Stretch-Activation of Angiotensin II Type 1a Receptors Contributes to the Myogenic Response of Mouse Mesenteric and Renal Arteries Johanna Schleifenbaum, Mario Kassmann, István Szijártó, Hantz Hercule, Jean-Yves Tano, Stefanie Weinert, Matthias Heidenreich, Asif Pathan, Yoland Anistan, Natalia Alenina, Nancy Rusch, Thomas Jentsch, Michael Bader and Maik Gollasch Circ Res. published online May 16, 2014; Circulation Research is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231 Copyright © 2014 American Heart Association, Inc. All rights reserved. Print ISSN: 0009-7330. Online ISSN: 1524-4571

The online version of this article, along with updated information and services, is located on the World Wide Web at: http://circres.ahajournals.org/content/early/2014/05/16/CIRCRESAHA.115.302882

Data Supplement (unedited) at: http://circres.ahajournals.org/content/suppl/2014/05/16/CIRCRESAHA.115.302882.DC1.html

Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published in Circulation Research can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for which permission is being requested is located, click Request Permissions in the middle column of the Web page under Services. Further information about this process is available in the Permissions and Rights Question and Answer document. Reprints: Information about reprints can be found online at: http://www.lww.com/reprints Subscriptions: Information about subscribing to Circulation Research is online at: http://circres.ahajournals.org//subscriptions/

Downloaded from http://circres.ahajournals.org/ at University of Virginia on June 22, 2014

Stretch–Activation of Angiotensin II Type 1a Receptors Contributes to the Myogenic Response of Mouse Mesenteric and Renal Arteries Johanna Schleifenbaum1, Mario Kassmann1, István András Szijártó1, Hantz C. Hercule1, Jean-Yves Tano1, Stefanie Weinert2,3, Matthias Heidenreich2,3,5, Asif R. Pathan4, Yoland-Marie Anistan1, Natalia Alenina2, Nancy J. Rusch4, Michael Bader2, Thomas J. Jentsch2,3, and Maik Gollasch1 Medical Clinic for Nephrology and Internal Intensive Care, Charité Campus Virchow Klinikum, Experimental and Clinical Research Center (ECRC); 2Max Delbrück Center for Molecular Medicine; 3 Leibniz-Institut für Molekulare Pharmakologie (FMP), Berlin, Germany; 4Department of Pharmacology and Toxicology, University of Arkansas for Medical Sciences, 4301 W. Markham Street, Little Rock, AR 72205 USA, and; 5Broad Institute of MIT and Harvard, 7 Cambridge Center, Cambridge, MA 02142, USA. 1

J.S. and M.K. contributed equally to this study. Running title: AT1aR and Myogenic Tone

Subject codes: [97] Other vascular biology [128] ACE/angiotensin receptors [152] Ion channels/membrane transport Address correspondence to: Dr. Maik Gollasch Charité Campus Virchow Klinikum Augustenburger Platz 1 13353 Berlin Germany Tel: +49 30 450 653 263 Fax: +49 30 450 553 909; [email protected]

In April 2014, the average time from submission to first decision for all original research papers submitted to Circulation Research was 14.38 days.

DOI: 10.1161/CIRCRESAHA.115.302882 Downloaded from http://circres.ahajournals.org/ at University of Virginia on June 22, 2014

1

ABSTRACT Rationale: Vascular wall stretch is the major stimulus for the myogenic response of small arteries to pressure. The molecular mechanisms are elusive, but recent findings suggest that G protein-coupled receptors can elicit a stretch response. Objective: Determine if angiotensin II type 1 receptors (AT1R) in vascular smooth muscle cells (VSMC) exert mechanosensitivity and identify the downstream ion channel mediators of myogenic vasoconstriction. Methods and Results: We used mice deficient in AT1R signaling molecules and putative ion channel targets, namely AT1R, angiotensinogen, TRPC6 channels or several subtypes of the voltage-gated K+ (Kv7) gene family (KCNQ3, 4 or 5). We identified a mechano-sensing mechanism in isolated mesenteric arteries and in the renal circulation that relies on coupling of the AT1R subtype a (AT1aR) to a Gq/11protein as a critical event to accomplish the myogenic response. Arterial mechano-activation occurs after pharmacological block of AT1R, and in the absence of angiotensinogen or TRPC6 channels. Activation of AT1aR by osmotically induced membrane stretch suppresses an XE991-sensitive Kv channel current in patch-clamped VSMCs and similar concentrations of XE991 enhance mesenteric and renal myogenic tone. Although XE991-sensitive KCNQ3, 4 and 5 channels are expressed in VSMCs, XE991-sensitive K+ current and myogenic contractions persist in arteries deficient in these channels. Conclusions: Our results provide definitive evidence that myogenic responses of mouse mesenteric and renal arteries rely on ligand-independent, mechano-activation of AT1aR. The AT1aR signal relies on an ion channel distinct from TRPC6 or KCNQ3, 4 or 5 to enact VSMC activation and elevated vascular resistance.

Keywords: Myogenic tone, angiotensin II, mechanosensor, Gq proteins, TRPC channels, KCNQ channels, Kv7 channels, Bayliss effect, angiotensin receptor, potassium channels, transgenic mice

Nonstandard Abbreviations and Acronyms: AT1R angiotensin II type 1 receptor VSMC vascular smooth muscle cell Ang II angiotensin II TM transmembrane segment GPCR G protein-coupled receptor C-KIPs PKC-interacting proteins PKC protein kinase C PIP2 phosphatidylinositol 4,5-bisphosphate UTP uridine 5'-triphosphate Kv voltage-gated K+ channels MA mesenteric artery 4-AP 4-aminopyridine WT wild-type PLC phospholipase C TRPP polycystin

DOI: 10.1161/CIRCRESAHA.115.302882 Downloaded from http://circres.ahajournals.org/ at University of Virginia on June 22, 2014

2

INTRODUCTION The regulation of blood flow requires immediate adjustments in the diameter of small arteries and arterioles to satisfy the metabolic demand of distal tissues. This phenomenon is pressure-sensitive and maintains blood flow despite fluctuations in perfusion pressure. Bayliss first observed that stretch imposed on the vascular wall by intravascular pressure mediates a contractile or “myogenic” response.1 A rise in the cytosolic Ca2+ concentration ([Ca2+]) in vascular smooth muscle cells (VSMCs) contributes to this response, and generally is attributed to depolarization –induced activation of L-type Ca2+ (Cav1.2) channels, Ca2+ influx, and myogenic vasoconstriction according to wall tension2-8. Several ion channels have been implicated in stretch-induced depolarization including cation-conducting channels (TRPC6/TRPM4)2-4, and voltage-gated K+ channels encoded by the Kv7 gene family (KCNQ)5-7. These channels exhibit only modest mechano-sensitivity in heterologous expression systems8-10, suggesting they are not the primary mechanosensors responsible for myogenic vasoconstriction. Osmotically-induced cell stretch was reported to initiate a conformational switch in AT1R during which transmembrane (TM) segment 7 enters the ligand-binding pocket to cause activation8. Apparently the stretch-induced disruption of inter-helical interactions between TM 7 and other TM that stabilize AT1R in an inactive state enable TM 7 to enter the ligand-binding pocket of AT1R to activate it independently of angiotensin II (Ang II)8. Initial reports also raise the possibility that multiple mechanosensitive G protein-coupled receptors (GPCRs), including AT1R, contribute to myogenic responsiveness through ligand-independent signaling and Gq/11-protein activation of TRPC6 channels11. Overexpression of vasoconstrictor GPCRs conferred mechano-sensitivity that relied on TRPC6 channel activation11, but this pathway defined in heterologous systems may relate to protein overexpression and may not represent a native feature of VSMCs. In addition, osmotic challenge as a way of mimicking pressure-induced stretch may substantially change intracellular signaling by various molecules, which is not representative of their function in native cells. Thus, a definitive role for AT1aR and/or other GPCRs as ligand-independent mechanosensors in VSMCs has not been firmly established and the downstream effectors that mediate stretch-induced depolarization are unknown. For example, AT1R antagonism with losartan or candesartan does not inhibit myogenic tone in rat mesenteric arteries12, 13 and only mildly blunts myogenic tone in rat cerebral arteries11. Furthermore, a recent study questioned if the interaction between uridine 5'-triphosphate (UTP)-activated Gq/11 protein and TRPC-like currents contributes to the development of myogenic tone in rat cerebral resistance arteries14. As an alternative mechanism for myogenic responsiveness, AT1R activation was described to suppress voltage-gated K+ (Kv) channels via Gq/11 -dependent activation of PKC-interacting proteins (C-KIPs), thereby increasing the contractile response to Ang II15. The further observation that XE991-sensitive Kv channels buffer myogenic vasoconstriction5, suggests that suppression of KCNQ-type channels by GPCRs is a previously unrecognized mechanism for stretchinduced depolarization and myogenic tone16. Indeed, AT1R activation inhibits cloned KCNQ2/3 channels in heterologous expression via phosphatidylinositol 4,5-bisphosphate (PIP2) depletion17, and KCNQ transcripts are found in small arteries5-7. Interestingly, native KCNQ2/3 heteromeric channels that show sensitivity to pharmacological block by XE99118 are inhibited by Gq-dependent PIP2 depletion19, 20, an event implicated in GPCR-initiated myogenic tone. Here, we explored mechanisms of mechano-sensitive AT1aR signaling in VSMCs. Since myogenic responsiveness in vivo is modulated by perfusion pressure and blood flow21 and these factors differ between vascular beds, our studies included both pressurized mesenteric arteries and isolated perfused kidneys to assess regulatory pathways of myogenic tone. We compared arterial myogenic responses between wild-type (WT) mice and mutant mice with deletion of genes coding for the AT1aR (Agtr1a-/mice) and angiotensinogen (Agt-/- mice) to conclusively evaluate if AT1aR are Ang II-independent mechanosensors in VSMCs. Mice with deletion or modification of genes encoding TRPC6 and KCNQ3,

DOI: 10.1161/CIRCRESAHA.115.302882 Downloaded from http://circres.ahajournals.org/ at University of Virginia on June 22, 2014

3

4 and 5 channels were employed to explore the role of these channels as downstream effectors of AT1aR – initiated myogenic signaling. Collectively, our results provide the first definitive analysis to pinpoint the AT1aR as the major AT1 receptor subtype that can elicit myogenic constriction of mesenteric and renal resistance arteries in the absence of its native ligand, angiotensin II. Interestingly, we failed to confirm TRPC6 channels as a target of AT1aR mechanosensing, although earlier studies implicated them as obligatory components of the myogenic response. Instead our findings revealed that a previously unrecognized XE991-sensitive Kv channel distinct from KCNQ3, 4 or 5 limits Ca2+-dependent myogenic constriction, which critically determines vascular resistance in the mesenteric and renal circulations to regulate blood pressure. This Kv channel is inhibited by osmotically-induced cell stretch via activation of AT1aR.

