k./ 1991 Oxford University Press
Nucleic Acids Research, Vol. 19, No. 25 7073-7079
Structural analysis of the human papillomavirus type 16-E2 transactivator with antipeptide antibodies reveals a high mobility region linking the transactivation and the DNAbinding domains Jean-Michel Gauthier, Joakim Dillner1 and Moshe Yaniv* Unite des Virus Oncogenes, Departement des Biotechnologies, Institut Pasteur, 25 rue du Dr Roux, 75724 Paris cedex 15, France and 1Department of Virology, Karolinska Institutet, SBL, S-105 21, Stockolm, Sweden
ABSTRACT In order to probe the structure of the transcription factor encoded by the E2 Open Reading Frame of papillomaviruses, we raised polyclonal antibodies against a series of synthetic peptides that cover the HPV16-E2 protein. In gel shift experiments with the native form of the protein, we detected supershifts (caused by the binding of antibodies to the E2-DNA complex) with antibodies synthesized against peptides covering a central region 50 residues long in the E2 protein. On the contrary, antibodies raised against peptides from the NH2- and COOH-termini did not give any supershifted band. Western blot experiments showed that several of these non reacting antibodies did however interact with the denatured protein. These results suggest that the central region that connects the NH2-terminal domain responsible for transcriptional activation and the COOH-domain involved in DNA-binding is exposed and maintained in a conformation resembling the peptide, indicating a high mobility region. In contrast, the DNA-binding and transactivation domains were not recognized by the antipeptide antibodies, in line with secondary structure predictions and sequence comparisons indicating that the E2 protein consists of structured and conserved NH2 and COOH-terminal regions separated by a nonconserved and unstructured region. This flexible 'hinge' region may facilitate contacts between E2 dimers at distance in mechanisms of transcriptional activation steps that involve homosynergy or DNAlooping. INTRODUCTION A considerable body of information on gene regulatory proteins that control the rate of transcription initiation has been obtained during the past few years. In particular, advances in molecular cloning and recombinant DNA methodologies have allowed the mapping of functional domains in eukaryotic transcription factors. *
To whom correspondence should be addressed
In a number of these studies, it has been shown that transcription factors are frequently composed of separable regions involved in distinct functions such as dimerization, DNA-binding, ligand binding or transcriptional activation (1-4). The products of the E2 ORF of papillomavirus are transcriptional regulators that bind as dimers to the palindromic motif ACCGN4CGGT present in multiple copies in papillomavirus genomes (5-7). It has been shown by analysing the effect of insertion and deletion mutations in the E2 gene that the DNA-binding domain is located in the COOH-terminal part of the protein whereas the NH2-terminal part is involved in transcriptional activation (6-8). This is consistent with the fact that the 3' end of the BPV1-E2 ORF codes for a truncated protein that can still bind to an E2 DNA-binding site and that probably represses transcription by binding competition with the full length protein (9). Secondary structure predictions on various E2 proteins have corroborated these results by separating the protein into three domains (8): the NH2-terminal domain contains potential (3 strands, amphiphilic a helices and acidic regions that have been implicated in transcriptional activation (10-13). The COOH-terminal domain, rich in basic residues, was predicted to contain alternating ca helices and (3 sheets although it has no obvious characteristics of known DNA-binding structures. Finally, the central region seems to be unstructured with several proline residues that have a low probability of taking part in an organized structure. Antibodies have often been used to study structure-function relationships of proteins (14). For instance, antipeptide antibodies are useful tools for determining the topology of membrane-bound proteins (14-16). Areas of an intact protein that react with antipepeptide antibodies have been shown to correspond with areas with greater than average atomic mobility (17-19). This mobility of the antigenic site allows it to resemble the more flexible peptide. Since short synthetic peptides have a low probability of assuming secondary structure, but rather adopt a variety of random conformations in solution, antipeptide antibodies should not recognize conformational (or discontinuous) epitopes but would rather allow the detection of the sequential
