Protein Engineering, Design & Selection vol. 27 no. 10 pp. 391–397, 2014 Published online August 20, 2014 doi:10.1093/protein/gzu033
Structural basis of an engineered dual-specific antibody: conformational diversity leads to a hypervariable loop metal-binding site Sean W.Fanning1,4, Richard Walter2 and James R.Horn1,3,5 1
Department of Chemistry and Biochemistry, Northern Illinois University, DeKalb, IL 60115, USA, 2Shamrock Structures, LLC, 1440 Davey Road, Woodridge, IL 60517, USA, 3Center for Biochemical and Biophysical Studies, Northern Illinois University, DeKalb, IL 60115, USA and 4Current address: Ben May Department for Cancer Research, University of Chicago, 929 E. 57th St., Chicago, IL 60637, USA
5
Received February 28, 2014; revised July 16, 2014; accepted July 17, 2014 Edited by Dan Tawfik
To explore dual-specificity in a small protein interface, we previously generated a ‘metal switch’ anti-RNase A VHH antibody using a combinatorial histidine library approach. While most metal-binding sites in proteins are found within rigid secondary structure, the engineered VHH antibody (VHHmetal ), which contained three new histidine residues, possessed metal-binding residues within the flexible hypervariable loops. Here, crystal structure analysis of the free and bound states of VHHmetal reveals the structural determinants leading to dual-function. Most notably, CDR1 is observed in two distinct conformations when adopting the metal or RNase A bound states. Furthermore, mutagenesis studies revealed that one of the engineered residues, not located in the metal-binding pocket, contributed indirectly to metal recognition, likely through influencing CDR1 conformation. Despite these changes, VHHmetal possesses a relatively minor energetic penalty toward binding the original antigen, RNase A (∼1 kcal/mol), where the engineered gain-of-function metal-binding residues are observed to possess a mix of favorable and unfavorable contributions towards RNase A recognition. Ultimately, the conformationally distinct metal-switch interface architecture reflects the robust, library-based strategy used to produce VHHmetal. These results also suggest that even small protein interfaces, such as VHH, may be structurally and energetically forgiving in adopting novel function, while maintaining original function. Keywords: nanobody/phage display/promiscuous binding/ protein switch/VHH
Introduction Multi-specific (or promiscuous) proteins can play an important role in biological regulation, frequently residing at critical ‘hub’ junctures in cellular signaling pathways (Pagel et al., 2005). Consequently, there is interest in not only understanding the origins of promiscuous recognition, but also designing
# The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: [email protected]
391
Downloaded from http://peds.oxfordjournals.org/ at Rutgers University on August 16, 2015
To whom correspondence should be addressed. E-mail: [email protected]
multi-specific proteins (Erijman et al., 2011). Such multispecificity can operate through a range of mechanisms, including complex, multiple protein binding interfaces to a simple, single protein interface. When only a single protein interface is involved, the minimalist form of this phenomenon, the binding of one ligand enhances or precludes the binding of a second ligand, which can range in size from macromolecules to protons (Erijman et al., 2011; Murtaugh et al., 2011; Schonichen et al., 2013). In general, the mechanism employed by these dual-function proteins typically involves the interface undergoing significant conformational rearrangement to recognize each distinct target (James et al., 2003), thus making engineering such dual-function interfaces a considerable challenge. Furthermore, the gain of protein function is often met with adverse effects on protein stability (Beadle and Shoichet, 2002; Dellus-Gur et al., 2013). Perhaps the most commonly observed example of dualspecificity in proteins occurs in metalloproteins (Lu et al., 2009). Nature frequently exploits the rich chemistry afforded by metals for a wide range of biological functions. In fact, metal-binding sites are so prevalent in nature that up to half of all natural proteins are metalloproteins (Lu et al., 2009). Metal-binding sites have roles in enzymatic catalysis (Conti and Beavo, 2007), modulation of secondary molecular recognition events (Kerkhoff et al., 1999) and protein stabilization (Chang et al., 2002). Due to the diverse range of functional outcomes, there has been significant interest in engineering metal-binding sites into proteins. Metal-binding sites have been successfully engineered to enhance protein stability (Regan, 1993; Martin et al., 2009), modulate oligomeric states (Salgado et al., 2010a, 2011) and control enzymatic catalysis (Higaki et al., 1990). Furthermore, metals have been inserted into antibody-binding sites for the development of catalytic antibodies (Roberts et al., 1990; Crowder et al., 1995; Roberts and Getzoff, 1995). Due to the complexity of metal-binding sites, existing structural knowledge is often used to best mimic a known natural metal-binding site (Roberts et al., 1990). Both natural and engineered metal-binding sites are frequently located within areas of rigid secondary structure (e.g. a-helicies/b-strands) where as little as two residues are necessary to coordinate a metal ion (Regan, 1993; Krantz and Sosnick, 2001; Salgado et al., 2007, 2010b). The use of such rigid protein structure to host metal ion binding sites most likely improves metal ion binding affinity, as well as facilitates design efforts by providing rigid scaffolding. Hence, designing metal-binding sites within flexible loops remains a significant challenge. We previously developed a metal-switch VHH antibody using a histidine scanning combinatorial library that probed the complementarity determining regions (CDRs) of an anti-RNase A VHH antibody for potential metal-binding site (Fanning et al., 2011). The library-based method was combined with a selection strategy that identified a dual-function
S.W.Fanning et al.
Results
The structural origins of engineered metal-binding site To determine how the anti-RNase A VHH antigen interface adopted dual-recognition, the X-ray crystal structure of the ˚ resolution VHHmetal – Ni2þ complex was determined to 1.50 A (PDB: 4PPT, Table I). Based on both the electron density and anomalous difference map, the location of the Ni2þ binding site was clearly identified between CDR1 and CDR3 (Fig. 2A). The histidine side chains of both H29 (CDR1) and H110 (CDR3) are observed to directly interact with Ni2þ. Wild-type residue Q1 (N-terminus) is within contact distance with the nickel ion, although the electron density for the Q1
side is relatively weak (Fig. 2B), so it is possible a water molecule may alternatively fill this position. The observed bond ˚ for lengths from each contributing group are 2.3, 2.0 and 2.2 A O1 (Q1/H2O), N1 (H29) and N1 (H110), respectively. Two water molecules are located in plane with Q1/H2O and H29, suggesting an octahedral coordination geometry. The unobserved distal ligand is most likely a water molecule, as this position is located on the solvent-exposed face of the metalbinding site. Overall, the observed coordination geometry and bond lengths for the VHHmetal – Ni2þ complex are comparable with known Ni2þ-binding proteins (Harding, 2004, 2006; Atanassova and Zamble, 2005; Thompson et al., 2011). It is interesting to note that VHHmetal’s third metal-selected histidine residue, H33, which is located within CDR1 is not ˚ observed to directly participate in Ni2þ binding, as it is 10 A from the metal ion binding site.
Dual-function histidines: metal versus antigen interactions To understand the structural consequences of the residues par˚ resoticipating in dual-specificity, we determined a 1.75 A lution x-ray crystal structure of VHHmetal in complex with its original target, RNase A (PDB: 4POU, Table I). When compared to a crystal structure of the wild-type anti-RNase A VHH – RNase A complex (Koide et al., 2007), there is very little evidence of structural change between the two VHH interfaces (Fig. 3). Of the two histidines participating in metal binding, only H110 is observed to form a contact with RNase A. The N1 of H110 forms a hydrogen bond with the main chain carbonyl of RNase A C58, whereas the N1 of H29 appears poised to hydrogen bond with Y76 of RNase A, but is beyond ˚ ) (Fig. 4A). hydrogen bond distance (3.8 A To evaluate structural differences between conformations of the CDRs, the complex VHHmetal structures (Ni2þ and RNase A) and free VHHmetal structure (PDB: 4POY, Table I) were compared. When all the three VHHmetal structures are superimposed, significant differences are observed in the conformation of CDR1 as well as the N-terminus (Fig. 4B). In
Fig. 1. Thermodynamic model of the engineered coupled equilibria. The model includes a dual-specific VHH antibody interface that binds either a metal ion (small sphere) or the protein antigen, RNase A. A color version of this figure is available as supplementary data at PEDS Online.
392
Downloaded from http://peds.oxfordjournals.org/ at Rutgers University on August 16, 2015
variant which possessed a mutually exclusive metal-binding site (Fig. 1). The resulting engineered VHH antibody (VHHmetal ) incorporated three histidine residues within the anti-RNase A VHH CDR loops. VHHmetal possessed a moderate affinity for Ni2þ (KD ¼ 30 mM), while it retained affinity near wild-type affinity for RNase A (KD ¼ 155 mM) (Fanning et al., 2011). Most importantly, the observed affinity (Kobs) of the dualspecific interface for antigen, RNase A, was tunable by the amount of metal present (Fig. 1). Here, we examine the structural and biophysical details of dual-recognition for the engineered anti-RNase A VHHmetal antibody, which is capable of binding either RNase A or Ni2þ using the same interface loops. The structural details of the VHHmetal dual-specificity were revealed by high-resolution X-ray crystal structures of VHHmetal in each state of the linked-equilibria, while mutagenesis studies examined the roles of the corresponding metal-binding residues in the recognition of Ni2þ versus RNAse A. These results demonstrate that metal-binding sites can be incorporated into conformationally diverse regions of secondary structure and that even small protein interfaces, such as VHH, may be structurally and energetically forgiving in adopting novel function, while maintaining original function.