METHODS Mouse models. Animal care followed American Physiological Society guidelines and all protocols were locally approved. All drugs used were obtained from Sigma Aldrich (Munich, Germany) or Merck (Darmstadt, Germany). Mice were maintained in IVC (Techniplast, Deutschland) cages under standardized conditions with an artificial 12-h dark–light cycle, with free access to standard chow (0.25% sodium; SSNIFF Spezialitäten, Soest, Germany) and drinking water ad libitum. We studied adult (12-16 weeks old) male mice either with AT1a receptor deficiency (Agtr1a-/-), angiotensinogen deficiency (Agt-/-), TRPC6 deficiency (Trpc6-/), KCNQ3 deficiency (Kcnq3-/-), KCNQ4 deficiency (Kcnq4-/-)22, KCNQ5 deficiency (Kcnq5dn/dn, mice expressing a dominant negative point mutant in the pore region 23) or with double deficiency of KCNQ4 and KCNQ5 channels (Kcnq4-/-/Kcnq5dn/dn). Agtr1a-/- mice24 and Agt-/- mice25 were backcrossed to the FVB/N genetic background (Charles River, Sulzfeld, Germany) for 8 generations and maintained in the MDC animal facility. Either litter- or age-matched male wild-type (WT) mice (+/+) were used as controls. Animals were randomly assigned to the experimental procedures in accordance with the German legislation on protection of animals. Pressurized mesenteric arteries (MA). After mice were killed, the kidneys and mesenteric bed were removed and transferred to cold (4°C), gassed (95% O2-5% CO2) physiological salt solution. Mesenteric (3rd or 4th order) and renal interlobar arteries were mounted on glass cannula to allow perfusion at physiological pressures3,11,26,27. Vessels were superfused continuously with Krebs–Henseleit solution (95% O2–5% CO2; pH 7.4, 37oC) of the following composition (mmol/L): 119 NaCl, 4.7 KCl, 25 NaHCO3, 1.2 KH2PO4, 1.6 CaCl2, 1.2 MgSO4, 0.03 EDTA and 11.1 glucose. The vessels were stepwise pressurized to 20, 40, 60, 80 or 100 mmHg using a pressure servocontrol system (Living System Instrumentation, Burlington, VT, USA). We measured the inner diameter of the vessels with a video-microscope (Nikon Diaphot, Düsseldorf, Germany) connected to a personal computer for data acquisition and analysis (HaSoTec, Rostock, Germany)11,28. Arteries were equilibrated for 45 to 60 min before starting experiments, after which a 60 mmol/L KCl challenge was performed prior to any other interventions. Isolated perfused kidneys. Isolated kidneys were perfused with gassed (95% O2 - 5% CO2) Krebs–Henseleit solution in an organ chamber using a peristaltic pump to ensure constant flow (0.3–1.9 ml/min). Drugs (Ang II or losartan) were added to the perfusate. Perfusion pressure was measured by a pressure transducer and data recorded and analyzed by a Powerlab acquisition system (AD Instruments, Colorado Springs, USA). Ang IIinduced pressor effects were normalized to the maximal pressor effect induced by KCl (60 mmol/L)11.

DOI: 10.1161/CIRCRESAHA.115.302882 Downloaded from http://circres.ahajournals.org/ at University of Virginia on June 22, 2014

4

Patch-clamp recordings. Potassium currents were recorded in the conventional whole-cell configuration of the patch-clamp technique29,30. Patch pipettes (resistance, 3-5 M) were filled with solution containing (in mmol/L): 130 KCl, 1 MgCl2, 3 Na2ATP, 0.1 Na3GTP, 10 HEPES, and 5 EGTA (pH 7.2). The external solution contained (in mmol/L): 126 NaCl, 5 KCl, 1 MgCl2, 0.1 CaCl2, 11 glucose and 10 HEPES (pH 7.2). The hypotonic external solution contained (250 mOsm kg-1) (in mmol/L): 110 NaCl, 5 KCl, 1 MgCl2, 2 CaCl2, 10 glucose, 10 HEPES (pH 7.4). For the corresponding normosmolar solution, mannitol was added to obtain an osmolarity of 300 mOsm kg-1. RT-PCR. Total RNA from brain, mesenteric and renal arteries of WT mice was isolated using the RNeasy Mini Kit (QIAGEN, Valencia, USA), and first-strand cDNA synthesis performed according to the iScriptTM cDNA Synthesis Kit (BIO-RAD, Hercules, USA). Primer pairs and PCR conditions are provided in the supplement. Statistics. Data are presented as mean ± SEM. Statistically significant differences in mean values were determined by Student's unpaired t-test. P values < 0.05 were considered statistically significant.

RESULTS AT1aR contribute to myogenic vasoconstriction in Agtr1a-/- arteries. We monitored myogenic vasoconstriction in isolated resistance-sized mesenteric arteries (MA) using videomicroscopy. MA were exposed to stepwise (20 mmHg) increases in intraluminal pressure between 20 and 100 mmHg in the presence and absence of external Ca2+ (1.6 mmol/L) to determine active and passive vessel diameters, respectively. Active vasoconstriction was defined as the difference between diameter in the presence and absence of external Ca2+ at each pressure step. Figure 1 shows representative diameter recordings of MA from Agtr1a+/+ wild-type mice (Fig. 1A) and Agtr1a-/- mutant mice (Fig. 1B) lacking the gene coding for AT1aR. Progressive increases in intraluminal pressure generated active tension that counteracted further dilation at pressures >40 mmHg in MA of Agtr1a+/+ mice, reaching peak constrictions of ~70 µm at 80 to 100 mmHg (Fig. 1A). In contrast, MA of Agtr1a-/- mice lacked active vasoconstriction (Fig. 1B), indicating that myogenic tone was nearly abolished in these arteries (Fig. 1C). Based on an initial report that AT1Rs activate Gq/11 protein subtypes to enact aortic contraction,31 we compared the diameter responses to agonist stimulation of AT1R, 1-adrenoceptors ( 1-AR), and thromboxane A2 receptors between resistance-sized MA of Agtr1a+/+ and Agtr1a-/- mice. At an intraluminal pressure of 60 mmHg, the α1-AR agonist phenylephrine (1-100 µmol/L) and the thromboxane A2 receptor agonist U46619 (0.01-1 µmol/L) caused strong concentration-dependent constrictions of MA from Agtr1a+/+ and Agtr1a-/- mice (Figs. 1E-F), thereby confirming intact Gq/11 – dependent signaling. In contrast, Ang II strongly constricted arteries of Agtr1a+/+ but not Agtr1a-/- mice (Fig. 1D), although the latter vessels fully constricted to 60 mmol/L KCl. These data confirmed the loss of functional AT1aR in MA of Agtr1a-/- animals. In contrast, Ang II (1 µmol/L) was able to induce contraction of aortas of Agtr1a-/- mice (not shown), consistent with an earlier report that AT1bR mediate contraction of large but not small arteries in mice.32 We also assessed myogenic tone in cannulated renal interlobar arteries. Similar to MA, renal arteries from Agtr1a-/- mice fully constricted in response to 60 mmol/L KCl, but failed to develop pressure-dependent myogenic tone (not shown). Importantly, myogenic constriction was normal in isolated MA of Agt-/- mice lacking the angiotensinogen gene. For example, MA from Agt+/+ and Agt-/- mice showed comparable constrictor responses to 60 mmol/L KCl

DOI: 10.1161/CIRCRESAHA.115.302882 Downloaded from http://circres.ahajournals.org/ at University of Virginia on June 22, 2014