7074 Nucleic Acids Research, Vol. 19, No.
25
(or continuous) epitopes of the protein (14, 20-24). In an attempt we have used an analogous approach. Polyclonal antibodies were raisd against a series of synthetic peptides that cover the human papiomvirus type 16 (HPV16) E2 transcriptional activator. We have tlen ested these antibodies with the HPV16-E2 protein in its nativer context by gel shift assays and in a denatured conformation by western blot experiments. The data obtained, in correlation with stctre predictions and sequence homologies between the E2 proteins of genital HPVs, show that the central hinge region is a domain of high mobility that links two structured regions. to probe the structure of a transcription factor,
MATERIALS AND METHODS Peptide synthesis 24 synthetic peptides representing the deduced amino acid sequence of the E2 ORFs of HPV 16 (25) were synthesized as peptide amides using t-Boc amino acids (Bachem AG, Bubendorf, Switzerland) and p-methylbenzhydrylamine resin (Fluka AG, Buchs, Switzerland) according to the multiple solid phase peptide synthesis method (26). Removal of the protecting groups from the formyl-tryptophan and methionine sulfoxide residues was achieved by cleavage with 25% hydrogen fluoride (27). The peptides were then cleaved from the resin with liquid hydrogen fluoride using a multivessel apparatus (28). Peptides were analyzed for purity by HPLC by use of a Vydac C4 column. The peptides were assigned consecutive numbers, starting with the amino-terminal peptide (peptide E2: 1) and continuing up to the carboxy-terminal peptide (peptide E2:24). The corresponding sera were designated respectively A10-35 (for peptide E2: 1) to A1O-58 (for peptide E2:24). The overlap between these peptides was in all cases 5 amino acids and all peptides were 20 amino acids long, except the amino-terminal peptide (peptide E2: 1) that contained 19 residues. The use of these peptides for HPV serology has been described previously (29). In addition to the overlapping set of peptides, we also synthesized three peptides (designated 145-10, 245 and 237) from regions that were predicted to be antigenic (30). ELISA The synthetic peptides were diluted in 10 mM carbonate buffer, pH 9.6 and added to half-area (50 ul/well) microtiter plates (Costar) at a concentration of 20 ,ug peptide/ml. The plates were kept at room temperature overnight. After one wash with PBS-0.05% Tween 20 (PBS-T) the plates were blocked with 10% lamb serum (heat inactivated; Flow) in PBS (LS-PBS) and incubated for 60 minutes at 37°C. The blocking solution was then discarded. Rabbit or guinea pig immune or preimmune sera were diluted at 1:10 and in consecutive 2-fold dilutions up to 1:5120 in LS-PBS, added to the plates and allowed to react for 120 minutes at room temperature. The plates were then washed five times with PBS-T. To detect bound antibodies, we used a horseradish peroxidase labeled antibody against rabbit IgG or against guinea pig IgG (Dako) diluted 1:2000 in LS-PBS, which was incubated on the plates for 60 minutes at room temperature. The plates were then washed five times with PBS-T and developed with 20 mg/ml 2,2'-azino-di (3-ethylbenzthiazolinsulfonat (6)) deammonium salt (ABTS) diluted 1:50 in 0.1 M citrate buffer, pH 4 with 0.9% hydrogen peroxide. The absorbances were recorded at 415 nm after 60 minutes. The ELISA
absorbances
of the
immune sera were subtracted
with
the absorbances of the same serum reacted with uncoated wells
and with the absorbance obtained with the serum from the same animal before immunization when reacted with the same peptide, The titer was defined as the last dilution of serum that produced an ELISA absorbance of at least 50% of maximum absorbance.
Immunztion Before immunization, the peptides were coupled to the carrier protein keyhole limpet hemocyanin (KLH). Cysteine-conaing peptides were coupled using the thiol group-specific reagent mmaleimibobenzoyl-N-hydroxysuccinimid ester, as described (31). The other peptides were coupled to carrier by mixing a solution of 1 mg/ml of peptide, 1 mg/ml of KLH and 0.025{% glutaraldehyde overnight at room temperature. On the day before immunization, a negative control serum was obtained from all animals. Rabbits were then injected subcutaneously with 200 ,ug of peptide conjugate emulsified in Freunds complete adjuvant. Guinea pigs received 100 ,ug of conjugate. 14 and 28 days later, the animals were boostered with the same amount of antigen emulsified in Freunds incomplete adjuvant. Animals were bled 10 days after the last booster.