Engineering multi-specific antibodies: protein switches
particular, CDR1 exhibits a Ca RMSD of 3.70 between the two bound (Ni2þ and RNase A) structures, whereas CDR3 ˚ (Ca) between possesses a Ca RMSD of 0.349. There is 8.6 A CDR1 residue H29 in the RNase A structure, where it is in a more extended position, to its location forming the Ni2þ
Table I. Crystal data and refinement statistics for VHH complexes
Space group abc
VHH-metal – RNase A
VHH-metal– Ni2þ
C2221 54.8, 62.0, 64.8 908, 908, 908 ˚ 20– 1.35 A 0.998 191128/ 26949 7.1 19.21/23.30
P1211 39.4, 54.7, 44.0
C2221 53.8, 61.9, 66.3
908, 1088, 908 ˚ 50–1.75 A 0.999 161504/43649
908, 908, 908 ˚ 40– 1.5 A 0.964 128707/22190
3.7 18.21/23.00
5.8 19.23/22.35
121 0 0 124
121 124 0 43
121 0 1 122
0.0153 1.42 0.108
0.0138 1.54 0.132
0.0153 1.56 0.126
97 (94.17) 5 (4.85) 1 (0.97)
242 (95.07) 10 (4.48) 1 (0.45)
102 (94.44) 5 (4.63) 1 (0.93)
Energetic contributions of Q1, H29, H33 and H110 in nickel (II) ion binding Based on the structure of the Ni2þ/VHHmetal complex, the binding energetics were investigated to dissect the underlying thermodynamic contributions toward metal ion recognition. Previous evaluation of the VHHmetal-binding energetics (at 258C) revealed that Ni2þ binding was enthalpically driven (DH8 212 kcal/mol) with an unfavorable entropy component (2TDS8 ¼ 6 kcal/mol) resulting in an overall free energy change of 26.1 + 0.2 kcal/mol (KD ¼ 30 + 10 mM) (Fanning et al., 2011). To examine each residue’s contribution toward Ni2þ binding, each participating Ni2þ-binding residue was individually mutated to its respective original, wild-type residue (Y29, Y33 and Q110) or alanine (for wild-type residue Q1). Isothermal titration calorimetry (ITC) was used to determine the binding energetics of each VHHmetal mutant (Table II). Consistent with Q1’s weakly observed electron density (Fig. 2B), the Q1A mutation revealed Q1 contributes minimally towards Ni2þ binding with a DDG8Nickel ¼ 0.4 + 0.4 kcal/mol,
Fig. 2. The VHHmetal –Ni2þ structure reveals the engineered metal-binding site involves both CDR1 and CDR3. (A) Ribbon structure of the VHH-metal–Ni2þ complex. The metal-binding site includes the anti-RNase A interface residues Q1, H29 and H110; CDR1 (cyan), CDR3 (orange) and framework (white). (B) 2(jFoj 2 jFcj) map of the VHH-metal VHH-Ni2þ binding site contoured at 1.6s. (C) CDR1 residue Y33 of the WT anti-RNase A VHH (PDB: 2P49) forms an intra-VHH bond with framework residue G57, whereas H33 of the VHHmetal complex does not.
393
Downloaded from http://peds.oxfordjournals.org/ at Rutgers University on August 16, 2015
abg Resolution Completeness # Reflections (all/unique) Redundancy Rwork/Rfree Res/chain VHH RNase A Ni2þ H2O RMSD ˚) Bond length (A Bond angle (8) Chiral volume Ramachandaran Preferred (%) Allowed (%) Outliers (%)
VHH-metal
binding site, where it is more centrally located near CDR3. Additionally, N-terminal residue Q1 is located in a more extended positions in the RNase A complex when compared ˚ (Ca) away in the Ni2þ bound structure. with its position 8.6 A Q1’s location is comparable between the free VHHmetal and the Ni2þ complex. Both H33 and H110, the remaining two engineered histidine sites are structurally conserved between the three VHHmetal states (Fig. 4B), which is most likely reflective of their proximity to the VHH scaffolding (i.e, terminal ends of CDR loops).
S.W.Fanning et al.
Fig. 3. Structural superposition of the RNase A complex interfaces of VHHmetal and wt-VHH RNase A (Koide et al., 2007). VHHmetal-light grey; VHHRNaseA-dark grey.
suggesting that this position may alternatively be a water. On the other hand, individual substitutions of H29Y and H110Q displayed significant energetic penalties for Ni2þ recognition (DDG8Nickel ¼ 2.2 + 0.2 and 2.3 + 0.3 kcal/mol for H29Y and H110Q, respectively). The weak, but measureable binding of individual mutants H29Y and H110Q, suggests that another metal ligand, likely Q1, participates with either H29 or H110Q to form a weak Ni2þ binding site (Kd 1 mM). Removal of both histidines (H29Y/H110Q) completely abolishes measurable binding (Kd .10 mM). Finally, to test the general effectiveness of a metal ion binding residue in the Q1 position, a glutamate residue, which is more frequently observed in metal-binding sites (Harding, 2004), was introduced into the engineered VHHmetal. The resulting Q1E VHHmetal variant possessed only a slight increase in Ni2þ affinity (DDGNickel ¼ 20.3 + 0.2 kcal/mol). 394
The remaining engineered histidine, H33, was found to be located well outside the Ni2þ binding pocket (Fig. 2). When using library-based phage display methods, residues may sometimes be introduced due to secondary selection criteria (e.g. enhanced expression level, more efficient phage packaging, etc.). Here, H33 appeared to fit this scenario. To rule-out its potential contribution towards metal binding, a H33Y back mutant was generated. Surprisingly, despite being ˚ (Ca-Ni2þ) from the Ni2þ binding site, the H33Y located 10 A mutation resulted in an energetic penalty towards Ni2þ binding (DDG8Nickel ¼ 1.1 + 0.2 kcal/mol). Based on the crystal structure of the wild-type anti-RNase A VHH – RNase A complex (Koide et al., 2007), the Y33 side chain hydroxyl group makes an intra-VHH hydrogen bond with G57’s main chain carbonyl oxygen, while H33 does not form such an interaction in the VHHmetal – RNase A complex (Fig. 2C). These results suggest
Downloaded from http://peds.oxfordjournals.org/ at Rutgers University on August 16, 2015
Fig. 4. The VHHmetal crystal structures reveal the dual function of metal binding H110 and significant conformational diversity between VHHmetal structural states. (A) Crystal structure of the VHHmetal –RNase A complex reveals VHHmetal H110 hydrogen bonds with RNase A C58, while VHHmetal H29 is just outside of hydrogen bond distance to RNase A Y76. VHH framework-light grey; CDR1-cyan; CDR3-orange; RNase A-black. (B) Stereoview highlighting the conformational diversity of CDR1 and the N-terminus between VHHmetal,free (yellow), VHHmetal/RNase A complex (red) and the VHHmetal/Ni2þ complex (green). Spheres indicate Ca positions of residues relevant to metal ion recognition; common overlap positions between two or more structures are displayed as a single grey sphere.
Engineering multi-specific antibodies: protein switches
Table II. Nickel and RNase A binding thermodynamics for the VHH mutants DH8 (kcal/mol)
2TDS8 (kcal/mol)
Kd mM
DG8 (kcal/mol)
DDG8 (kcal/mol)b
Metal VHHa Q1A Q1E H29Y H33Y H110Q H29Y/H110Q
212 + 1 212 + 6 210 + 2 212 + 5 26.7 + 0.7 220 + 7 N/D
6+1 6+4 4+1 7+5 1.68 + 0.9 16 + 7 N/D
30 + 10 50 + 30 21 + 4 1300 + 200 213 + 3 1600 + 700 .10 000
26.1 + 0.2 25.8 + 0.3 26.3 + 0.1 23.910 + 0.008 24.992 + 0.008 23.8 + 0.3 . 23.0
0.42 + 0.4 20.3 + 0.2 2.2 + 0.2 1.1 + 0.2 2.3 + 0.3 N/D
RNase A binding thermodynamics N VHHmetal variant
DH8 (kcal/mol)
2TDS8 (kcal/mol)
Kd (nM)
DG8 (kcal/mol)
DDG8 (kcal/mol)b
VHHametal Q1A H29Y H33Y H110Q
217.8 + 0.1 214.1 + 0.8 213 + 3 211 + 1 218.9 + 0.8
9.0 + 0.1 5.2 + 0.8 5+3 2+1 8.2 + 0.8
157 + 3 255 + 6 800 + 300 215 + 23 12.6 + 0.2
29.3 + 0.01 29 + 1 28.3 + 0.2 29.07 + 0.06 10.70 + 0.01
0.3 + 0.1 1.0 + 0.2 0.2 + 0. 1 21.49 + 0.01
1.01 + 0.02 1.0 + 0* 0.96 + 0.02 1 + 0* 1 + 0* 1.0 + 0* 1.0 + 0*
0.96 + 0.01 1.02 + 0.03 0.99 + 0.05 0.98 + 0.01 0.96 + 0.01
a
VHHmetal binding thermodynamics previously determined (Fanning et al., 2011). DDG8 calculated from DG8single mutant 2 DG8VHHmetal. *Indicates a fixed stoichiometry of one used for low c-value experiments (Turnbull and Daranas, 2003).
b
that the Y33H substitution relieves an intramolecular interaction (e.g. packing or hydrogen bonding) that enables CDR1 to form a more efficient Ni2þ binding conformation.