5

and dilator responses to Ca2+-free solution (Fig. 2). Notably, MA from Trpc6-/- mice that lack the cation channel TRPC6 implicated in the myogenic response of rat cerebral arteries also showed intact myogenic tone (Fig. 3). Hence, our results support the concept that the AT1aR is required for the development of myogenic vasoconstriction, but surprisingly, as revealed by Agt-/- and Trpc6-/- arteries that retain Ca2+dependent tone, myogenic responsiveness may not depend on the presence of Ang II or TRPC6 channels as surmised by earlier reports.11 13, 33 AT1aR are essential for pressure-induced responses in the renal circulation. Next we evaluated the level of myogenic tone in the mouse renal circulation, a highly myogenic vascular bed responsible for regulating blood flow to the kidneys to influence sodium excretion and blood pressure. We calculated renal vascular resistance in isolated perfused kidneys by measuring perfusion pressure at fixed levels of flow. Online Figure I A shows that perfusion pressure increased with flow rate in kidneys of Agtr1a+/+ mice, reaching a value of ~150 mmHg at a flow rate of 1.9 mL/min (Online Figs. I A & C). Kidneys from Agtr1a-/- mice developed significantly less pressure at the same flow rate (Online Figs I B & C). At 1.9 mL/min, pressure in Agtr1a-/- kidneys was ~70 mmHg lower than in Agtr1a+/+ kidneys. Ang II (100 nmol/L) increased perfusion pressure by ~70 mmHg in kidneys of Agtr1a+/+ mice, but had no effect in kidneys of Agtr1a-/- mice (Online Fig. I D), indicating that AT1aR (but not AT1b receptors) mediate Ang II-dependent vasoconstriction of mouse renal arterioles. We further investigated the role of the AT1R using the AT1R antagonist losartan and a Ca2+-free external perfusion solution. Losartan (100 nmol/L and 1 µmol/L) only slightly decreased perfusion pressure in kidneys of Agtr1a+/+ mice (Online Figs. I A & E), but had no effect in kidneys of Agtr1a-/- mice (Online Figs. I B & E). Removal of external Ca2+ nearly abolished flow-induced myogenic constriction in perfused kidneys of Agtr1a+/+ mice (Online Figs. I A & F), but had no effect in kidneys of Agtr1a-/- mice (Online Figs. I B & F). Importantly, flow-induced myogenic constriction was normal in kidneys of angiotensinogen (Agt) deficient mice (Online Fig. I G). Flow-induced myogenic responsiveness also persisted in kidneys from Trpc6-/- mice (Online Fig. II). These results demonstrate a key role of AT1aR in the flow-induced myogenic response of the mouse renal vasculature and provide strong evidence that the contribution of AT1aR to the renal myogenic response is independent of circulating Ang II and TRPC6 channels. Inhibition of Kv channels by XE991 causes vasoconstriction. Gq-protein dependent signaling including AT1R activation inhibits Kv7 channels which are encoded by KCNQ genes17,19, 20. Thus, we considered the alternative hypothesis that block of KCNQ channels underlies the myogenic tone initiated by mechano-sensitive AT1aR5-7. Since XE991 is a relatively specific inhibitor of several KCNQ subtypes34-37, we explored whether AT1aR suppress XE991-sensitive K+ currents in freshly isolated mesenteric VSMCs (Fig. 4 & Online Fig. III). The outward Kv current in WT cells was almost completely blocked by 30 µmol/L XE991 (Figs. 4A-B & Online Fig. III) and exhibited a half-blocking concentration (IC50) of ~60 nmol/L XE991 (Online Fig. IV A), consistent with selective inhibition of KCNQ channels. XE991 (100 nmol/L) did not suppress K+ current mediated by recombinant Kv1.2 or Kv1.5 channels in HEK 293 cells (Online Fig. V), which are regarded as the major Kv channels expressed by VSMCs38,39. We also performed complete voltage step protocols in order to study the voltage-dependent properties of the XE991 and the 4-AP sensitive current in VSMCs (Online Fig. VI). Online Figure VI shows that both drugs exhibited current inhibition over a wide range of voltages, indicating that this protocol cannot ascertain whether XE991 and 4-AP selectively block Kv7 and Kv1 channels, respectively. Consistent with earlier findings,15 the Kv current was inhibited by 100 nmol/L Ang II (Fig. 4C), but importantly this concentration of Ang II did not inhibit the Kv current in VSMCs from Agtr1a-/- mice (Fig. 4C), and only ~50% of the XE991-sensitive Kv current component was blocked by the nonselective Kv channel blocker 4-AP (2 mmol/L, Fig. 4) that exhibited an IC50 of ~6 µmol/L (Online Fig. IV A). To investigate whether the Kv current is mechanosensitive with an essential role of AT1aR, the effect of osmotically induced membrane stretch (250 mOsm kg-1) on VSMCs was

DOI: 10.1161/CIRCRESAHA.115.302882 Downloaded from http://circres.ahajournals.org/ at University of Virginia on June 22, 2014

6

studied. Figure 4D shows that the Kv current was inhibited by hypotonicity in wild-type cells (Fig. 4D), but not in VSMCs from Agtr1a-/- mice (Fig. 4D). Consistent with its effects in cerebral arteries of rats5, XE991 (30 µmol/L) increased myogenic tone in mouse MA (Figs. 5A-B) and enhanced perfusion pressure in isolated kidneys (Online Fig. IV B). XE991 at concentrations of 100 nmol/L and 30 µmol/L equi-effectively enhanced the myogenic response (Fig. 5B & Online Fig IV B). Together, these results implicated an XE991–sensitive Kv channel susceptible to AT1R activation as capable of limiting myogenic vasoconstriction of mouse mesenteric and renal arteries. Based on pharmacological experiments using XE991, KCNQ-type Kv7 channels are proposed to modulate myogenic vasoconstriction5. To explore the contribution of KCNQ channels to myogenic contraction, we compared myogenic responses between isolated MA from WT mice and mice lacking activity of certain KCNQ isoforms. Since Kv current in mouse mesenteric VSMCs and native KCNQ2/3 channels in neuronal cells18 show similar high sensitivity to XE991 block, we first evaluated myogenic responsiveness in MA of Kcnq3-/- mice. Myogenic tone and peak Kv current density were normal in MA from Kcnq3-/- mice compared to WT mice (Fig. 6). Similar results indicating intact myogenic responsiveness were obtained in MA from Kcnq4-/-, Kcnq5dn/dn, and Kcnq4-/-/Kcnq5dn/dn mice (Figs. 7A-E, Online Fig. VI). Furthermore, we observed similar magnitudes of XE991-sensitive Kv current in freshly isolated mesenteric VSMCs from Kcnq4-/- mice, Kcnq5dn/dn, and Kcnq4-/-/Kcnq5dn/dn mice. Normalized peak Kv current density also was not significantly different between VSMCs from these genotypes (Fig. 7F). Similar to cells of WT mice, total Kv currents were nearly eliminated in VSMCs isolated from all KCNQ-deficient mouse models by 30 µmol/L XE991 and 2 mmol/L 4-AP (Online Fig. VII). The XE991sensitive Kv current was resistant to the KCNQ1 channel blockers HMR1556 and chromanol 293B (Online Fig. VIII). In contrast to XE991 (Fig. 5), the KCNQ1 channel blockers HMR1556 and chromanol 293B (each at 10 µmol/L) increased rather than decreased the diameter of pressurized MA from WT mice (Online Fig. VIII). Reverse transcription (RT)-PCR analysis of mesenteric and renal arteries from WT mice revealed a KCNQ gene expression profile that included all five known KCNQs in MA (Online Fig. IX). However, KCNQ2 is not detected in renal arteries that show AT1aR-dependent myogenic tone, and KCNQ1 is resistant to block by nanomolar concentrations of XE99134, 35. We failed to detect KCNQ2 in isolated VSMCs from mouse MA (Online Fig. X).

DISCUSSION Our findings provide compelling evidence that AT1aRs in mesenteric and renal arteries fulfill a fundamental physiological function by transducing intravascular pressure into the active force that underlies myogenic tone. We observed a striking loss of arterial mechano-activation after genomic deletion of AT1aR, but myogenic response fully persisted in the absence of angiotensinogen and after pharmacological block of AT1R. Our experiments rule out a major role for anticipated downstream targets of AT1R myogenic signaling in mesenteric and renal vessels including TRPC6 and several KCNQ channel gene families. Instead, our genetic mouse models revealed an unrecognized XE991-sensitive K+ channel, which is inhibited by osmotically induced membrane stretch, requires essential involvement of AT1aR, and limits myogenic vasoconstriction. Various elements have been proposed to contribute to mechanosensation by VSMCs, including cell adhesion proteins, the cytoskeleton, phospholipase C (PLC)40, 41, TRPC6/TRPM4 channels2-4, ENaC/ASIC2 channels42, inwardly rectifying K+ channels43, polycystins (TRPP)44 and the phospholipid bilayer of the plasma membrane21, 45-47. However, the primary mechanosensor(s) involved in the myogenic response of small arteries and arterioles remain elusive. Cell stretch is able to activate AT1R in heterologous expression systems by an anticlockwise rotation and a shift of TM 7 into the ligand-binding pocket.8 Such a conformational switch may also provide a structural basis for the inhibition of AT1R

DOI: 10.1161/CIRCRESAHA.115.302882 Downloaded from http://circres.ahajournals.org/ at University of Virginia on June 22, 2014

7

activation by inverse agonists8. Stretch-activation of AT1R also is proposed to underlie activation of TRPC6 channels by hypo-osmotic cell swelling, an effect inhibited by losartan11. However, the results supporting mechano-sensitivity of GPCRs were obtained by heterologous overexpression of GPCRs and TRPC channels, which may have artificially accentuated their interaction. Moreover, it seems questionable whether the hypo-osmotic cell swelling used in those studies11 faithfully mimics stretchdependent activation of VSMCs in situ. Thus, although cell-stretch activation of AT1R was inhibited by the inverse agonist losartan after heterologous overexpression8, we found that mechano-activation of AT1aR cannot be reversed by an inverse AT1R agonist in small arteries perfused at physiological pressures characteristic of the peripheral circulation. Additionally, we demonstrate that myogenic tone is normal in arteries of Trpc6-/- mice, indicating that TRPC6 plays only a dispensable role in ligandindependent AT1R signaling in these VSMCs. By showing that vascular preparations from Agtr1a-/- mice fail to generate normal levels of pressureinduced myogenic vasoconstriction, our work demonstrates that expression of AT1aR is required for the myogenic response in resistance MA and in the in-situ renal circulation. The vasoconstrictor response to Ang II was severely suppressed in arteries of Agtr1a-/- mice, and residual Ang II effects were attributed to AT1bR expression. The loss of myogenic responsiveness in Agtr1a-/- mice was not caused by a deficit of Ang II-elicited signaling, since preparations from angiotensinogen-deficient (Agt) mice showed normal myogenic tone. Instead, our results showing normal myogenic constriction in MA of Agt-/- mice excludes the involvement of local Ang II production in myogenic tone, an inherent concern of earlier studies that relied on captopril or perindopril to rule out Ang II-dependent AT1aR mechano-sensitivity11, 33. Thus, we provide the most definitive evidence to date demonstrating that sustained Ang II-independent, mechanosensitive AT1R signaling in the arterial wall critically mediates the myogenic constriction of mesenteric and renal arteries. Furthermore, our findings specify the AT1aR as the major AT1R subtype involved in this process. This novel GPCR signaling pathway involving AT1aR may play an important role in blood pressure regulation, since Agtr1a-/- mice show lower systemic blood pressure (by ~20 mmHg) compared to WT mice, but their SBP is similar to mice deficient in smooth muscle specific -Gq/11 24, 31, 48. The ionic mechanism underlying AT1aR-mediated myogenic vasoconstriction is unknown, but is presumed to rely on depolarization-induced opening of voltage-gated Cav1.2 channels in VSMCs. Although smooth muscle cell polycystin-1 and -2 (TRPP1 and -2) proteins reportedly modulate the myogenic response in mesenteric arteries44, there is no evidence that TRPP1 and -2 are effector targets for GPCR signaling pathways. Depolarizing cation current through TRPC6/TRPM4 channels2-4 or suppression of hyperpolarizing K+ current through KCNQ-type Kv channels5 have been proposed to mediate myogenic contractions. Based on these earlier findings, we hypothesized that TRPC6 channels contribute to myogenic tone in mouse mesenteric and renal arteries. Surprisingly, however, we found that myogenic tone was normal in arteries of Trpc6-/- mice, arguing against a major role for TRPC6 channels in the myogenic response to pressure. Next, we hypothesized that suppression of KCNQ channels mediates the depolarizing event downstream of AT1aR-dependent mechanosensing that opens Cav1.2 channels, since the KCNQ family members are active at relatively negative membrane potentials and are inhibited by AT1R activated Gq-protein signaling17, 19, 20. Consistent with this idea, we observed that K+ currents in mesenteric VSMCs were remarkably sensitive to block by XE991 at concentrations regarded as selective for KCNQ channels (IC50 ~60 nmol/L) and that XE991 augmented myogenic vasoconstriction. Importantly, Ang II and osmotically induced membrane stretch suppressed the XE991sensitive component of Kv current in mesenteric VSMCs; both effects were observed in the presence of AT1aR, but not in the absence of AT1aR. Considering these findings, the observation of normal myogenic tone in MA from Kcnq3-/-, Kcnq4-/-, Kcnq5dn/dn and Kcnq4-/-/Kcnq5dn/dn mice was surprising, as was the observation that Kv current was similarly blocked by XE991 in mesenteric VSMCs isolated from WT, Kcnq4-/-, Kcnq5dn/dn and Kcnq4-/-/Kcnq5dn/dn mice. Kcnq5dn/dn mice23 carry a dominant negative mutation (G278S) in the KCNQ5 pore, which renders KCNQ5 (dn)-containing homomeric channels, as well as heteromeric KCNQ5(dn)/KCNQ3 and KCNQ5(dn)/KCNQ4 channels, non-functional23. Although