HPV16&E2 in vitro synthesis and gd
tion amys The in vitro translated protein used for the band shift assays was expressed from plasmid T7f3E216. The HPV16-E2 ORF contained in pGEM-2 (a kind gift of Alison McBride and Peter Howley) was amplified by PCR in order to create an NcoI site Table 1. Characteristics of the immunizing peptides and the corresponding sera used in this study. HPV16-E2 residues contained in the
Immune Sera
immunizing peptide Titera
Hydrophilicityb
A1O-35 A10-36 A1O-37 A1O-38 A1O-39 A1040 A1O-41 A1O-42 A1043 A1O-44 A1O-45 A1O-46 A1O-47 A1O-48 A1O-48 AO-S50 AIO-51 A1O-52 A1O-53 A1O-54 A1O-550 A1O-56 A1O-57 A1O-58 145-10* 245* 237*
2-20 16-35 31-50 46-65 61-80 76-95 91-110 106-125 121-140 136-155 151-170 166-185 181-200 196-215 211-230 226-245 241-260 256-275 271-290 286-305 301-320 316-335 331-350 346-365 284-300 328-345 336-353
+0.30 +1.75 +0.57 +0.15
>5120 >5120 80
>5120 >5120 >5120 >5120 >5120 ND ND 5120 >5120 > 5120 < 10 5120 > 5120 > 5120 >5120 640 40, 160 20 >5120 160 >5120 5120 2560
-0.06 +1.17 -0.34 +0.52 +0.64 -0.41 +0.26 +1.52
-0.62 +0.29 +0.54 +1.10 +1.30 -0.17 +1.21 +0.25 +0.40 +1.10 +1.11 -0.36 +0.10 +1.37 +0.10
aThe titer was defined as detailed in the Materials and Methods. bThe hydrophilicity mean of the immunizing peptides was calculated using the method described by Kite and Doolittle (38). *Sera obtained from rabbit. 'Sera obtained from guinea pig and rabbit. The two given titers correspond respectively to the guinea pig and rabbit serum. All the other sera were obtained from guinea pigs.
Nucleic Acids Research, Vol. 19, No. 25 7075 salmon sperm DNA in 15 /1 of binding buffer, 10 mM Hepes, pH 8.0, 60 mM KCl, 4 mM MgCl2, 0.1 mM EDTA, 4 mM spermidine, and 20% glycerol. Then 1 ng of 32P-labeled probe was added and the mixture further incubated for 2 mn. The immune or pre-immune sera were also added only after 2 mn of incubation of HPV16-E2 with the probe. The mix was then incubated for 20 additional mn before loading on gel. The sequence of the probe was:
at the start codon and a BamH1 site at the end of the ORF. This NcoI/BamHl fragment was cloned in the T7(3c-jun plasmid deleted of the NcoI/BamHl fragment encoding c-Jun (32). Thus, the HPV16-E2 RNA was transcribed from the T7 promoter of pT73E216 with the 3-globin translation leader. The protein was synthesized with a rabbit reticulocyte lysate (NEN DuPont) as already described (32). It is notable that only kits of particularly high yields (giving 10 times more proteins than average kits for c-Jun or BPV 1-E2 for instance) were efficient enough to produce sufficient quantities of HPV16-E2 to allow good retardation assays. The translated proteins (2 141 of the non-labelled translated reaction mix to avoid background due to 35S) were preincubated at room temperature for 20 mn with 1 A1 of immune or preimmune serum, 1.5 ltg of Poly dI-dC and 1 ptg of sonicated A
CTAGTGACCGAAAACGGTCGGCGCTGACTCAGATT ACTGGCTTTTGCCAGCCGCGACTGAGTCTAAGATC
The probe was labeled by filling in the recessed 3' ends of the oligonucleotide with [ca32P]dATP, dCTP, dGTP, dTTP. The reaction mixture was loaded on a 6% polyacrylamide gel that
B
+ IIPVI6-f,E2 o r-
:,r-
17. 1.1 t,
.,;. .:.
L;. ;X
;L;
i!