Energetic contributions of nickel (II) ion binding residues on RNase A binding To better understand the energetic consequences of VHHmetal’s remodeled interface on RNase A recognition, the binding thermodynamics were measured for a series of VHHmetal variants, each reverting a single VHHmetal residue (H29, H33 and H110) back to its original wild-type anti-RNase A VHH residue or alanine (in the case of Q1, which is identical between VHHwt and VHHmetal ). RNase A binding experiments suggested that the individual absence of engineered VHHmetal residue H33 results in negligible energetic change towards RNase A binding (0.2 + 0.1 kcal/mol), similar to Q1A (0.3 + 0.1 kcal/ mol). Residue H29, however, displayed a loss of binding when reverted to its wild-type residue (1.0 + 0.2, kcal/mol), suggesting that the VHHmetal residue’s presence is slightly favorable for RNase A recognition. Surprisingly, while H110 is observed to form a hydrogen bond with RNase A within the VHHmetal – RNase A complex crystal structure, the H110Q mutant demonstrated that H110 conferred a significant energetic penalty towards RNase A binding relative to wild-type Q110 (DDG8RNase A ¼ 21.49 + 0.01 kcal/mol). Based on the observation that removal of the Q110 side chain with alanine results in a negligible loss of affinity (Koide et al., 2007), an explanation for H110’s disruptive role in RNase A binding is uncertain. The thermodynamic signature suggests Gln at 110 is slightly more enthalpically favorable and less entropically unfavorable than when His resides at Position 110 in the VHHmetal variant, which may suggest that H110 produces less favorable intramolecular packing interactions despite the observed intermolecular hydrogen bond. Overall, the mutagenesis studies revealed that H110 was the most important residue for Ni2þ binding affinity and the most detrimental toward RNase A recognition. Conversely, H29 is truly a dual-function residue by demonstrating favorable
energetic contributions (.1 kcal/mol) to both binding specificities (Ni2þ/RNase A). In addition, while the individual backmutations suggest, as expected, a slightly more favorable improvement in binding to RNase A, the energetic differences are close and could likely include cooperative contributions due to their proximity in the binding site. Such contributions which would not be captured by the single mutant studies examined here. Discussion and conclusions The generation of a dual-specific single domain VHH antibody is a promising step toward the generation of next generation affinity reagents that may be regulated through environmental triggers. To our knowledge, this represents the first antibody – antigen interaction that was engineered to be regulated through a metal switch. One of the most relevant outcomes is that the design of metal-binding sites may not need to be restricted to rigid secondary structure, although its success is anticipated to be heavily dependent on the protein architecture and available metal-binding residues. Here, crystal structure analysis revealed that the binding interface of VHHmetal is capable of undergoing significant conformational rearrangement to achieve dual-specificity. Our success in generating a metal ion binding site within the small VHH interface suggests that a larger interface (e.g. conventional VH/VL antibody interface) may provide additional opportunities to generate novel metal-binding sites. Furthermore, the results suggest that residues not directly participating in metal ion binding can play an energetically important role in metal ion binding affinity (e.g. H33). This likely reflects how a protein’s interface may be sensitive to small structural changes that propagate through loop structure. Consequently, efforts to design new function (e.g. dual-recognition) may benefit from library-based strategies that extensively explore the protein’s structure and energetic space. It is of interest to note that the VHHmetal possessed a moderate (micromolar) Ni2þ binding affinity, while higher binding affinities have been observed in metalloproteins (Zambelli 395
Downloaded from http://peds.oxfordjournals.org/ at Rutgers University on August 16, 2015
Ni2þ binding thermodynamics VHHmetal variant N
S.W.Fanning et al.
et al., 2008). It is unknown whether VHHmetal’s limited coordination with Ni2þ and corresponding moderate Ni2þ binding constant may be a limitation of this particular VHH structure, the residues involved or a limitation of the screening itself. Consequently, alternative or modified library-based approaches (e.g. inclusion of a wider array of metal-binding residues) may be useful in the design of new competitive metal-binding sites in protein interfaces. The ability to increase metal-binding affinity would allow more tailored regulation of the original antibody– antigen interaction (e.g. a wider change in antibody/ antigen affinity over lower metal concentrations), although as observed here, the modified function may ultimately arise at the expense of the original binding function. Materials and methods
Mutant generation, VHH expression and purification
H29Y: 50 CCCATATGAAGATAGGTATACGCATAACCG CTTGCTGC30 , H33Y: 50 GGAACCAACCCATATAAATATAAGGATGAG GATAACC30 , H110Q: 50 GGTGCCTTGACCCCACTGACCATAAGTACG ATC30 , Q1A: 50 GCTTTCTACCAGTTGTACAGCGGATCCCTGG AAGTACAGG30 and Q1E: 50 GCTTTCTACCAGTTGTACTTCGGATCCCTGG AAGTACAGG30 The metal-binding VHH clone and mutants were expressed in E. coli BL21 (DE3). Briefly, cells were incubated with shaking at 378C until they reached an OD600 of 0.55 at which time expression was induced by the addition of 1 mM isopropyl b-D-1-thiogalactopyranoside. Cells were further incubated overnight at 208C, then harvested by centrifugation (7500g for 15 min at 48C) and then frozen. Cells were thawed and resuspended in 10 mM Tris/pH 8.0 and sonicated for three, 2 min on/off cycles at an output power of 21 W using a Model 60 Sonic Dismembrator (Fisher Scientific). The mixture was centrifuged (8500g for 20 min at 48C) to isolate the insoluble fraction which contained the VHH inclusion bodies. The inclusion body pellet was washed with 2% deoxycholic acid, 50 mM Tris/pH 8.0, 5 mM EDTA, then with deionized water and a final time with 10 mM Tris/pH 8.0. The resulting washed inclusion body pellet was solubilized with 50 ml unfolding buffer (6 M guanidine HCl, 50 mM sodium phosphate/pH 7.4, 300 mM NaCl, 2 mM reduced glutathione and 0.2 mM oxidized glutathione). The solution was clarified through centrifugation and then added dropwise to 500 ml of refolding buffer (20 mM Tris/pH7.4, 2 mM reduced glutathione, 0.2 mM oxidized glutathione) overnight with stirring at 58C. Purification of the metal clone VHH and removal of the Hexa-His-Tev tag were performed as previously described (Fanning et al., 2011).
Isothermal titration calorimetry ITC experiments were performed using a MicroCal VP-ITC (MicroCal, LLC). Proteins were dialyzed against the desired 396
Crystallization of the metal VHH structures The VHHmetal was run on a Superdex 75 model 10/30GL size exclusion column (GE Healthcare) with a 10 mM Tris/pH8.0, 300 mM NaCl running buffer. Fractions containing VHH were concentrated to 20 mg/ml using an Amicon ultrafiltration device with a 5 kDa cut-off membrane. RNase A complex solutions were generated by adding a 1.5 concentration of RNase A, then performing another size exclusion purification. NiSO4 was added to the VHH for a final concentration of 100 mM NiSO4 to generate the Ni2þ bound crystals. All crystals were grown by the hanging drop method. For the VHHmetal – Ni2þ complex structure, clear rectangular crystals appeared after 2 weeks when 2 ml of 10 mg/ml Ni2þ bound metal VHH was mixed with 2 ml of 1.8 M ammonium citrate tribasic, pH 7.0, 0.2 M ammonium acetate. For the VHHmetal – RNase A complex structure, clear rectangular crystals appeared overnight when 2 ml of 10 mg/ml VHHmetal – RNase A was mixed with 2 ml of 0.1 M Bis-Tris/pH 8.5, 25% w/v polyethylene glycol 3350. For the free VHHmetal, clear rectangular crystals formed overnight when 2 ml of 10 mg/ml VHHmetal was mixed with 2 ml 0.1 M Bis-Tris/pH 5.5 and 2.0 M ammonium sulfate. Twenty percent glycerol was used as a cryoprotectant for all data collections. All X-ray data sets were collected at the Advanced Photon Source at Argonne National Laboratories, Argonne, Illinois at ˚ . The beamline was the SER-CAT-22BM beamline at 1 A 2þ ˚ tuned to 1.44 A for the Ni bound structure to diffract the nickel edge for the generation of an anomalous difference map to insure the presence of Ni2þ at the binding site.