DOI: 10.1161/CIRCRESAHA.115.302882 Downloaded from http://circres.ahajournals.org/ at University of Virginia on June 22, 2014

8

Kcnq1, Kcnq3, Kcnq4, and Kcnq5 gene products are widely expressed in arteries5-7, with KCNQ4 and 5 often being dominant49, 50, our data indicate that the latter three channel subtypes do not majorly contribute to the myogenic response in mouse MA. Nevertheless, triple-knockout mice would give a more definitive answer. It is unlikely that KCNQ1 channels are involved since native KCNQ1 channels are inhibited by XE991 with an IC50 of ~10 µmol/L34, 35, a concentration ~100-fold higher than the one used here. In addition, the KCNQ1 channel blockers chromanol 293B and HMR1556 at a concentration (10 µM) that blocks cloned KCNQ1 channels, did not affect the Kv current in mesenteric VSMCs, but induced an apparently off-target relaxation of MA. Additionally, we failed to detect KCNQ2 transcript in mouse renal arteries and isolated mouse mesenteric VSMCs. Other Kv channels known to be expressed in VSMCs including Kv1.2/Kv1.5 and Kv2.1/Kv9.3 heteromeric channels are only blocked by higher concentrations of XE991 (10 µmol/L) than required to block Kv current in mouse mesenteric VSMCs5. Moreover, we found that XE991 (100 nmol/L) does not alter currents attributed to recombinant Kv1.2 or Kv1.5 monomeric channels. Thus, our collective findings suggest that recognized members encoded by the Kv7 channel gene family (KCNQ3, 4 and 5 channels) are not downstream effectors of AT1aR – initiated myogenic signaling. Instead, an unrecognized XE991-sensitive K+ channel limits AT1aRmediated myogenic vasoconstriction. This channel also appears to serve as a novel downstream target for ligand-independent and membrane stretch-dependent AT1aR signaling in VSMCs. In summary, we have identified a mechanosensitive function of AT1aR in the myogenic vasoconstriction of two key vascular beds. Instead of accepting the conceptual framework that multiple mechano-sensitive GPCRs couple to TRPC6 channels to produce myogenic tone11, we propose that primarily mechano-activated and ligand-independent AT1aR contribute to myogenic responsiveness in VSMCs without critical involvement of TRPC6. The AT1aR signal relies on an ion channel distinct from KCNQ3, 4 or 5. Our findings establish the foundation for further studies designed to identify the precise mechanism of AT1aR –mediated myogenic responsiveness, which may reveal new cellular targets for therapeutic strategies to alleviate the accentuated myogenic response that characterizes hypertension and other cardiovascular diseases. Notably, mechano-activation of AT1R is also proposed to contribute to pressure overload-induced cardiac hypertrophy51. Hypertrophic effects were observed in Agt-/- mice51 and were reversed by the inverse AT1R agonist candesartan, suggesting that the hypertrophic effects are caused by AT1R activation induced by mechanical stress independently of Ang II51. However, the interpretation of these results is not straightforward since other strong inverse agonists such as valsartan52 did not blunt the development of hypertrophy53, and mechanical stretch can induce hypertrophic responses in cardiac myocytes of AT1aR knockout mice54. Regardless, the precise contribution of ligandindependent, AT1aR -induced mechano-signaling to cellular processes previously attributed to Ang II may be revealed by future studies as pathogenic events underlying diverse and numerous cardiovascular diseases.

AUTHOR CONTRIBUTIONS All authors planned and designed experimental studies. J.S., M.K., H.C.H., I.Sz. and Y.M.A. obtained most experimental results, whereas N.A., M.H., S.W., and M.B. worked more on animal models. A.R.P and N.J.R. performed the RT-PCR studies. J.S., N.J.R., T.J.J. and M.G. drafted the paper and all authors contributed to its completion. ACKNOWLEDGEMENTS We thank Dr. William C. Cole for providing Kv1.2 and Kv1.5 expression plasmids and Dr. Lutz Birnbaumer for critical reading of the manuscript. We thank Dr. Iain Greenwood for providing HMR1556.

DOI: 10.1161/CIRCRESAHA.115.302882 Downloaded from http://circres.ahajournals.org/ at University of Virginia on June 22, 2014

9

SOURCES OF FUNDING The Deutsche Forschungsgemeinschaft supported this work. DISCLOSURES None.

REFERENCES 1. Bayliss WM. On the local reactions of the arterial wall to changes of internal pressure. J Physiol. 1902;28:220-231. 2. Welsh DG, Morielli AD, Nelson MT, Brayden JE. Transient receptor potential channels regulate myogenic tone of resistance arteries. Circ Res. 2002;90:248-250. 3. Dietrich A, Mederos YSM, Gollasch M, Gross V, Storch U, Dubrovska G, Obst M, Yildirim E, Salanova B, Kalwa H, Essin K, Pinkenburg O, Luft FC, Gudermann T, Birnbaumer L. Increased vascular smooth muscle contractility in TRPC6-/- mice. Mol Cell Biol. 2005;25:6980-6989. 4. Earley S, Straub SV, Brayden JE. Protein kinase C regulates vascular myogenic tone through activation of TRPM4. Am J Physiol Heart Circ Physiol. 2007;292:H2613-2622. 5. Zhong XZ, Harhun MI, Olesen SP, Ohya S, Moffatt JD, Cole WC, Greenwood IA. Participation of KCNQ (Kv7) potassium channels in myogenic control of cerebral arterial diameter. J Physiol. 2010;588:3277-3293. 6. Kansui Y, Goto K, Ohtsubo T, Murakami N, Ichishima K, Matsumura K, Kitazono T. Facilitation of sympathetic neurotransmission by phosphatidylinositol-4,5-bisphosphate-dependent regulation of KCNQ channels in rat mesenteric arteries. Hypertens Res.35:909-916. 7. Joshi S, Sedivy V, Hodyc D, Herget J, Gurney AM. KCNQ modulators reveal a key role for KCNQ potassium channels in regulating the tone of rat pulmonary artery smooth muscle. J Pharmacol Exp Ther. 2009;329:368-376. 8. Yasuda N, Miura S, Akazawa H, Tanaka T, Qin Y, Kiya Y, Imaizumi S, Fujino M, Ito K, Zou Y, Fukuhara S, Kunimoto S, Fukuzaki K, Sato T, Ge J, Mochizuki N, Nakaya H, Saku K, Komuro I. Conformational switch of angiotensin II type 1 receptor underlying mechanical stress-induced activation. EMBO Rep. 2008;9:179-186. 9. He Y, Xiao J, Yang Y, Zhou Q, Zhang Z, Pan Q, Liu Y, Chen Y. Stretch-induced alterations of human Kir2.1 channel currents. Biochem Biophys Res Commun. 2006;351:462-467. 10. Morita H, Honda A, Inoue R, Ito Y, Abe K, Nelson MT, Brayden JE. Membrane stretch-induced activation of a TRPM4-like nonselective cation channel in cerebral artery myocytes. J Pharmacol Sci. 2007;103:417-426. 11. Mederos y Schnitzler M, Storch U, Meibers S, Nurwakagari P, Breit A, Essin K, Gollasch M, Gudermann T. Gq-coupled receptors as mechanosensors mediating myogenic vasoconstriction. EMBO J. 2008;27:3092-3103. 12. Gschwend S, Henning RH, Pinto YM, de Zeeuw D, van Gilst WH, Buikema H. Myogenic constriction is increased in mesenteric resistance arteries from rats with chronic heart failure: instantaneous counteraction by acute AT1 receptor blockade. Br J Pharmacol. 2003;139:13171325. 13. Matrougui K, Loufrani L, Heymes C, Levy BI, Henrion D. Activation of AT(2) receptors by endogenous angiotensin II is involved in flow-induced dilation in rat resistance arteries. Hypertension. 1999;34:659-665. 14. Anfinogenova Y, Brett SE, Walsh MP, Harraz OF, Welsh DG. Do TRPC-like currents and G protein-coupled receptors interact to facilitate myogenic tone development? Am J Physiol Heart Circ Physiol. 2011;301:H1378-1388.