-
c-i
r, r- x =
-
ri
-,
-t w-,
,- t-x
-
17, IT -It -T -t -t -T "-I, W.l 1.1 Irl 1.1 1.1 r, 117, I-rI=
C-1= c c c c 11:11 1= c = C-- .z = c = - -
C-- C'--
ell
-,,,c
:. .: :. :;,. :.. :.. :.. -
Nucleic Acids Research, Vol. 19, No. 25 7073-7079
Structural analysis of the human papillomavirus type 16-E2 transactivator with antipeptide antibodies reveals a high mobility region linking the transactivation and the DNAbinding domains Jean-Michel Gauthier, Joakim Dillner1 and Moshe Yaniv* Unite des Virus Oncogenes, Departement des Biotechnologies, Institut Pasteur, 25 rue du Dr Roux, 75724 Paris cedex 15, France and 1Department of Virology, Karolinska Institutet, SBL, S-105 21, Stockolm, Sweden
ABSTRACT In order to probe the structure of the transcription factor encoded by the E2 Open Reading Frame of papillomaviruses, we raised polyclonal antibodies against a series of synthetic peptides that cover the HPV16-E2 protein. In gel shift experiments with the native form of the protein, we detected supershifts (caused by the binding of antibodies to the E2-DNA complex) with antibodies synthesized against peptides covering a central region 50 residues long in the E2 protein. On the contrary, antibodies raised against peptides from the NH2- and COOH-termini did not give any supershifted band. Western blot experiments showed that several of these non reacting antibodies did however interact with the denatured protein. These results suggest that the central region that connects the NH2-terminal domain responsible for transcriptional activation and the COOH-domain involved in DNA-binding is exposed and maintained in a conformation resembling the peptide, indicating a high mobility region. In contrast, the DNA-binding and transactivation domains were not recognized by the antipeptide antibodies, in line with secondary structure predictions and sequence comparisons indicating that the E2 protein consists of structured and conserved NH2 and COOH-terminal regions separated by a nonconserved and unstructured region. This flexible 'hinge' region may facilitate contacts between E2 dimers at distance in mechanisms of transcriptional activation steps that involve homosynergy or DNAlooping. INTRODUCTION A considerable body of information on gene regulatory proteins that control the rate of transcription initiation has been obtained during the past few years. In particular, advances in molecular cloning and recombinant DNA methodologies have allowed the mapping of functional domains in eukaryotic transcription factors. *
To whom correspondence should be addressed
In a number of these studies, it has been shown that transcription factors are frequently composed of separable regions involved in distinct functions such as dimerization, DNA-binding, ligand binding or transcriptional activation (1-4). The products of the E2 ORF of papillomavirus are transcriptional regulators that bind as dimers to the palindromic motif ACCGN4CGGT present in multiple copies in papillomavirus genomes (5-7). It has been shown by analysing the effect of insertion and deletion mutations in the E2 gene that the DNA-binding domain is located in the COOH-terminal part of the protein whereas the NH2-terminal part is involved in transcriptional activation (6-8). This is consistent with the fact that the 3' end of the BPV1-E2 ORF codes for a truncated protein that can still bind to an E2 DNA-binding site and that probably represses transcription by binding competition with the full length protein (9). Secondary structure predictions on various E2 proteins have corroborated these results by separating the protein into three domains (8): the NH2-terminal domain contains potential (3 strands, amphiphilic a helices and acidic regions that have been implicated in transcriptional activation (10-13). The COOH-terminal domain, rich in basic residues, was predicted to contain alternating ca helices and (3 sheets although it has no obvious characteristics of known DNA-binding structures. Finally, the central region seems to be unstructured with several proline residues that have a low probability of taking part in an organized structure. Antibodies have often been used to study structure-function relationships of proteins (14). For instance, antipeptide antibodies are useful tools for determining the topology of membrane-bound proteins (14-16). Areas of an intact protein that react with antipepeptide antibodies have been shown to correspond with areas with greater than average atomic mobility (17-19). This mobility of the antigenic site allows it to resemble the more flexible peptide. Since short synthetic peptides have a low probability of assuming secondary structure, but rather adopt a variety of random conformations in solution, antipeptide antibodies should not recognize conformational (or discontinuous) epitopes but would rather allow the detection of the sequential