X-Ray structure solution Data were indexed, merged and scaled using HKL-2000 (Otwinowski and Minor, 1997). Molecular replacement was performed using Phaser (McCoy et al., 2007) with an existing anti-RNase A VHH (PDB ID: 2P94) as the input model (Koide
Downloaded from http://peds.oxfordjournals.org/ at Rutgers University on August 16, 2015
Using a pET-21a(þ) vector (Novagen) containing the gene for a Hexa-His-Tev-anti-RNase A VHH-metal (Fanning et al., 2011), Kunkel Mutagenesis (Kunkel, 1985) was performed to incorporate H29Y, H33Y, H110Q, Q1A and Q1E mutations. The following oligonucleotide sequences were used to generate the mutants:
experimental buffer, TBS (20 mM Tris/pH 7.4, 150 mM NaCl). Titrations included a typical 10 : 1 ratio of nickel ion (syringe) to VHH (cell) with NiCl2 concentrations between 300 mM and 30 mM and VHH concentrations between 30 and 300 mM. Extinction coefficients were determined using values determined by the methods described by Pace et al. (Pace et al., 1995). The extinction coefficient for the VHHmetal, Q1A and H110Q mutants were 23 045 and 24 410 M21 cm21 for the H29Y and H33Y mutants. Experiments with c-values ,5 (c-value ¼ Kobs[VHH]), such as Q1A, H29Y, H110Q and the double/triple mutants followed methods of Turnbull and Daranas (Turnbull and Daranas, 2003). All experiments were performed at 258C. Experiments typically included 28, injections whereby an initial 2 ml injection was used to account for dilution across the syringe and the heat was discarded. The remaining injections were 10 ml with a 240-s delay between each injection. Dilution heat experiments were performed whereby concentrations of Ni2þ matching the experimental were injected into buffer following each experiment and were subtracted from the data. The binding parameters (K, DH8, DS8 and n) were determined using the single-site binding model using the ITC add-in in Origin version 7 (MicroCal LLC). All 10 : 1 titrations indicated a 1 : 1 interaction with observed stoichiometries equal to 1.0 (within 5%). All 100 : 1 required fixing the stoichiometry to the known value of 1 (Turnbull and Daranas, 2003).
Engineering multi-specific antibodies: protein switches
Acknowledgements The authors thank Ryan Bourgo, Megan Murtaugh and Christopher Smith for their helpful comments and discussion.
Funding This work was supported by the National Science Foundation (MCB-0953323 to J.R.H.). The US Department of Energy, Office of Science, Office of Basic Energy Sciences for supporting use of the Advanced Photon Source under Contract No. W-31-109-Eng-38, as well as the Southeast Regional Collaborative Access Team (SER-CAT) 22-BM beamline, Argonne National Laboratory, supporting institutions can be found at www.ser-cat.org/members.html.
Kunkel,T.A. (1985) Proc. Natl Acad. Sci. USA, 82, 488–492. Lu,Y., Yeung,N., Sieracki,N. and Marshall,N.M. (2009) Nature, 460, 855–862. Martin,A., Damian,M., Laguerre,M., Parello,J., Pucci,B., Serre,L., Mary,S., Marie,J. and Baneres,J.L. (2009) Protein Sci., 18, 727– 734. McCoy,A.J., Grosse-Kunstleve,R.W., Adams,P.D., Winn,M.D., Storoni,L.C. and Read,R.J. (2007) J. Appl. Crystallogr., 40, 658–674. Murtaugh,M.L., Fanning,S.W., Sharma,T.M., Terry,A.M. and Horn,J.R. (2011) Protein Sci., 20, 1619–1631. Otwinowski,Z. and Minor,W. (1997) Methods Enzymol., 276, 307– 326. Pace,C.N., Vajdos,F., Fee,L., Grimsley,G. and Gray,T. (1995) Protein Sci., 4, 2411– 2423. Pagel,P., Kovac,S., Oesterheld,M., et al. (2005) Bioinformatics, 21, 832–834. Regan,L. (1993) Ann. Rev. Biophys. Biomol. Struct., 22, 257–287. Roberts,V.A. and Getzoff,E.D. (1995) FASEB J., 9, 94–100. Roberts,V.A., Iverson,B.L., Iverson,S.A., Benkovic,S.J., Lerner,R.A., Getzoff,E.D. and Tainer,J.A. (1990) Proc. Natl Acad. Sci. USA, 87, 6654– 6658. Salgado,E.N., Faraone-Mennella,J. and Tezcan,F.A. (2007) J. Am. Chem. Soc., 129, 13374–13375. Salgado,E.N., Ambroggio,X.I., Brodin,J.D., Lewis,R.A., Kuhlman,B. and Tezcan,F.A. (2010a) Proc. Natl Acad. Sci. USA, 107, 1827–1832. Salgado,E.N., Radford,R.J. and Tezcan,F.A. (2010b) Acc. Chem. Res., 43, 661–672. Salgado,E.N., Brodin,J.D., To,M.M. and Tezcan,F.A. (2011) Inorg. Chem., 50, 6323– 6329. Schonichen,A., Webb,B.A., Jacobson,M.P. and Barber,D.L. (2013) Annu. Rev. Biophys., 42, 289– 314. Thompson,L.C., Goswami,S. and Peterson,C.B. (2011) Protein Sci., 20, 366–378. Turnbull,W.B. and Daranas,A.H. (2003) J. Am. Chem. Soc., 125, 14859–14866. Zambelli,B., Danielli,A., Romagnoli,S., Neyroz,P., Ciurli,S. and Scarlato,V. (2008) J. Mol. Biol., 383, 1129– 1143.
References Atanassova,A. and Zamble,D.B. (2005) J. Bacteriol., 187, 4689–4697. Beadle,B.M. and Shoichet,B.K. (2002) J. Mol. Biol., 321, 285– 296. Chang,H.C., Chou,W.Y. and Chang,G.G. (2002) J. Biol. Chem., 277, 4663–4671. Collaborative Computational Project N. (1994) Acta Crystallogr, D50, 760–763. Conti,M. and Beavo,J. (2007) Ann. Rev. Biochem., 76, 481 –511. Crowder,M.W., Stewart,J.D., Roberts,V.A., Bender,C.J., Tevelrakh,E., Peisach,J., Getzoff,E.D., Gaffney,B.J. and Benkovic,S.J. (1995) J. Am. Chem. Soc., 117, 5627–5634. DeLano,W.L. (2002) The PyMOL Molecular Graphics System, Version 1.5.0.4 Schro¨dinger, LLC. DeLano Scientific, San Carlos, CA, USA. Dellus-Gur,E., Toth-Petroczy,A., Elias,M. and Tawfik,D.S. (2013) J. Mol. Biol., 425, 2609– 2621. Emsley,P. and Cowtan,K. (2004) Acta Crystallogr. D Biol. Crystallogr., 60, 2126–2132. Erijman,A., Aizner,Y. and Shifman,J.M. (2011) Biochemistry, 50, 602– 611. Fanning,S.W., Murtaugh,M.L. and Horn,J.R. (2011) Biochemistry, 50, 5093–5095. Harding,M.M. (2004) Acta Crystallogr. D Biol. Crystallogr., 60, 849–859. Harding,M.M. (2006) Acta Crystallogr. D Biol. Crystallogr., 62, 678–682. Higaki,J.N., Haymore,B.L., Chen,S., Fletterick,R.J. and Craik,C.S. (1990) Biochemistry, 29, 8582– 8586. Hubbard,S.J. and Thornton,J.M. (1993) ‘NACCESS’, Computer Program, Department of Biochemistry and Molecular Biology, University College London. James,L.C., Roversi,P. and Tawfik,D.S. (2003) Science, 299, 1362–1367. Kerkhoff,C., Vogl,T., Nacken,W., Sopalla,C. and Sorg,C. (1999) FEBS Lett., 460, 134– 138. Koide,A., Tereshko,V., Uysal,S., Margalef,K., Kossiakoff,A.A. and Koide,S. (2007) J. Mol. Biol., 373, 941–953. Krantz,B.A. and Sosnick,T.R. (2001) Nat. Struct. Biol., 8, 1042– 1047.
397
Downloaded from http://peds.oxfordjournals.org/ at Rutgers University on August 16, 2015
et al., 2007). All structures possess one molecule or complex in the asymmetric unit. The CCP4 (Refmac) program suite was used for all refinements (Collaborative Computational Project, 1994). The residues of each CDR were removed during the initial refinement and were subsequently re-built using iterative rounds of refinement and model building with Refmac and Coot (Emsley and Cowtan, 2004). Density corresponding to the nickel (II) ion was clearly visible in the Ni2þ bound structure after one round of refinement and confirmed with a large peak at the same location in the anomalous difference map. The final structure of the RNase A bound metal VHH does not possess residues 19– 22 in Chain A as they are not resolved in the electron density. All molecular images were generated using PYMOL (DeLano, 2002). Accessible surface area calculations were done using the program NACCESS (Hubbard and Thornton, 1993). The models and structure factors were each deposited in the RCSB (PDBs: 4PPT, 4POUand 4POY).