DOI: 10.1161/CIRCRESAHA.115.302882 Downloaded from http://circres.ahajournals.org/ at University of Virginia on June 22, 2014

10

15.

16.

17.

18.

19. 20. 21. 22.

23.

24.

25. 26.

27.

28.

29. 30.

31.

32.

Rainbow RD, Norman RI, Everitt DE, Brignell JL, Davies NW, Standen NB. Endothelin-I and angiotensin II inhibit arterial voltage-gated K+ channels through different protein kinase C isoenzymes. Cardiovasc Res. 2009;83:493-500. Mackie AR, Brueggemann LI, Henderson KK, Shiels AJ, Cribbs LL, Scrogin KE, Byron KL. Vascular KCNQ potassium channels as novel targets for the control of mesenteric artery constriction by vasopressin, based on studies in single cells, pressurized arteries, and in vivo measurements of mesenteric vascular resistance. J Pharmacol Exp Ther. 2008;325:475-483. Zaika O, Lara LS, Gamper N, Hilgemann DW, Jaffe DB, Shapiro MS. Angiotensin II regulates neuronal excitability via phosphatidylinositol 4,5-bisphosphate-dependent modulation of Kv7 (M-type) K+ channels. J Physiol. 2006;575:49-67. Passmore GM, Selyanko AA, Mistry M, Al-Qatari M, Marsh SJ, Matthews EA, Dickenson AH, Brown TA, Burbidge SA, Main M, Brown DA. KCNQ/M currents in sensory neurons: significance for pain therapy. J Neurosci. 2003;23:7227-7236. Suh BC, Inoue T, Meyer T, Hille B. Rapid chemically induced changes of PtdIns(4,5)P2 gate KCNQ ion channels. Science. 2006;314:1454-1457. Falkenburger BH, Jensen JB, Dickson EJ, Suh BC, Hille B. Phosphoinositides: lipid regulators of membrane proteins. J Physiol.588:3179-3185. Iida N, Mitamura Y. Effects of venous pressure elevation on myogenic vasoconstrictive responses to static and dynamic arterial pressures. Jpn J Physiol. 1989;39:811-823. Kharkovets T, Dedek K, Maier H, Schweizer M, Khimich D, Nouvian R, Vardanyan V, Leuwer R, Moser T, Jentsch TJ. Mice with altered KCNQ4 K+ channels implicate sensory outer hair cells in human progressive deafness. EMBO J. 2006;25:642-652. Tzingounis AV, Heidenreich M, Kharkovets T, Spitzmaul G, Jensen HS, Nicoll RA, Jentsch TJ. The KCNQ5 potassium channel mediates a component of the afterhyperpolarization current in mouse hippocampus. Proc Natl Acad Sci U S A. 2010;107:10232-10237. Ito M, Oliverio MI, Mannon PJ, Best CF, Maeda N, Smithies O, Coffman TM. Regulation of blood pressure by the type 1A angiotensin II receptor gene. Proc Natl Acad Sci U S A. 1995;92:3521-3525. Tanimoto K, Sugiyama F, Goto Y, Ishida J, Takimoto E, Yagami K, Fukamizu A, Murakami K. Angiotensinogen-deficient mice with hypotension. J Biol Chem. 1994;269:31334-31337. Gollasch M, Wellman GC, Knot HJ, Jaggar JH, Damon DH, Bonev AD, Nelson MT. Ontogeny of local sarcoplasmic reticulum Ca2+ signals in cerebral arteries: Ca2+ sparks as elementary physiological events. Circ Res. 1998;83:1104-1114. Hercule HC, Schunck WH, Gross V, Seringer J, Leung FP, Weldon SM, da Costa Goncalves A, Huang Y, Luft FC, Gollasch M. Interaction between P450 eicosanoids and nitric oxide in the control of arterial tone in mice. Arterioscler Thromb Vasc Biol. 2009;29:54-60. Hercule HC, Tank J, Plehm R, Wellner M, da Costa Goncalves AC, Gollasch M, Diedrich A, Jordan J, Luft FC, Gross V. Regulator of G protein signalling 2 ameliorates angiotensin IIinduced hypertension in mice. Exp Physiol. 2007;92:1014-1022. Gollasch M, Ried C, Bychkov R, Luft FC, Haller H. K+ currents in human coronary artery vascular smooth muscle cells. Circ Res. 1996;78:676-688. Essin K, Welling A, Hofmann F, Luft FC, Gollasch M, Moosmang S. Indirect coupling between Cav1.2 channels and ryanodine receptors to generate Ca2+ sparks in murine arterial smooth muscle cells. J Physiol. 2007;584:205-219. Wirth A, Benyo Z, Lukasova M, Leutgeb B, Wettschureck N, Gorbey S, Orsy P, Horvath B, Maser-Gluth C, Greiner E, Lemmer B, Schutz G, Gutkind JS, Offermanns S. G12-G13-LARGmediated signaling in vascular smooth muscle is required for salt-induced hypertension. Nat Med. 2008;14:64-68. Zhou Y, Chen Y, Dirksen WP, Morris M, Periasamy M. AT1b receptor predominantly mediates contractions in major mouse blood vessels. Circ Res. 2003;93(11):1089-1094.

DOI: 10.1161/CIRCRESAHA.115.302882 Downloaded from http://circres.ahajournals.org/ at University of Virginia on June 22, 2014

11

33.

34.

35.

36.

37. 38.

39.

40. 41. 42.

43. 44.

45. 46. 47. 48. 49.

50.

51.

Matrougui K, Levy BI, Henrion D. Tissue angiotensin II and endothelin-1 modulate differently the response to flow in mesenteric resistance arteries of normotensive and spontaneously hypertensive rats. Br J Pharmacol. 2000;130:521-526. Wang HS, Brown BS, McKinnon D, Cohen IS. Molecular basis for differential sensitivity of KCNQ and I(Ks) channels to the cognitive enhancer XE991. Mol Pharmacol. 2000;57:12181223. Wang HS, Pan Z, Shi W, Brown BS, Wymore RS, Cohen IS, Dixon JE, McKinnon D. KCNQ2 and KCNQ3 potassium channel subunits: molecular correlates of the M-channel. Science. 1998;282:1890-1893. Dupuis DS, Schroder RL, Jespersen T, Christensen JK, Christophersen P, Jensen BS, Olesen SP. Activation of KCNQ5 channels stably expressed in HEK293 cells by BMS-204352. Eur J Pharmacol. 2002;437:129-137. Schroder RL, Strobaek D, Olesen SP, Christophersen P. Voltage-independent KCNQ4 currents induced by (+/-)BMS-204352. Pflugers Arch. 2003;446:607-616. Lu Y, Hanna ST, Tang G, Wang R. Contributions of Kv1.2, Kv1.5 and Kv2.1 subunits to the native delayed rectifier K+ current in rat mesenteric artery smooth muscle cells. Life Sci. 2002;71:1465-1473. Albarwani S, Nemetz LT, Madden JA, Tobin AA, England SK, Pratt PF, Rusch NJ. Voltagegated K+ channels in rat small cerebral arteries: molecular identity of the functional channels. J Physiol. 2003;551:751-763. Thorneloe KS, Nelson MT. Ion channels in smooth muscle: regulators of intracellular calcium and contractility. Can J Physiol Pharmacol. 2005;83:215-242. Inoue R, Jensen LJ, Shi J, Morita H, Nishida M, Honda A, Ito Y. Transient receptor potential channels in cardiovascular function and disease. Circ Res. 2006;99:119-131. Gannon KP, Vanlandingham LG, Jernigan NL, Grifoni SC, Hamilton G, Drummond HA. Impaired pressure-induced constriction in mouse middle cerebral arteries of ASIC2 knockout mice. Am J Physiol Heart Circ Physiol. 2008;294:H1793-1803. McPherson GA, Keily SG. Electrophysiological properties of the rat middle cerebral artery at different levels of passive wall tension. Clin Exp Pharmacol Physiol. 1995;22:724-731. Sharif-Naeini R, Folgering JH, Bichet D, Duprat F, Lauritzen I, Arhatte M, Jodar M, Dedman A, Chatelain FC, Schulte U, Retailleau K, Loufrani L, Patel A, Sachs F, Delmas P, Peters DJ, Honore E. Polycystin-1 and -2 dosage regulates pressure sensing. Cell. 2009;139:587-596. Orr AW, Helmke BP, Blackman BR, Schwartz MA. Mechanisms of mechanotransduction. Dev Cell. 2006;10:11-20. Kung C. A possible unifying principle for mechanosensation. Nature. 2005;436:647-654. Martinac B. Mechanosensitive ion channels: molecules of mechanotransduction. J Cell Sci. 2004;117:2449-2460. Sugaya T, Nishimatsu S, Tanimoto K, et al. Angiotensin II type 1a receptor-deficient mice with hypotension and hyperreninemia. J Biol Chem. 1995;270:18719-18722. Jepps TA, Chadha PS, Davis AJ, Harhun MI, Cockerill GW, Olesen SP, Hansen RS, Greenwood IA. Downregulation of Kv7.4 channel activity in primary and secondary hypertension. Circulation. 2011;124:602-611. Ng FL, Davis AJ, Jepps TA, Harhun MI, Yeung SY, Wan A, Reddy M, Melville D, Nardi A, Khong TK, Greenwood IA. Expression and function of the K+ channel KCNQ genes in human arteries. Br J Pharmacol. 2011;162:42-53. Zou Y, Akazawa H, Qin Y, Sano M, Takano H, Minamino T, Makita N, Iwanaga K, Zhu W, Kudoh S, Toko H, Tamura K, Kihara M, Nagai T, Fukamizu A, Umemura S, Iiri T, Fujita T, Komuro I. Mechanical stress activates angiotensin II type 1 receptor without the involvement of angiotensin II. Nat Cell Biol. 2004;6:499-506.

DOI: 10.1161/CIRCRESAHA.115.302882 Downloaded from http://circres.ahajournals.org/ at University of Virginia on June 22, 2014

12

52.

53.

54.