7074 Nucleic Acids Research, Vol. 19, No.
25
(or continuous) epitopes of the protein (14, 20-24). In an attempt we have used an analogous approach. Polyclonal antibodies were raisd against a series of synthetic peptides that cover the human papiomvirus type 16 (HPV16) E2 transcriptional activator. We have tlen ested these antibodies with the HPV16-E2 protein in its nativer context by gel shift assays and in a denatured conformation by western blot experiments. The data obtained, in correlation with stctre predictions and sequence homologies between the E2 proteins of genital HPVs, show that the central hinge region is a domain of high mobility that links two structured regions. to probe the structure of a transcription factor,
MATERIALS AND METHODS Peptide synthesis 24 synthetic peptides representing the deduced amino acid sequence of the E2 ORFs of HPV 16 (25) were synthesized as peptide amides using t-Boc amino acids (Bachem AG, Bubendorf, Switzerland) and p-methylbenzhydrylamine resin (Fluka AG, Buchs, Switzerland) according to the multiple solid phase peptide synthesis method (26). Removal of the protecting groups from the formyl-tryptophan and methionine sulfoxide residues was achieved by cleavage with 25% hydrogen fluoride (27). The peptides were then cleaved from the resin with liquid hydrogen fluoride using a multivessel apparatus (28). Peptides were analyzed for purity by HPLC by use of a Vydac C4 column. The peptides were assigned consecutive numbers, starting with the amino-terminal peptide (peptide E2: 1) and continuing up to the carboxy-terminal peptide (peptide E2:24). The corresponding sera were designated respectively A10-35 (for peptide E2: 1) to A1O-58 (for peptide E2:24). The overlap between these peptides was in all cases 5 amino acids and all peptides were 20 amino acids long, except the amino-terminal peptide (peptide E2: 1) that contained 19 residues. The use of these peptides for HPV serology has been described previously (29). In addition to the overlapping set of peptides, we also synthesized three peptides (designated 145-10, 245 and 237) from regions that were predicted to be antigenic (30). ELISA The synthetic peptides were diluted in 10 mM carbonate buffer, pH 9.6 and added to half-area (50 ul/well) microtiter plates (Costar) at a concentration of 20 ,ug peptide/ml. The plates were kept at room temperature overnight. After one wash with PBS-0.05% Tween 20 (PBS-T) the plates were blocked with 10% lamb serum (heat inactivated; Flow) in PBS (LS-PBS) and incubated for 60 minutes at 37°C. The blocking solution was then discarded. Rabbit or guinea pig immune or preimmune sera were diluted at 1:10 and in consecutive 2-fold dilutions up to 1:5120 in LS-PBS, added to the plates and allowed to react for 120 minutes at room temperature. The plates were then washed five times with PBS-T. To detect bound antibodies, we used a horseradish peroxidase labeled antibody against rabbit IgG or against guinea pig IgG (Dako) diluted 1:2000 in LS-PBS, which was incubated on the plates for 60 minutes at room temperature. The plates were then washed five times with PBS-T and developed with 20 mg/ml 2,2'-azino-di (3-ethylbenzthiazolinsulfonat (6)) deammonium salt (ABTS) diluted 1:50 in 0.1 M citrate buffer, pH 4 with 0.9% hydrogen peroxide. The absorbances were recorded at 415 nm after 60 minutes. The ELISA
absorbances
of the
immune sera were subtracted
with
the absorbances of the same serum reacted with uncoated wells
and with the absorbance obtained with the serum from the same animal before immunization when reacted with the same peptide, The titer was defined as the last dilution of serum that produced an ELISA absorbance of at least 50% of maximum absorbance.
Immunztion Before immunization, the peptides were coupled to the carrier protein keyhole limpet hemocyanin (KLH). Cysteine-conaing peptides were coupled using the thiol group-specific reagent mmaleimibobenzoyl-N-hydroxysuccinimid ester, as described (31). The other peptides were coupled to carrier by mixing a solution of 1 mg/ml of peptide, 1 mg/ml of KLH and 0.025{% glutaraldehyde overnight at room temperature. On the day before immunization, a negative control serum was obtained from all animals. Rabbits were then injected subcutaneously with 200 ,ug of peptide conjugate emulsified in Freunds complete adjuvant. Guinea pigs received 100 ,ug of conjugate. 14 and 28 days later, the animals were boostered with the same amount of antigen emulsified in Freunds incomplete adjuvant. Animals were bled 10 days after the last booster.