Structural basis of an engineered dual-specific antibody: conformational diversity leads to a hypervariable loop metal-binding site Sean W.Fanning1,4, Richard Walter2 and James R.Horn1,3,5 1
Department of Chemistry and Biochemistry, Northern Illinois University, DeKalb, IL 60115, USA, 2Shamrock Structures, LLC, 1440 Davey Road, Woodridge, IL 60517, USA, 3Center for Biochemical and Biophysical Studies, Northern Illinois University, DeKalb, IL 60115, USA and 4Current address: Ben May Department for Cancer Research, University of Chicago, 929 E. 57th St., Chicago, IL 60637, USA
5
Received February 28, 2014; revised July 16, 2014; accepted July 17, 2014 Edited by Dan Tawfik
To explore dual-specificity in a small protein interface, we previously generated a ‘metal switch’ anti-RNase A VHH antibody using a combinatorial histidine library approach. While most metal-binding sites in proteins are found within rigid secondary structure, the engineered VHH antibody (VHHmetal ), which contained three new histidine residues, possessed metal-binding residues within the flexible hypervariable loops. Here, crystal structure analysis of the free and bound states of VHHmetal reveals the structural determinants leading to dual-function. Most notably, CDR1 is observed in two distinct conformations when adopting the metal or RNase A bound states. Furthermore, mutagenesis studies revealed that one of the engineered residues, not located in the metal-binding pocket, contributed indirectly to metal recognition, likely through influencing CDR1 conformation. Despite these changes, VHHmetal possesses a relatively minor energetic penalty toward binding the original antigen, RNase A (∼1 kcal/mol), where the engineered gain-of-function metal-binding residues are observed to possess a mix of favorable and unfavorable contributions towards RNase A recognition. Ultimately, the conformationally distinct metal-switch interface architecture reflects the robust, library-based strategy used to produce VHHmetal. These results also suggest that even small protein interfaces, such as VHH, may be structurally and energetically forgiving in adopting novel function, while maintaining original function. Keywords: nanobody/phage display/promiscuous binding/ protein switch/VHH
Introduction Multi-specific (or promiscuous) proteins can play an important role in biological regulation, frequently residing at critical ‘hub’ junctures in cellular signaling pathways (Pagel et al., 2005). Consequently, there is interest in not only understanding the origins of promiscuous recognition, but also designing
# The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: [email protected]
391
Downloaded from http://peds.oxfordjournals.org/ at Rutgers University on August 16, 2015
To whom correspondence should be addressed. E-mail: [email protected]
multi-specific proteins (Erijman et al., 2011). Such multispecificity can operate through a range of mechanisms, including complex, multiple protein binding interfaces to a simple, single protein interface. When only a single protein interface is involved, the minimalist form of this phenomenon, the binding of one ligand enhances or precludes the binding of a second ligand, which can range in size from macromolecules to protons (Erijman et al., 2011; Murtaugh et al., 2011; Schonichen et al., 2013). In general, the mechanism employed by these dual-function proteins typically involves the interface undergoing significant conformational rearrangement to recognize each distinct target (James et al., 2003), thus making engineering such dual-function interfaces a considerable challenge. Furthermore, the gain of protein function is often met with adverse effects on protein stability (Beadle and Shoichet, 2002; Dellus-Gur et al., 2013). Perhaps the most commonly observed example of dualspecificity in proteins occurs in metalloproteins (Lu et al., 2009). Nature frequently exploits the rich chemistry afforded by metals for a wide range of biological functions. In fact, metal-binding sites are so prevalent in nature that up to half of all natural proteins are metalloproteins (Lu et al., 2009). Metal-binding sites have roles in enzymatic catalysis (Conti and Beavo, 2007), modulation of secondary molecular recognition events (Kerkhoff et al., 1999) and protein stabilization (Chang et al., 2002). Due to the diverse range of functional outcomes, there has been significant interest in engineering metal-binding sites into proteins. Metal-binding sites have been successfully engineered to enhance protein stability (Regan, 1993; Martin et al., 2009), modulate oligomeric states (Salgado et al., 2010a, 2011) and control enzymatic catalysis (Higaki et al., 1990). Furthermore, metals have been inserted into antibody-binding sites for the development of catalytic antibodies (Roberts et al., 1990; Crowder et al., 1995; Roberts and Getzoff, 1995). Due to the complexity of metal-binding sites, existing structural knowledge is often used to best mimic a known natural metal-binding site (Roberts et al., 1990). Both natural and engineered metal-binding sites are frequently located within areas of rigid secondary structure (e.g. a-helicies/b-strands) where as little as two residues are necessary to coordinate a metal ion (Regan, 1993; Krantz and Sosnick, 2001; Salgado et al., 2007, 2010b). The use of such rigid protein structure to host metal ion binding sites most likely improves metal ion binding affinity, as well as facilitates design efforts by providing rigid scaffolding. Hence, designing metal-binding sites within flexible loops remains a significant challenge. We previously developed a metal-switch VHH antibody using a histidine scanning combinatorial library that probed the complementarity determining regions (CDRs) of an anti-RNase A VHH antibody for potential metal-binding site (Fanning et al., 2011). The library-based method was combined with a selection strategy that identified a dual-function
S.W.Fanning et al.
Results
The structural origins of engineered metal-binding site To determine how the anti-RNase A VHH antigen interface adopted dual-recognition, the X-ray crystal structure of the ˚ resolution VHHmetal – Ni2þ complex was determined to 1.50 A (PDB: 4PPT, Table I). Based on both the electron density and anomalous difference map, the location of the Ni2þ binding site was clearly identified between CDR1 and CDR3 (Fig. 2A). The histidine side chains of both H29 (CDR1) and H110 (CDR3) are observed to directly interact with Ni2þ. Wild-type residue Q1 (N-terminus) is within contact distance with the nickel ion, although the electron density for the Q1
side is relatively weak (Fig. 2B), so it is possible a water molecule may alternatively fill this position. The observed bond ˚ for lengths from each contributing group are 2.3, 2.0 and 2.2 A O1 (Q1/H2O), N1 (H29) and N1 (H110), respectively. Two water molecules are located in plane with Q1/H2O and H29, suggesting an octahedral coordination geometry. The unobserved distal ligand is most likely a water molecule, as this position is located on the solvent-exposed face of the metalbinding site. Overall, the observed coordination geometry and bond lengths for the VHHmetal – Ni2þ complex are comparable with known Ni2þ-binding proteins (Harding, 2004, 2006; Atanassova and Zamble, 2005; Thompson et al., 2011). It is interesting to note that VHHmetal’s third metal-selected histidine residue, H33, which is located within CDR1 is not ˚ observed to directly participate in Ni2þ binding, as it is 10 A from the metal ion binding site.
Dual-function histidines: metal versus antigen interactions To understand the structural consequences of the residues par˚ resoticipating in dual-specificity, we determined a 1.75 A lution x-ray crystal structure of VHHmetal in complex with its original target, RNase A (PDB: 4POU, Table I). When compared to a crystal structure of the wild-type anti-RNase A VHH – RNase A complex (Koide et al., 2007), there is very little evidence of structural change between the two VHH interfaces (Fig. 3). Of the two histidines participating in metal binding, only H110 is observed to form a contact with RNase A. The N1 of H110 forms a hydrogen bond with the main chain carbonyl of RNase A C58, whereas the N1 of H29 appears poised to hydrogen bond with Y76 of RNase A, but is beyond ˚ ) (Fig. 4A). hydrogen bond distance (3.8 A To evaluate structural differences between conformations of the CDRs, the complex VHHmetal structures (Ni2þ and RNase A) and free VHHmetal structure (PDB: 4POY, Table I) were compared. When all the three VHHmetal structures are superimposed, significant differences are observed in the conformation of CDR1 as well as the N-terminus (Fig. 4B). In
Fig. 1. Thermodynamic model of the engineered coupled equilibria. The model includes a dual-specific VHH antibody interface that binds either a metal ion (small sphere) or the protein antigen, RNase A. A color version of this figure is available as supplementary data at PEDS Online.
392
Downloaded from http://peds.oxfordjournals.org/ at Rutgers University on August 16, 2015
variant which possessed a mutually exclusive metal-binding site (Fig. 1). The resulting engineered VHH antibody (VHHmetal ) incorporated three histidine residues within the anti-RNase A VHH CDR loops. VHHmetal possessed a moderate affinity for Ni2þ (KD ¼ 30 mM), while it retained affinity near wild-type affinity for RNase A (KD ¼ 155 mM) (Fanning et al., 2011). Most importantly, the observed affinity (Kobs) of the dualspecific interface for antigen, RNase A, was tunable by the amount of metal present (Fig. 1). Here, we examine the structural and biophysical details of dual-recognition for the engineered anti-RNase A VHHmetal antibody, which is capable of binding either RNase A or Ni2þ using the same interface loops. The structural details of the VHHmetal dual-specificity were revealed by high-resolution X-ray crystal structures of VHHmetal in each state of the linked-equilibria, while mutagenesis studies examined the roles of the corresponding metal-binding residues in the recognition of Ni2þ versus RNAse A. These results demonstrate that metal-binding sites can be incorporated into conformationally diverse regions of secondary structure and that even small protein interfaces, such as VHH, may be structurally and energetically forgiving in adopting novel function, while maintaining original function.