Miura S, Kiya Y, Kanazawa T, Imaizumi S, Fujino M, Matsuo Y, Karnik SS, Saku K. Differential bonding interactions of inverse agonists of angiotensin II type 1 receptor in stabilizing the inactive state. Mol Endocrinol. 2008;22:139-146. Li L, Zhou N, Gong H, Wu J, Lin L, Komuro I, Ge J, Zou Y. Comparison of angiotensin II type 1-receptor blockers to regress pressure overload-induced cardiac hypertrophy in mice. Hypertens Res.33:1289-1297. Kudoh S, Komuro I, Hiroi Y, Zou Y, Harada K, Sugaya T, Takekoshi N, Murakami K, Kadowaki T, Yazaki Y. Mechanical stretch induces hypertrophic responses in cardiac myocytes of angiotensin II type 1a receptor knockout mice. J Biol Chem. 1998;273:24037-24043.

DOI: 10.1161/CIRCRESAHA.115.302882 Downloaded from http://circres.ahajournals.org/ at University of Virginia on June 22, 2014

13

FIGURE LEGENDS Figure 1. Myogenic tone in mesenteric arteries (MA). A, B: representative recordings of MA diameter during a series of pressure steps from 15 to between 20 and 100 mmHg in 20 mmHg increments in control conditions (Control) and in zero Ca2+ solution (-Ca2+). Arteries were isolated from Agtr1a+/+ (A) and Agtr1a-/- mice (B). Note increase in active constriction over the entire pressure range from 60 to 100 mmHg in vessels from Agtr1a+/+, but not from Agtr1a-/- mice. Vasodilation in response to external Ca2+free solution was observed in Agtr1a+/+ but not in Agtr1a-/- arteries (P < 0.05). C: Myogenic tone (at 80 mm Hg) expressed as dilation of vessels induced by external Ca2+-free solution (0 Ca/EGTA) (n=5). D, E, F: Dose-response curves to Ang II (D), phenylephrine (E), and U46619 (F) in MA of Agtr1a+/+ and Agtr1a-/- mice. MA were pressurized to 60 mmHg. Responses are expressed as relative changes in vessel inner diameter. Agtr1a+/+, n=4-5 vessels and Agtr1a-/-, n=7-8 vessels, in each group. *, significant difference at P < 0.05. Figure 2. Original recordings showing the vasodilator response to external Ca2+-free solution (0 Ca/EGTA) in Agt+/+ (A) and Agt-/- (B) arteries. Resting diameters at 15 mmHg (167±12 µm vs. 159±15 µm) and diameters at 80 mmHg (143+8 vs. 140+9 µm) were not different between groups (n=7, 8). (C) Myogenic tone (at 80 mm Hg) expressed as the increase in diameter induced by external Ca2+-free solution (n=5). n.s., P > 0.05. Figure 3. A: Representative recordings of MA diameter during a series of pressure steps from 15 to between 20 and 100 mmHg in 20 mmHg increments in control conditions (+ Ca2+) and in Ca2+-free solution (0 Ca/EDTA). Arteries were isolated from Trpc6+/+ and Trpc6-/- mice. Note increase in active constriction over the entire pressure range from 60 to 100 mmHg in vessels from Trpc6+/+ and Trpc6-/mice. B: Myogenic tone was not significantly different between MA of Trpc6+/+ and Trpc6-/- mice. Resting diameters at 15 mmHg were 109+4 µm and 117+4 µm averaged from 17 and 12 vessels in each group, respectively; P > 0.05. Figure 4. Suppression of Kv current in mesenteric VSMCs by XE991, 4-aminoypridine (4-AP), Ang II and hypotonicity. A: Left, representative families of whole-cell Kv currents in the absence (Control) and presence of 30 µmol/L XE991 and presence of 30 µmol/L XE991 + 2 mmol/L 4-AP. Right, representative families of whole-cell Kv currents in the absence (Control) and presence of 2 mmol/L 4-AP and presence of 30 µmol/L XE991 + 2 mmol/L 4-AP. Voltage clamp protocol included test steps (200 ms) to 20 mV. Holding potential was -60 mV; test pulse frequency, 1/20 s. B: Percent current inhibition by 30 µmol/L XE991 (XE, n=8), 2 mmol/L 4-AP (n=7), and 30 µmol/L XE991 (XE) + 2 mmol/L 4-AP (n=8). P < 0.05 for all bars. C: Original recordings of Kv current inhibition before (Control) and after extracellular application of 100 nmol/L Ang II. Decrease of whole-cell peak Kv currents (Imax) over time (25 min) in Ang II-treated (Agtr1a+/+, n=4) vs. non-treated (Control, n=7) cells. Ang II (1 µmol/L) did not inhibit the Kv current in Agtr1a-/- VSMCs (n=6). Voltage clamp protocol included test steps (200 ms) to 20 mV. Holding potential was -60 mV; test pulse frequency, 1/20 s. *, P < 0.05; n.s., not significant. D: Indirect Kv current suppression by membrane stretch through AT1aR. Osmotically induced membrane stretch reduced whole-cell Kv current in Agtr1a+/+ VSMCs, but not in Agtr1a-/- cells. ‘Basal’, before; ‘Hypo’, during hypotonic stimulation. Decrease of whole-cell peak Kv current (I0) after a 10 –min interval of hypotonic stimulation in Agtr1a+/+ cells (n=5) vs. Agtr1a-/- cells (n=6). *, P < 0.05. Figure 5. Enhancement of the myogenic response by XE991. A: Representative recordings of MA diameter during a series of pressure steps from 15 to between 20 and 100 mmHg in 20 mmHg increments in control conditions (Control), XE991 30 µmol/L and in Ca2+-free solution. B: Average myogenic constriction of MA in drug-free PSS (n=10) and in PSS containing 100 nmol/L and 30 µmol/L XE991 (n=6, 4). Note increase in active constriction over the entire pressure range from 60 to 100 mmHg in XE991. *, P < 0.05; n.s., P > 0.05.

DOI: 10.1161/CIRCRESAHA.115.302882 Downloaded from http://circres.ahajournals.org/ at University of Virginia on June 22, 2014

14

Figure 6. A,B: Representative recordings of MA diameter during a series of pressure steps from 15 to between 20 and 100 mmHg in 20 mmHg increments in control conditions (+Ca2+) and in Ca2+-free solution (0 Ca/EDTA). Arteries were isolated from Kcnq3+/+ (A) and Kcnq3-/- mice (B). C: Myogenic tone was not significantly different between MA of Kcnq3+/+ (n=12) and Kcnq3-/- (n=14) mice. Resting diameters at 15 mmHg were 157±10 µm and 131 ± 6 µm, respectively; P > 0.05. Note increase in active constriction over the pressure range from 60 to 100 mmHg. D: Peak XE991-sensitive Kv currents in mesenteric VSMCs from control wild-type (q3+/+) and Kcnq3-/- (q3-/-) mice. Original traces are shown in the inset. Cell capacitances were not different between groups (20.1±0.6 pF vs. 21.8±1.9 pF in Kcnq3+/+ and Kcnq3-/- VSMCs, respectively). Numbers in parentheses indicate numbers of cells tested. P > 0.05. Figure 7. A-D: Original recordings showing vasodilation caused by external Ca2+-free solution (0 Ca/EGTA) in control wild-type (A, n=16)), Kcnq4-/- (B, n=9), Kcnq5dn/dn (C, n=9) and Kcnq4-/-/Kcnq5dn/dn (D, n=10) arteries. E: Resting diameters (at 15 mmHg) and myogenic tone at 80 mmHg (157+9, 138+7, 145+13, 137+8 µm, respectively) were not different between the groups; P > 0.05. F: Peak XE991sensitive Kv currents in mesenteric VSMCs from wild-type, Kcnq4-/-, Kcnq5dn/dn and Kcnq4-/-/q5dn/dn mice. Cell capacitances also were not different (22.8±0.9, 24.4±0.7, 24.6±0.9, 24.4±1.1 pF, respectively). Numbers in parentheses indicate numbers of cells tested. P > 0.05.

DOI: 10.1161/CIRCRESAHA.115.302882 Downloaded from http://circres.ahajournals.org/ at University of Virginia on June 22, 2014

15

Novelty and Significance What Is Known? 

Stretch imposed on the vascular wall by intravascular pressure mediates a contractile or “myogenic” response to maintain blood flow despite fluctuations in perfusion pressure.



Osmotically-induced cell stretch initiates a conformational switch in the Angiotensin II type 1 receptor (AT1R) to cause ligand-independent receptor activation in heterologous expression systems.



Mechano-sensitive G protein-coupled receptors (GPCRs), including AT1R, have been implicated as mediators of myogenic responsiveness through ligand-independent signaling and Gq/11-protein activation of TRPC6 channels.

What New Information Does This Article Contribute? 

Our findings provide the first definitive evidence that the AT1aR is the major AT1 receptor subtype in vascular smooth muscle cells (VSMCs), which can elicit myogenic constriction of mouse mesenteric and renal resistance arteries in the absence of its native ligand, angiotensin II.



Our experiments indicate that the predicted downstream targets of AT1R-elicited myogenic signalling in mouse mesenteric and renal arteries including TRPC6 and several KCNQ channel gene families do not majorly contribute to the myogenic response to rises in intraluminal pressure.



Our results reveal an unrecognized XE991-sensitive K+ channel in VSMCs that is inhibited by osmotic membrane stretch as a potential mediator of AT1aR –elicited myogenic vasoconstriction.

A definitive role for GPCRs as ligand-independent mechanosensors in VSMCs is not firmly established and the downstream effectors that mediate stretch-induced depolarization are unknown. We find a striking loss of pressure –induced myogenic contraction after gene deletion of AT1aR in mouse mesenteric and renal resistance arteries, but the myogenic response fully persists in the absence of angiotensinogen or after pharmacological block of AT1R. Instead of accepting the concept that multiple mechano-sensitive GPCRs couple to TRPC6 channels to mediate myogenic tone, we propose that primarily mechanoactivated and ligand-independent AT1aR contribute to myogenic responsiveness in VSMCs without critical involvement of TRPC6. The AT1aR signal relies on an ion channel distinct from KCNQ3, 4 or 5 to depolarize VSMCs. We provide new evidence that a voltage-gated K+ channel in mesenteric VSMCs is activated by osmotic stretch, and this response requires the expression of AT1aR. Our findings establish the foundation for further studies designed to identify the precise mechanism of AT1aR–mediated myogenic responsiveness, which may involve a previously unrecognized XE991-sensitive Kv channel distinct from KCNQ3, 4 or 5 as a therapeutic target to alleviate anomalous myogenic tone.

