

Successful Treatment of Necrotizing Fasciitis and Streptococcal Toxic Shock Syndrome with the Addition of Linezolid.

Streptococcal Toxic Shock Syndrome: Life Saving Role of Peritoneal Lavage and Drainage.

Mutants of staphylococcal toxic shock syndrome toxin 1: mitogenicity and recognition by a neutralizing monoclonal antibody.

Receptors for toxic shock syndrome toxin-1 and staphylococcal enterotoxin A on human blood monocytes.

Streptococcal toxic-shock syndrome due to Streptococcus dysgalactiae subspecies equisimilis in breast cancer-related lymphedema: a case report.

Erythrogenic toxins A, B and C: occurrence of the genes and exotoxin formation from clinical Streptococcus pyogenes strains associated with streptococcal toxic shock-like syndrome.

Suppression of antibody response by group A streptococcal pyrogenic exotoxin and characterization of the cells involved.

Spontaneous mutations in Streptococcus pyogenes isolates from streptococcal toxic shock syndrome patients play roles in virulence.

Intense, flu-like symptoms in women using menstrual devices: always think of staphylococcal Toxic Shock Syndrome.