Engineering multi-specific antibodies: protein switches
particular, CDR1 exhibits a Ca RMSD of 3.70 between the two bound (Ni2þ and RNase A) structures, whereas CDR3 ˚ (Ca) between possesses a Ca RMSD of 0.349. There is 8.6 A CDR1 residue H29 in the RNase A structure, where it is in a more extended position, to its location forming the Ni2þ
Table I. Crystal data and refinement statistics for VHH complexes
Space group abc
VHH-metal – RNase A
VHH-metal– Ni2þ
C2221 54.8, 62.0, 64.8 908, 908, 908 ˚ 20– 1.35 A 0.998 191128/ 26949 7.1 19.21/23.30
P1211 39.4, 54.7, 44.0
C2221 53.8, 61.9, 66.3
908, 1088, 908 ˚ 50–1.75 A 0.999 161504/43649
908, 908, 908 ˚ 40– 1.5 A 0.964 128707/22190
3.7 18.21/23.00
5.8 19.23/22.35
121 0 0 124
121 124 0 43
121 0 1 122
0.0153 1.42 0.108
0.0138 1.54 0.132
0.0153 1.56 0.126
97 (94.17) 5 (4.85) 1 (0.97)
242 (95.07) 10 (4.48) 1 (0.45)
102 (94.44) 5 (4.63) 1 (0.93)
Energetic contributions of Q1, H29, H33 and H110 in nickel (II) ion binding Based on the structure of the Ni2þ/VHHmetal complex, the binding energetics were investigated to dissect the underlying thermodynamic contributions toward metal ion recognition. Previous evaluation of the VHHmetal-binding energetics (at 258C) revealed that Ni2þ binding was enthalpically driven (DH8 212 kcal/mol) with an unfavorable entropy component (2TDS8 ¼ 6 kcal/mol) resulting in an overall free energy change of 26.1 + 0.2 kcal/mol (KD ¼ 30 + 10 mM) (Fanning et al., 2011). To examine each residue’s contribution toward Ni2þ binding, each participating Ni2þ-binding residue was individually mutated to its respective original, wild-type residue (Y29, Y33 and Q110) or alanine (for wild-type residue Q1). Isothermal titration calorimetry (ITC) was used to determine the binding energetics of each VHHmetal mutant (Table II). Consistent with Q1’s weakly observed electron density (Fig. 2B), the Q1A mutation revealed Q1 contributes minimally towards Ni2þ binding with a DDG8Nickel ¼ 0.4 + 0.4 kcal/mol,
Fig. 2. The VHHmetal –Ni2þ structure reveals the engineered metal-binding site involves both CDR1 and CDR3. (A) Ribbon structure of the VHH-metal–Ni2þ complex. The metal-binding site includes the anti-RNase A interface residues Q1, H29 and H110; CDR1 (cyan), CDR3 (orange) and framework (white). (B) 2(jFoj 2 jFcj) map of the VHH-metal VHH-Ni2þ binding site contoured at 1.6s. (C) CDR1 residue Y33 of the WT anti-RNase A VHH (PDB: 2P49) forms an intra-VHH bond with framework residue G57, whereas H33 of the VHHmetal complex does not.
393
Downloaded from http://peds.oxfordjournals.org/ at Rutgers University on August 16, 2015
abg Resolution Completeness # Reflections (all/unique) Redundancy Rwork/Rfree Res/chain VHH RNase A Ni2þ H2O RMSD ˚) Bond length (A Bond angle (8) Chiral volume Ramachandaran Preferred (%) Allowed (%) Outliers (%)
VHH-metal
binding site, where it is more centrally located near CDR3. Additionally, N-terminal residue Q1 is located in a more extended positions in the RNase A complex when compared ˚ (Ca) away in the Ni2þ bound structure. with its position 8.6 A Q1’s location is comparable between the free VHHmetal and the Ni2þ complex. Both H33 and H110, the remaining two engineered histidine sites are structurally conserved between the three VHHmetal states (Fig. 4B), which is most likely reflective of their proximity to the VHH scaffolding (i.e, terminal ends of CDR loops).
S.W.Fanning et al.
Fig. 3. Structural superposition of the RNase A complex interfaces of VHHmetal and wt-VHH RNase A (Koide et al., 2007). VHHmetal-light grey; VHHRNaseA-dark grey.
suggesting that this position may alternatively be a water. On the other hand, individual substitutions of H29Y and H110Q displayed significant energetic penalties for Ni2þ recognition (DDG8Nickel ¼ 2.2 + 0.2 and 2.3 + 0.3 kcal/mol for H29Y and H110Q, respectively). The weak, but measureable binding of individual mutants H29Y and H110Q, suggests that another metal ligand, likely Q1, participates with either H29 or H110Q to form a weak Ni2þ binding site (Kd 1 mM). Removal of both histidines (H29Y/H110Q) completely abolishes measurable binding (Kd .10 mM). Finally, to test the general effectiveness of a metal ion binding residue in the Q1 position, a glutamate residue, which is more frequently observed in metal-binding sites (Harding, 2004), was introduced into the engineered VHHmetal. The resulting Q1E VHHmetal variant possessed only a slight increase in Ni2þ affinity (DDGNickel ¼ 20.3 + 0.2 kcal/mol). 394
The remaining engineered histidine, H33, was found to be located well outside the Ni2þ binding pocket (Fig. 2). When using library-based phage display methods, residues may sometimes be introduced due to secondary selection criteria (e.g. enhanced expression level, more efficient phage packaging, etc.). Here, H33 appeared to fit this scenario. To rule-out its potential contribution towards metal binding, a H33Y back mutant was generated. Surprisingly, despite being ˚ (Ca-Ni2þ) from the Ni2þ binding site, the H33Y located 10 A mutation resulted in an energetic penalty towards Ni2þ binding (DDG8Nickel ¼ 1.1 + 0.2 kcal/mol). Based on the crystal structure of the wild-type anti-RNase A VHH – RNase A complex (Koide et al., 2007), the Y33 side chain hydroxyl group makes an intra-VHH hydrogen bond with G57’s main chain carbonyl oxygen, while H33 does not form such an interaction in the VHHmetal – RNase A complex (Fig. 2C). These results suggest
Downloaded from http://peds.oxfordjournals.org/ at Rutgers University on August 16, 2015
Fig. 4. The VHHmetal crystal structures reveal the dual function of metal binding H110 and significant conformational diversity between VHHmetal structural states. (A) Crystal structure of the VHHmetal –RNase A complex reveals VHHmetal H110 hydrogen bonds with RNase A C58, while VHHmetal H29 is just outside of hydrogen bond distance to RNase A Y76. VHH framework-light grey; CDR1-cyan; CDR3-orange; RNase A-black. (B) Stereoview highlighting the conformational diversity of CDR1 and the N-terminus between VHHmetal,free (yellow), VHHmetal/RNase A complex (red) and the VHHmetal/Ni2þ complex (green). Spheres indicate Ca positions of residues relevant to metal ion recognition; common overlap positions between two or more structures are displayed as a single grey sphere.
Engineering multi-specific antibodies: protein switches
Table II. Nickel and RNase A binding thermodynamics for the VHH mutants DH8 (kcal/mol)
2TDS8 (kcal/mol)
Kd mM
DG8 (kcal/mol)
DDG8 (kcal/mol)b
Metal VHHa Q1A Q1E H29Y H33Y H110Q H29Y/H110Q
212 + 1 212 + 6 210 + 2 212 + 5 26.7 + 0.7 220 + 7 N/D
6+1 6+4 4+1 7+5 1.68 + 0.9 16 + 7 N/D
30 + 10 50 + 30 21 + 4 1300 + 200 213 + 3 1600 + 700 .10 000
26.1 + 0.2 25.8 + 0.3 26.3 + 0.1 23.910 + 0.008 24.992 + 0.008 23.8 + 0.3 . 23.0
0.42 + 0.4 20.3 + 0.2 2.2 + 0.2 1.1 + 0.2 2.3 + 0.3 N/D
RNase A binding thermodynamics N VHHmetal variant
DH8 (kcal/mol)
2TDS8 (kcal/mol)
Kd (nM)
DG8 (kcal/mol)
DDG8 (kcal/mol)b
VHHametal Q1A H29Y H33Y H110Q
217.8 + 0.1 214.1 + 0.8 213 + 3 211 + 1 218.9 + 0.8
9.0 + 0.1 5.2 + 0.8 5+3 2+1 8.2 + 0.8
157 + 3 255 + 6 800 + 300 215 + 23 12.6 + 0.2
29.3 + 0.01 29 + 1 28.3 + 0.2 29.07 + 0.06 10.70 + 0.01
0.3 + 0.1 1.0 + 0.2 0.2 + 0. 1 21.49 + 0.01
1.01 + 0.02 1.0 + 0* 0.96 + 0.02 1 + 0* 1 + 0* 1.0 + 0* 1.0 + 0*
0.96 + 0.01 1.02 + 0.03 0.99 + 0.05 0.98 + 0.01 0.96 + 0.01
a
VHHmetal binding thermodynamics previously determined (Fanning et al., 2011). DDG8 calculated from DG8single mutant 2 DG8VHHmetal. *Indicates a fixed stoichiometry of one used for low c-value experiments (Turnbull and Daranas, 2003).
b
that the Y33H substitution relieves an intramolecular interaction (e.g. packing or hydrogen bonding) that enables CDR1 to form a more efficient Ni2þ binding conformation.