DOI: 10.1161/CIRCRESAHA.115.302882 Downloaded from http://circres.ahajournals.org/ at University of Virginia on June 22, 2014

16

Downloaded from http://circres.ahajournals.org/ at University of Virginia on June 22, 2014

Downloaded from http://circres.ahajournals.org/ at University of Virginia on June 22, 2014

Downloaded from http://circres.ahajournals.org/ at University of Virginia on June 22, 2014

Downloaded from http://circres.ahajournals.org/ at University of Virginia on June 22, 2014

Downloaded from http://circres.ahajournals.org/ at University of Virginia on June 22, 2014

Downloaded from http://circres.ahajournals.org/ at University of Virginia on June 22, 2014

Downloaded from http://circres.ahajournals.org/ at University of Virginia on June 22, 2014

Downloaded from http://circres.ahajournals.org/ at University of Virginia on June 22, 2014

Downloaded from http://circres.ahajournals.org/ at University of Virginia on June 22, 2014

0.6

E

-4

C

Agtr1a

150

Agtr1a

0.8 1.0 1.2

+/+ -/1.4

- 14

100nM

Losartan 1.6

-6

-8

- 10

- 12

* 1µM

0

+/+

D

-/-

100

* *

50

0 1.8

Agtr1a

0

-2

+/+ -/2.0

F 100

25

- 25

10min

+/+

0

+/+

0 Ca

Agtr1a Losartan 1µM

Losartan 100nM

1.9 ml/min

1.3 ml/min

50mmHg

B 0.7 ml/min

0.3 ml/min

0 Ca

Losartan 1µM

+/+

Change in perfusion pressure [mmHg]

1.9 ml/min

1.3 ml/min

Agtr1a

Losartan 100nM

0.7 ml/min

0.3 ml/min

10min

50mmHg

Online Figure I

Change in perfusion pressure [mmHg]

Perfusion pressure [mmHg]

A

Change in perfusion pressure [mmHg]

Supplemental Material

Renal -/-

0

Ang II 100nM

75

50

-/*

Agtr1a

Flow [ml/min]

Agtr1a

0

* -/-

- 50

- 75

Ca2+-free

Online Figure I

G

Renal Change in perfusion pressure [mmHg]

Agt -/-

Agt+/+

0

20

40

n.s. 60

PSS Ca2+-free

Online Figure I. A,B: Flow-induced increase in perfusion pressure in isolated perfused kidneys of wild type Agtr1a+/+ (A) and Agtr1a-/- mice (B). C: Perfusion pressure in Agtr1a+/+ (WT, n=8) and Agtr1a-/- kidneys (n=7) measured at flow rates of 0.7, 1.3, and 1.9 mL/min. D: Increases in perfusion pressure induced by 100 nM Ang II in isolated perfused kidneys of Agtr1a+/+ (n=7) and Agtr1a-/- (n=7) mice. E: Decrease of perfusion pressure induced by 100 nmol/L and 1 µmol/L losartan in isolated perfused kidneys of Agtr1a+/+ (n=6) and Agtr1a-/- (n=8) mice. F: Myogenic tone in isolated perfused kidneys of Agtr1a+/+ (n=6) and Agtr1a-/- mice (n=8) assessed by exposure to Ca2+-free perfusate (*, p 0.05).

Online Figure II

Renal Perfusion Pressure [ mmHg ]

A

150

Trpc6 Trpc6

+/+ -/-

100

*

50

0 0.0

0.5

1.0

1.5

2.0

B

Decrease of Perfusion Pressure [ mmHg ]

Flow [ ml/min ] Trpc6 Trpc6

+/+ -/-

n.s. 30

20

10

0

Ca2+-free

Online Figure II. Flow-induced increase in perfusion pressure in isolated perfused kidneys of wild type Trpc6+/+ and Trpc6-/- mice. A: Perfusion pressure in Trpc6+/+ (n=7) and Trpc6-/- kidneys (n=9) measured at flow rates of 0.3, 0.7, 1.3, and 1.9 ml/min (*, p 0.05).

Online Figure III

Mesenteric A

B

XE991 20 mV

Control

200 pA

-60 mV

-60 mV

+60 mV

0

-20 mV -100 mV

C

0

100 ms

100 ms

+60 mV -20 mV -100 mV

200 pA

Control

20 mV

XE991 0 mV

0 pA

Online Figure III. Suppression of Kv current by XE991 (30 µmol/L) in mesenteric VSMCs. A,B: Representative families of whole-cell Kv currents in the absence (Control) and presence of XE991. Voltage clamp protocol included test steps (500 ms) to between - 100 and +60 mV in 20-mV increments. Holding potential was -60 mV; test pulse frequency, 1/20 s. C: Current-voltage (I–V) relations for the Kv current in the absence (Control) and presence of XE991.

Online Figure IV

Mesenteric Normalized Current

A

(4) (4) (5) (5)

(4)

(6)

1

10

(8)

(4)

(6)

(6)

(7)

(5)

1.0

0.5

0.0 0.01

0.1

1

[XE991] (µmol/L)

10 100 [4-AP] (µmol/L)

1000

Renal Perfusion pressure [mmHg]

B 250 200

Control +XE991 30µmol/L +XE991 100nmol/L

150

* *

100

*

50 0 0.0

0.5

1.0

1.5

2.0

Flow [ ml/min] Online Figure IV. A : C oncentration-response curves for K v current inhibition by XE991 and 4-AP. Cells were exposed to the blocking drugs for ~20 min at each concentration. Numbers in parentheses, numbers of cells tested. B : Increases in perfusion pressure of isolated kidneys by 100 nmol/L XE991 (n=6) and 30 µmol/L X E991 (n=10), compared to control (n=14). *, P < 0.05. No difference between the effects of 100 nmol/L and 30 µmol/L XE991; P > 0.05.

Online Figure V

A

Control

XE991 100 nmol/L

KV1.2 100 ms 2 nA 0

B KV1.5 100 ms 5 nA 0

C

(4)

(6)

Kv1.2

Kv1.5

I/I0

1.0

0.5

0.0

Online Figure V. Effect of XE991 on currents attributed to heterologously expressed Kv1.2 and Kv1.5 channels in HEK293 cells. A,B: Representative families of whole-cell K v currents in the absence (Control) and presence of 100 nmol/L XE991. Test pulses (500 ms) to voltages between - 100 and +60 mV in 20-mV increments. Holding potential was -60 mV; test pulse frequency, 1/30 s. C: Mean ± SEM of current inhibition; I, Io currents in the presence and absence of XE991, respectively (n.s., P > 0.05). HEK293 cells were transfected using Roti®-Fect according to the vendor’s instructions.

Online Figure VI

A Current (nA)

B

100 ms 40 mV

Control

150 100

Control

XE991

50 0 -100

C

-50

0

50

Voltage (mV)

1.0

100 ms

20 mV 40 mV 60 mV

100 pA

XE991

I/I0

0

0.5

0

0.0 50 nM 100 nM

1 µM

XE991

Online Figure VI

E

100 ms 40 mV

Control

Current (pA)

D

Control

600 400 200

4-AP

0 -100

100 ms 100 pA

0

Voltage (mV)

F 1.0

4-AP

I/I0

0

20 mV 40 mV 60 mV

0.5

0.0 0

2 µM

20 µM

200 µM

4-AP

2 mM

Online Figure VI

G 40

Myogenic tone [%]

Kcnq5

+/+

Kcnq5dn/dn

30 20 10 0 0

20

40

60

80

100

mmHg

Online Figure VI. Voltage-dependent properties of the XE991 (A, B, C) and the 4-AP (D, E, F) sensitive Kv currents in VSMCs isolated from MA of WT mice. The voltage protocol in shown in the inset. I/I0, peak outward currents in the presence and absence of the drugs, respectively. P>0.05 between groups (n>4). The small zero (e.g. “0”) in panel D indicates baseline current. Myogenic tone was not significantly different between MA of Kcnq5+/+ (n=5) and Kcnq5dn/dn (n=4) mice (G).

Online Figure VII 50 0 -50 -100

+/+

200

dn/dn

Kcnq5

400

Control

Control

200

100

XE991 XE991 + 4-AP

XE991 XE991 + 4-AP

0

0 0.0 400

0.1

Kcnq4

0.2

0.0

0.3

0.1

0.2

-/-

-/-

200

Control

400

XE991

200

Kcnq4 /5

0.3

dn/dn Control XE991

XE991 + 4-AP

XE991 + 4-AP

0

0 0.1 0.2 Time (ms)

XE991 (8)

*

*

(10) *

(8)

50

0.3

100

(7)

(6)

(7)

(7)

* 50

(8)

(4)

(16)

(12)

n

nq Kc

5 dn /d n Kc

nq

nq

+/

+

4 -/-

0

4 5 dn //d /

50

n

4 -//d / 5 dn

nq Kc

5 dn /d n nq Kc

Kc nq 4 -/-

4 5 dn //d / n

nq Kc

Kc

nq

Kc

nq

5 dn

/d n

4 -/-

+ +/

XE991 + 4-AP

+

0

0

100

0.1 0.2 Time (ms)

4-AP

+/

Inhibition [%]

100

* (7)

0.0

0.3

Inhibition [%]

0.0

Inhibition [%]

Current (pA)

50 0 -50 -100

Kc

Current (pA) Voltage (mV)

Mesenteric

Online Figure VII. Suppression of Kv current by XE991 and 4-aminoypridine (4-AP) in mesenteric VSMCs. Myocytes were freshly isolated from control wild-type, Kcnq4-/-, Kcnq5dn/dn and Kcnq4-/-/Kcnq5dn/dn mice. Upper panels, representative families of wholecell Kv currents in the absence (Control) and presence of 30 µM XE991 and presence of 30 µmol/L XE991 + 2 mmol/L 4-AP. Voltage clamp protocol included test steps (200 ms) to 20 mV. Holding potential was -60 mV; test pulse frequency, 1/20 s. Lower panels, Percent current inhibition by 30 µmol/L XE991, 2 mmol/L 4AP, and 30 µmol/L XE991 + 2 mmol/L 4-AP.* P < 0.05, otherwise P>0.05 between groups.