HPV16&E2 in vitro synthesis and gd
tion amys The in vitro translated protein used for the band shift assays was expressed from plasmid T7f3E216. The HPV16-E2 ORF contained in pGEM-2 (a kind gift of Alison McBride and Peter Howley) was amplified by PCR in order to create an NcoI site Table 1. Characteristics of the immunizing peptides and the corresponding sera used in this study. HPV16-E2 residues contained in the
Immune Sera
immunizing peptide Titera
Hydrophilicityb
A1O-35 A10-36 A1O-37 A1O-38 A1O-39 A1040 A1O-41 A1O-42 A1043 A1O-44 A1O-45 A1O-46 A1O-47 A1O-48 A1O-48 AO-S50 AIO-51 A1O-52 A1O-53 A1O-54 A1O-550 A1O-56 A1O-57 A1O-58 145-10* 245* 237*
2-20 16-35 31-50 46-65 61-80 76-95 91-110 106-125 121-140 136-155 151-170 166-185 181-200 196-215 211-230 226-245 241-260 256-275 271-290 286-305 301-320 316-335 331-350 346-365 284-300 328-345 336-353
+0.30 +1.75 +0.57 +0.15
>5120 >5120 80
>5120 >5120 >5120 >5120 >5120 ND ND 5120 >5120 > 5120 < 10 5120 > 5120 > 5120 >5120 640 40, 160 20 >5120 160 >5120 5120 2560
-0.06 +1.17 -0.34 +0.52 +0.64 -0.41 +0.26 +1.52
-0.62 +0.29 +0.54 +1.10 +1.30 -0.17 +1.21 +0.25 +0.40 +1.10 +1.11 -0.36 +0.10 +1.37 +0.10
aThe titer was defined as detailed in the Materials and Methods. bThe hydrophilicity mean of the immunizing peptides was calculated using the method described by Kite and Doolittle (38). *Sera obtained from rabbit. 'Sera obtained from guinea pig and rabbit. The two given titers correspond respectively to the guinea pig and rabbit serum. All the other sera were obtained from guinea pigs.
Nucleic Acids Research, Vol. 19, No. 25 7075 salmon sperm DNA in 15 /1 of binding buffer, 10 mM Hepes, pH 8.0, 60 mM KCl, 4 mM MgCl2, 0.1 mM EDTA, 4 mM spermidine, and 20% glycerol. Then 1 ng of 32P-labeled probe was added and the mixture further incubated for 2 mn. The immune or pre-immune sera were also added only after 2 mn of incubation of HPV16-E2 with the probe. The mix was then incubated for 20 additional mn before loading on gel. The sequence of the probe was:
at the start codon and a BamH1 site at the end of the ORF. This NcoI/BamHl fragment was cloned in the T7(3c-jun plasmid deleted of the NcoI/BamHl fragment encoding c-Jun (32). Thus, the HPV16-E2 RNA was transcribed from the T7 promoter of pT73E216 with the 3-globin translation leader. The protein was synthesized with a rabbit reticulocyte lysate (NEN DuPont) as already described (32). It is notable that only kits of particularly high yields (giving 10 times more proteins than average kits for c-Jun or BPV 1-E2 for instance) were efficient enough to produce sufficient quantities of HPV16-E2 to allow good retardation assays. The translated proteins (2 141 of the non-labelled translated reaction mix to avoid background due to 35S) were preincubated at room temperature for 20 mn with 1 A1 of immune or preimmune serum, 1.5 ltg of Poly dI-dC and 1 ptg of sonicated A
CTAGTGACCGAAAACGGTCGGCGCTGACTCAGATT ACTGGCTTTTGCCAGCCGCGACTGAGTCTAAGATC
The probe was labeled by filling in the recessed 3' ends of the oligonucleotide with [ca32P]dATP, dCTP, dGTP, dTTP. The reaction mixture was loaded on a 6% polyacrylamide gel that
B
+ IIPVI6-f,E2 o r-
:,r-
17. 1.1 t,
.,;. .:.
L;. ;X
;L;
i!
-
c-i
r, r- x =
-
ri
-,
-t w-,
,- t-x
-
17, IT -It -T -t -t -T "-I, W.l 1.1 Irl 1.1 1.1 r, 117, I-rI=
C-1= c c c c 11:11 1= c = C-- .z = c = - -
C-- C'--
ell
-,,,c
:. .: :. :;,. :.. :.. :.. -