Energetic contributions of nickel (II) ion binding residues on RNase A binding To better understand the energetic consequences of VHHmetal’s remodeled interface on RNase A recognition, the binding thermodynamics were measured for a series of VHHmetal variants, each reverting a single VHHmetal residue (H29, H33 and H110) back to its original wild-type anti-RNase A VHH residue or alanine (in the case of Q1, which is identical between VHHwt and VHHmetal ). RNase A binding experiments suggested that the individual absence of engineered VHHmetal residue H33 results in negligible energetic change towards RNase A binding (0.2 + 0.1 kcal/mol), similar to Q1A (0.3 + 0.1 kcal/ mol). Residue H29, however, displayed a loss of binding when reverted to its wild-type residue (1.0 + 0.2, kcal/mol), suggesting that the VHHmetal residue’s presence is slightly favorable for RNase A recognition. Surprisingly, while H110 is observed to form a hydrogen bond with RNase A within the VHHmetal – RNase A complex crystal structure, the H110Q mutant demonstrated that H110 conferred a significant energetic penalty towards RNase A binding relative to wild-type Q110 (DDG8RNase A ¼ 21.49 + 0.01 kcal/mol). Based on the observation that removal of the Q110 side chain with alanine results in a negligible loss of affinity (Koide et al., 2007), an explanation for H110’s disruptive role in RNase A binding is uncertain. The thermodynamic signature suggests Gln at 110 is slightly more enthalpically favorable and less entropically unfavorable than when His resides at Position 110 in the VHHmetal variant, which may suggest that H110 produces less favorable intramolecular packing interactions despite the observed intermolecular hydrogen bond. Overall, the mutagenesis studies revealed that H110 was the most important residue for Ni2þ binding affinity and the most detrimental toward RNase A recognition. Conversely, H29 is truly a dual-function residue by demonstrating favorable
energetic contributions (.1 kcal/mol) to both binding specificities (Ni2þ/RNase A). In addition, while the individual backmutations suggest, as expected, a slightly more favorable improvement in binding to RNase A, the energetic differences are close and could likely include cooperative contributions due to their proximity in the binding site. Such contributions which would not be captured by the single mutant studies examined here. Discussion and conclusions The generation of a dual-specific single domain VHH antibody is a promising step toward the generation of next generation affinity reagents that may be regulated through environmental triggers. To our knowledge, this represents the first antibody – antigen interaction that was engineered to be regulated through a metal switch. One of the most relevant outcomes is that the design of metal-binding sites may not need to be restricted to rigid secondary structure, although its success is anticipated to be heavily dependent on the protein architecture and available metal-binding residues. Here, crystal structure analysis revealed that the binding interface of VHHmetal is capable of undergoing significant conformational rearrangement to achieve dual-specificity. Our success in generating a metal ion binding site within the small VHH interface suggests that a larger interface (e.g. conventional VH/VL antibody interface) may provide additional opportunities to generate novel metal-binding sites. Furthermore, the results suggest that residues not directly participating in metal ion binding can play an energetically important role in metal ion binding affinity (e.g. H33). This likely reflects how a protein’s interface may be sensitive to small structural changes that propagate through loop structure. Consequently, efforts to design new function (e.g. dual-recognition) may benefit from library-based strategies that extensively explore the protein’s structure and energetic space. It is of interest to note that the VHHmetal possessed a moderate (micromolar) Ni2þ binding affinity, while higher binding affinities have been observed in metalloproteins (Zambelli 395
Downloaded from http://peds.oxfordjournals.org/ at Rutgers University on August 16, 2015
Ni2þ binding thermodynamics VHHmetal variant N
S.W.Fanning et al.
et al., 2008). It is unknown whether VHHmetal’s limited coordination with Ni2þ and corresponding moderate Ni2þ binding constant may be a limitation of this particular VHH structure, the residues involved or a limitation of the screening itself. Consequently, alternative or modified library-based approaches (e.g. inclusion of a wider array of metal-binding residues) may be useful in the design of new competitive metal-binding sites in protein interfaces. The ability to increase metal-binding affinity would allow more tailored regulation of the original antibody– antigen interaction (e.g. a wider change in antibody/ antigen affinity over lower metal concentrations), although as observed here, the modified function may ultimately arise at the expense of the original binding function. Materials and methods
Mutant generation, VHH expression and purification
H29Y: 50 CCCATATGAAGATAGGTATACGCATAACCG CTTGCTGC30 , H33Y: 50 GGAACCAACCCATATAAATATAAGGATGAG GATAACC30 , H110Q: 50 GGTGCCTTGACCCCACTGACCATAAGTACG ATC30 , Q1A: 50 GCTTTCTACCAGTTGTACAGCGGATCCCTGG AAGTACAGG30 and Q1E: 50 GCTTTCTACCAGTTGTACTTCGGATCCCTGG AAGTACAGG30 The metal-binding VHH clone and mutants were expressed in E. coli BL21 (DE3). Briefly, cells were incubated with shaking at 378C until they reached an OD600 of 0.55 at which time expression was induced by the addition of 1 mM isopropyl b-D-1-thiogalactopyranoside. Cells were further incubated overnight at 208C, then harvested by centrifugation (7500g for 15 min at 48C) and then frozen. Cells were thawed and resuspended in 10 mM Tris/pH 8.0 and sonicated for three, 2 min on/off cycles at an output power of 21 W using a Model 60 Sonic Dismembrator (Fisher Scientific). The mixture was centrifuged (8500g for 20 min at 48C) to isolate the insoluble fraction which contained the VHH inclusion bodies. The inclusion body pellet was washed with 2% deoxycholic acid, 50 mM Tris/pH 8.0, 5 mM EDTA, then with deionized water and a final time with 10 mM Tris/pH 8.0. The resulting washed inclusion body pellet was solubilized with 50 ml unfolding buffer (6 M guanidine HCl, 50 mM sodium phosphate/pH 7.4, 300 mM NaCl, 2 mM reduced glutathione and 0.2 mM oxidized glutathione). The solution was clarified through centrifugation and then added dropwise to 500 ml of refolding buffer (20 mM Tris/pH7.4, 2 mM reduced glutathione, 0.2 mM oxidized glutathione) overnight with stirring at 58C. Purification of the metal clone VHH and removal of the Hexa-His-Tev tag were performed as previously described (Fanning et al., 2011).
Isothermal titration calorimetry ITC experiments were performed using a MicroCal VP-ITC (MicroCal, LLC). Proteins were dialyzed against the desired 396
Crystallization of the metal VHH structures The VHHmetal was run on a Superdex 75 model 10/30GL size exclusion column (GE Healthcare) with a 10 mM Tris/pH8.0, 300 mM NaCl running buffer. Fractions containing VHH were concentrated to 20 mg/ml using an Amicon ultrafiltration device with a 5 kDa cut-off membrane. RNase A complex solutions were generated by adding a 1.5 concentration of RNase A, then performing another size exclusion purification. NiSO4 was added to the VHH for a final concentration of 100 mM NiSO4 to generate the Ni2þ bound crystals. All crystals were grown by the hanging drop method. For the VHHmetal – Ni2þ complex structure, clear rectangular crystals appeared after 2 weeks when 2 ml of 10 mg/ml Ni2þ bound metal VHH was mixed with 2 ml of 1.8 M ammonium citrate tribasic, pH 7.0, 0.2 M ammonium acetate. For the VHHmetal – RNase A complex structure, clear rectangular crystals appeared overnight when 2 ml of 10 mg/ml VHHmetal – RNase A was mixed with 2 ml of 0.1 M Bis-Tris/pH 8.5, 25% w/v polyethylene glycol 3350. For the free VHHmetal, clear rectangular crystals formed overnight when 2 ml of 10 mg/ml VHHmetal was mixed with 2 ml 0.1 M Bis-Tris/pH 5.5 and 2.0 M ammonium sulfate. Twenty percent glycerol was used as a cryoprotectant for all data collections. All X-ray data sets were collected at the Advanced Photon Source at Argonne National Laboratories, Argonne, Illinois at ˚ . The beamline was the SER-CAT-22BM beamline at 1 A 2þ ˚ tuned to 1.44 A for the Ni bound structure to diffract the nickel edge for the generation of an anomalous difference map to insure the presence of Ni2þ at the binding site.