Online Figure VIII 10 µM HMR1556 30 µM XE991

A

300

200

+20 mV

3000 -60 0.00mV

0.10

0.20

100

c

0.30

b a c

100

100 pA

Current (pA)

b

a

50 ms

0

0 0

10

20

30

10

* 5

XE 99 1

H

C

M R

15 56

tro

l

0

on

Peak current (pA/pF)

Time (min)

a

b

600 0+20 mV 0.00mV -60

400

200 pA

Current (pA)

B

10 µM Chromanol293B 30 µM XE991

0.00

200

0.10

0.20

50 ms

b0.30 a c

c

0 0

10

20

Time (min)

30

Online Figure VIII

25µm

C 40 mmHg

60 mmHg

100 mmHg

80 mmHg

0 Ca/EDTA Chromanol 293B 10 µM

300s 15 mmHg

20 mmHg

Wash-out Before

125µm

D

E Control Chromanol 293B 10 µM

30

30

*

*

20 10

Myogenic tone (%)

40

Myogenic tone (%)

+Ca2+

Control HMR1556 10 µM

20

* *

10

0

0 0

20

40

60

mmHg

80

100

0

20

40

60

80

100

mmHg

O n line F igu re VIII. E ffects of KCN Q1 channel blockers H M R1556 and chromanol 293B on X E991sensitive K v currents in m esenteric VS M Cs (A , B ) and m yogenic tone of M A (C ,D,E). A : Representative tim e course of peak curr ent am plitudes and corresponding K v cur rent traces (insets) in the absence (a) and pr esence of 10 µM HM R 1556 (b) and 10 µM HM R 1556 plus 30 µm ol/L XE 991 (c) ( left panel). Voltage clamp protocol included test steps (200 ms ) to 20 m V. Holding potential was 60 m V; tes t pulse f requency, 1/20 s. Lower pan el, peak current bef or e application of the drugs (C ontr ol, n=10), af ter cum ulative addition of HM R1556 ( n=10, P >0.05) and XE 991 (n=9). *, P < 0.05. B: R epresentative tim e course of cur rent amplitudes and cor responding K v current tr aces (ins et) in the absence ( a) and pr esence of 10 µM chrom anol 293B (b) and 10 µM chrom anol 293B plus 30 µm ol/L X E991 (c) . C: Representative recordings of M A diam eter dur ing a s er ies of pressure steps fr om 15 to between 20 and 100 m m Hg in 20 m m Hg incr em ents in C a 2+ -containing Kr ebs–Henseleit (+Ca 2+ ) solution before application of chromanol 293B ( Before), in the pr esence of chrom anol 293B 10 µm ol/L in K rebs–Henseleit ( +Ca 2+) solution, in C a 2+-fr ee solution ( 0 Ca/E DTA ) Krebs–Henseleit solution, and after wash-out of 0 Ca/EDT A and chr om anol 293B/ using Kr ebs–Henseleit (+Ca 2+ ) solution. D : Average myogenic constriction of M A in the absence and pr esence of 10 µm ol/L chrom anol 293B (n=5 each). E : A ver age m yogenic cons triction of M A in the abs ence and 10 µm ol/L HM R1556 (n=5 each). * P < 0.05, otherwise P >0.05. C hromanol 293B was obtained from T ocris Bioscience, B ristol, UK .

Online Figure IX KCNQ1 bp

KCNQ2

KCNQ3

KCNQ4

KCNQ5 bp

Br MA RA Br MA RA Br MA RA Br MA RA Br MA RA

1000

1000

500

500

200

200 Ladder

Ladder

Online Figure IX. Reverse transcription (RT)-PCR detection of KCNQ1 (322 bp), KCNQ2 (418 bp), KCNQ3 (330 bp), KCNQ4 (383 bp) and KCNQ5 (386 bp) transcripts in brain (positive control), mesenteric arteries (MA) and renal arteries (RA) of wild-type C57/BL6 mice. Brain (n=4), MA (n=4; each pooled from 2-3 mice/sample), and RA (n=1; pooled from 5 mice). The following primer sequences (5’-3’) were used for the amplification of specific fragments from the first-strand synthesis after ensuring high amplification efficiency: KCNQ1, F: GTGCGCATTAAAGAACTACAGAGAAGGCTGG; R:GCACAGTCAGTTGTTCGTAGGTGGGCAGG; KCNQ2, F: CATCCTGGCCTCATTTCTGGTGTACTTGGC; R: GGAGGCCCCATAGGTTTGAGTTTGTGAGC; KCNQ3, F: GCTCAGGACTGGCACTGAAGGTTCAGGAGC; R: TTGGCTCTTTGGAAGGGCTTTCTTCTATGG; KCNQ4, F: GCTATGGTGACAAGACGCCACATACATGGC; R: GTAGCGAGAGGGCGCTCCATCAGGTACTGGC; KCNQ5, F: CTTCCTTGTCTATCTTGTGGAAAAGGATGC; R: GTTCTTTCTTGGTAGGGCTGCAGGTGTGCAAGGC. RT-PCR was performed using a hot-start iTaq™ DNA polymerase (BIO-RAD, Hercules, USA), 10 picomoles of each primer pair and 2 µl of cDNA template in a 25 µl reaction. Negative control, RNA instead of cDNA. The integrity of PCR products was verified by dissociation curve analysis and verifying PCR product size on 1.5% agarose gels.

Online Figure X KCNQ bp

1

2

3

4

5

1000 500 300 100 Ladder

Online Figure X. Reverse transcription (RT)-PCR detection of KCNQ1, -2, -3, -4 and -5 transcripts in isolated VSMCs from mesenteric arteries (MA) of wild-type C57/BL6 mice. MA were enzymatically digested and ~ 60-80 VSMCs were aspirated into a 1X PBS-filled borosilicate glass micropipette under the microscope. Total RNA preparation and cDNA synthesis were performed using the Single Cell Real-Time RT-PCR Assay Kit (Signosis, Sunnyvale, CA) and following commercial instructions. cDNA products were amplified by nested PCR using the following primer sequences (5’-3’) for first-round PCR amplification: KCNQ1, F: AAGAAATTCCAGCAAGCACGG; R: TTTACCCTGGACCTCCCTTCT; KCNQ2, F: CTGGAAGCTCTTGGGATCGG; R: CTCCAGCTGGTTCAGAGGTG; KCNQ3, F: TATGCAGATGCTCTGTGGTGG; R: GGAAGTCATTCCCATAGCCCC; KCNQ4, F: CTATGCCGACTCGCTCTGG; R: TGCTTATGCGGATTCGGTCTT; KCNQ5, F: ATCACAGCCTGGTACATTGGA; R: CTGACTGCTTGATGCCTCCC. Second-round PCR amplification was performed using primers described in Figure S7. The integrity of PCR products was verified by dissociation curve analysis and verifying PCR product size on 1.5% agarose gels.

Online Table I

Genotype

MAP

HF

Peripheral resistance Reference

Agtr1a-/-

-21 to -27 mmHg

N or -93 beats/min

Decreased

1-4

Agt-/-

-25 mmHg

N

Decreased

5, 6

TRPC6-/-

+7 mmHg

N

Increased

7

SM Gq/11-/-

-14 mmHg

ND

Decreased

8

MAP, mean arterial pressure; HF, heart frequency; N, normal; ND, not defined;, SM, smooth muscle; -, reduction, + increase in MAP.

1.

2.

3.

4.

5.

6. 7.

8.

Ito M, Oliverio MI, Mannon PJ, Best CF, Maeda N, Smithies O, Coffman TM. Regulation of blood pressure by the type 1A angiotensin II receptor gene. Proc Natl Acad Sci U S A. 1995;92:3521-3525. Sugaya T, Nishimatsu S, Tanimoto K, Takimoto E, Yamagishi T, Imamura K, Goto S, Imaizumi K, Hisada Y, Otsuka A, et al. Angiotensin II type 1a receptor-deficient mice with hypotension and hyperreninemia. J Biol Chem. 1995;270:18719-18722. Davern PJ, Chen D, Head GA, Chavez CA, Walther T, Mayorov DN. Role of angiotensin II Type 1A receptors in cardiovascular reactivity and neuronal activation after aversive stress in mice. Hypertension. 2009;54:1262-1268. Chen Y, Joaquim LF, Farah VM, Wichi RB, Fazan R, Jr., Salgado HC, Morris M. Cardiovascular autonomic control in mice lacking angiotensin AT1a receptors. Am J Physiol Regul Integr Comp Physiol. 2005;288:R1071-1077. Chen D, Hazelwood L, Walker LL, Oldfield BJ, McKinley MJ, Allen AM. Changes in angiotensin type 1 receptor binding and angiotensin-induced pressor responses in the rostral ventrolateral medulla of angiotensinogen knockout mice. Am J Physiol Regul Integr Comp Physiol. 2010;298:R411-418. Stec DE, Keen HL, Sigmund CD. Lower blood pressure in floxed angiotensinogen mice after adenoviral delivery of Cre-recombinase. Hypertension. 2002;39:629-633. Dietrich A, Mederos YSM, Gollasch M, Gross V, Storch U, Dubrovska G, Obst M, Yildirim E, Salanova B, Kalwa H, Essin K, Pinkenburg O, Luft FC, Gudermann T, Birnbaumer L. Increased vascular smooth muscle contractility in TRPC6-/- mice. Mol Cell Biol. 2005;25:6980-6989. Wirth A, Benyo Z, Lukasova M, Leutgeb B, Wettschureck N, Gorbey S, Orsy P, Horvath B, Maser-Gluth C, Greiner E, Lemmer B, Schutz G, Gutkind JS, Offermanns S. G12-G13-LARG-mediated signaling in vascular smooth muscle is required for saltinduced hypertension. Nat Med. 2008;14:64-68.