X-Ray structure solution Data were indexed, merged and scaled using HKL-2000 (Otwinowski and Minor, 1997). Molecular replacement was performed using Phaser (McCoy et al., 2007) with an existing anti-RNase A VHH (PDB ID: 2P94) as the input model (Koide
Downloaded from http://peds.oxfordjournals.org/ at Rutgers University on August 16, 2015
Using a pET-21a(þ) vector (Novagen) containing the gene for a Hexa-His-Tev-anti-RNase A VHH-metal (Fanning et al., 2011), Kunkel Mutagenesis (Kunkel, 1985) was performed to incorporate H29Y, H33Y, H110Q, Q1A and Q1E mutations. The following oligonucleotide sequences were used to generate the mutants:
experimental buffer, TBS (20 mM Tris/pH 7.4, 150 mM NaCl). Titrations included a typical 10 : 1 ratio of nickel ion (syringe) to VHH (cell) with NiCl2 concentrations between 300 mM and 30 mM and VHH concentrations between 30 and 300 mM. Extinction coefficients were determined using values determined by the methods described by Pace et al. (Pace et al., 1995). The extinction coefficient for the VHHmetal, Q1A and H110Q mutants were 23 045 and 24 410 M21 cm21 for the H29Y and H33Y mutants. Experiments with c-values ,5 (c-value ¼ Kobs[VHH]), such as Q1A, H29Y, H110Q and the double/triple mutants followed methods of Turnbull and Daranas (Turnbull and Daranas, 2003). All experiments were performed at 258C. Experiments typically included 28, injections whereby an initial 2 ml injection was used to account for dilution across the syringe and the heat was discarded. The remaining injections were 10 ml with a 240-s delay between each injection. Dilution heat experiments were performed whereby concentrations of Ni2þ matching the experimental were injected into buffer following each experiment and were subtracted from the data. The binding parameters (K, DH8, DS8 and n) were determined using the single-site binding model using the ITC add-in in Origin version 7 (MicroCal LLC). All 10 : 1 titrations indicated a 1 : 1 interaction with observed stoichiometries equal to 1.0 (within 5%). All 100 : 1 required fixing the stoichiometry to the known value of 1 (Turnbull and Daranas, 2003).
Engineering multi-specific antibodies: protein switches
Acknowledgements The authors thank Ryan Bourgo, Megan Murtaugh and Christopher Smith for their helpful comments and discussion.
Funding This work was supported by the National Science Foundation (MCB-0953323 to J.R.H.). The US Department of Energy, Office of Science, Office of Basic Energy Sciences for supporting use of the Advanced Photon Source under Contract No. W-31-109-Eng-38, as well as the Southeast Regional Collaborative Access Team (SER-CAT) 22-BM beamline, Argonne National Laboratory, supporting institutions can be found at www.ser-cat.org/members.html.
Kunkel,T.A. (1985) Proc. Natl Acad. Sci. USA, 82, 488–492. Lu,Y., Yeung,N., Sieracki,N. and Marshall,N.M. (2009) Nature, 460, 855–862. Martin,A., Damian,M., Laguerre,M., Parello,J., Pucci,B., Serre,L., Mary,S., Marie,J. and Baneres,J.L. (2009) Protein Sci., 18, 727– 734. McCoy,A.J., Grosse-Kunstleve,R.W., Adams,P.D., Winn,M.D., Storoni,L.C. and Read,R.J. (2007) J. Appl. Crystallogr., 40, 658–674. Murtaugh,M.L., Fanning,S.W., Sharma,T.M., Terry,A.M. and Horn,J.R. (2011) Protein Sci., 20, 1619–1631. Otwinowski,Z. and Minor,W. (1997) Methods Enzymol., 276, 307– 326. Pace,C.N., Vajdos,F., Fee,L., Grimsley,G. and Gray,T. (1995) Protein Sci., 4, 2411– 2423. Pagel,P., Kovac,S., Oesterheld,M., et al. (2005) Bioinformatics, 21, 832–834. Regan,L. (1993) Ann. Rev. Biophys. Biomol. Struct., 22, 257–287. Roberts,V.A. and Getzoff,E.D. (1995) FASEB J., 9, 94–100. Roberts,V.A., Iverson,B.L., Iverson,S.A., Benkovic,S.J., Lerner,R.A., Getzoff,E.D. and Tainer,J.A. (1990) Proc. Natl Acad. Sci. USA, 87, 6654– 6658. Salgado,E.N., Faraone-Mennella,J. and Tezcan,F.A. (2007) J. Am. Chem. Soc., 129, 13374–13375. Salgado,E.N., Ambroggio,X.I., Brodin,J.D., Lewis,R.A., Kuhlman,B. and Tezcan,F.A. (2010a) Proc. Natl Acad. Sci. USA, 107, 1827–1832. Salgado,E.N., Radford,R.J. and Tezcan,F.A. (2010b) Acc. Chem. Res., 43, 661–672. Salgado,E.N., Brodin,J.D., To,M.M. and Tezcan,F.A. (2011) Inorg. Chem., 50, 6323– 6329. Schonichen,A., Webb,B.A., Jacobson,M.P. and Barber,D.L. (2013) Annu. Rev. Biophys., 42, 289– 314. Thompson,L.C., Goswami,S. and Peterson,C.B. (2011) Protein Sci., 20, 366–378. Turnbull,W.B. and Daranas,A.H. (2003) J. Am. Chem. Soc., 125, 14859–14866. Zambelli,B., Danielli,A., Romagnoli,S., Neyroz,P., Ciurli,S. and Scarlato,V. (2008) J. Mol. Biol., 383, 1129– 1143.
References Atanassova,A. and Zamble,D.B. (2005) J. Bacteriol., 187, 4689–4697. Beadle,B.M. and Shoichet,B.K. (2002) J. Mol. Biol., 321, 285– 296. Chang,H.C., Chou,W.Y. and Chang,G.G. (2002) J. Biol. Chem., 277, 4663–4671. Collaborative Computational Project N. (1994) Acta Crystallogr, D50, 760–763. Conti,M. and Beavo,J. (2007) Ann. Rev. Biochem., 76, 481 –511. Crowder,M.W., Stewart,J.D., Roberts,V.A., Bender,C.J., Tevelrakh,E., Peisach,J., Getzoff,E.D., Gaffney,B.J. and Benkovic,S.J. (1995) J. Am. Chem. Soc., 117, 5627–5634. DeLano,W.L. (2002) The PyMOL Molecular Graphics System, Version 1.5.0.4 Schro¨dinger, LLC. DeLano Scientific, San Carlos, CA, USA. Dellus-Gur,E., Toth-Petroczy,A., Elias,M. and Tawfik,D.S. (2013) J. Mol. Biol., 425, 2609– 2621. Emsley,P. and Cowtan,K. (2004) Acta Crystallogr. D Biol. Crystallogr., 60, 2126–2132. Erijman,A., Aizner,Y. and Shifman,J.M. (2011) Biochemistry, 50, 602– 611. Fanning,S.W., Murtaugh,M.L. and Horn,J.R. (2011) Biochemistry, 50, 5093–5095. Harding,M.M. (2004) Acta Crystallogr. D Biol. Crystallogr., 60, 849–859. Harding,M.M. (2006) Acta Crystallogr. D Biol. Crystallogr., 62, 678–682. Higaki,J.N., Haymore,B.L., Chen,S., Fletterick,R.J. and Craik,C.S. (1990) Biochemistry, 29, 8582– 8586. Hubbard,S.J. and Thornton,J.M. (1993) ‘NACCESS’, Computer Program, Department of Biochemistry and Molecular Biology, University College London. James,L.C., Roversi,P. and Tawfik,D.S. (2003) Science, 299, 1362–1367. Kerkhoff,C., Vogl,T., Nacken,W., Sopalla,C. and Sorg,C. (1999) FEBS Lett., 460, 134– 138. Koide,A., Tereshko,V., Uysal,S., Margalef,K., Kossiakoff,A.A. and Koide,S. (2007) J. Mol. Biol., 373, 941–953. Krantz,B.A. and Sosnick,T.R. (2001) Nat. Struct. Biol., 8, 1042– 1047.
397
Downloaded from http://peds.oxfordjournals.org/ at Rutgers University on August 16, 2015
et al., 2007). All structures possess one molecule or complex in the asymmetric unit. The CCP4 (Refmac) program suite was used for all refinements (Collaborative Computational Project, 1994). The residues of each CDR were removed during the initial refinement and were subsequently re-built using iterative rounds of refinement and model building with Refmac and Coot (Emsley and Cowtan, 2004). Density corresponding to the nickel (II) ion was clearly visible in the Ni2þ bound structure after one round of refinement and confirmed with a large peak at the same location in the anomalous difference map. The final structure of the RNase A bound metal VHH does not possess residues 19– 22 in Chain A as they are not resolved in the electron density. All molecular images were generated using PYMOL (DeLano, 2002). Accessible surface area calculations were done using the program NACCESS (Hubbard and Thornton, 1993). The models and structure factors were each deposited in the RCSB (PDBs: 4PPT, 4POUand 4POY).
