http://informahealthcare.com/mdn ISSN: 1940-1736 (print), 1940-1744 (electronic) Mitochondrial DNA, Early Online: 1–5 ! 2014 Informa UK Ltd. DOI: 10.3109/19401736.2014.895987
ORIGINAL ARTICLE
Structure and evolution of the Phasianidae mitochondrial DNA control region Zuhao Huang and Dianhua Ke
Mitochondrial DNA Downloaded from informahealthcare.com by Cornell University on 05/31/14 For personal use only.
School of Life Sciences, Jinggangshan University, Ji’an, Jiangxi Province, China
Abstract
Keywords
The mitochondrial DNA control region is an area of the mitochondrial genome which is non-coding DNA. To infer the structural and evolutionary characteristics of Phasianidae mitochondrial DNA control region, the entire control region sequences of 34 species were analyzed. The length of the control region sequences ranged from 1144 bp (Phasianus colchicus) to 1555 bp (Coturnix japonica) and can be separated into three domains. The average genetic distances among the species within the genera varied from 1.96% (Chrysolophus) to 12.05% (Coturnix). The average genetic distances showed significantly negative correlation with ts/tv. In most genera (except Coturnix), domain I is the most variable among the three domains. However, the first 150 nucleotides apparently evolved at unusually low rates. Four conserved sequence boxes in the domain II of Phasianidae sequences were identified. The alignment of the Phasianidae four boxes and CSB-1 sequences showed considerable sequence variation.
Control region, mitochondrial dna, phasianidae, structure
Introduction The mitochondrial DNA (mtDNA) control region is an area of the mitochondrial genome which is non-coding DNA. In most species, control region is the most variable part of the vertebrate mtDNA genome, presumably because of the lack of coding constrains (Baker & Marshall, 1997). Because the mutation rates were relatively higher than other mtDNA genes and nuclear genes, the control region sequences were used frequently to estimate phylogenetic relationships (Huang et al., 2009) and population genetics (Xiao et al., 2013; Zhong et al., 2013) in animals. The control region is flanked by the genes for tRNAGlu and tRNAPhe in most of the avian species, but by tRNAThr and tRNAPro in some species of Picidae, Passeriformes, Falconiformes, and Cuculidae (Bensch & Ha¨rlid, 2000; Mindell et al., 1998). The mitochondrial DNA control region of animal is divided into three domains: the tRNAGlu -adjacent domain I, the central conserved domain II, the tRNAPhe -adjacent domain III (Randi & Lucchini, 1998). The three domains of the control region evolve at high different rates (Randi & Lucchini, 1998). Most of the variability within the control region is concentrated in the domains I and III (Baker & Marshall, 1997). Randi & Lucchini (1998) described the comparative structural organization of the mitochondrial DNA control region in the Alectoris of Phasianidae. The structure and evolution of avian control region have been analyzed (Baker & Marshall, 1997; Quinn & Wilson, 1993; Ruokonen & Kvist, 2002). But only limited number of avian species control region have been studied. Rates and patterns of molecular evolution of Phasianidae control region are not known, with except of a few studies (Huang & Correspondence: Zuhao Huang, School of Life Sciences, Jinggangshan University, Ji’an, Jiangxi Province 343009, China. Tel: +86 7968106363. Fax: +86 7968100493. E-mail: [email protected]
History Received 17 December 2013 Revised 10 February 2014 Accepted 16 February 2014 Published online 11 March 2014
Liao, 2011; Randi & Lucchini, 1998). The avian family Phasianidae is one of the most important groups of birds. In recent years, mitochondrial complete genome of many Phasianidae species was sequenced and available in GenBank. In the present study, we examined the structure of the control region of Phasianidae species based on the complete mitochondrial genome retrieved from GenBank. The aim of this paper is to characterize the structural features and patterns of sequence evolution of the Phasianidae mitochondrial DNA control region.
Materials and methods All the sequences were fetched from the GenBank (species and accession numbers in Table 1). To ensure the entire mitochondrial DNA control region, only mitochondrial complete genome were selected. A total of 34 species from 18 genera belonging to the Phasianidae family were analyzed (Table 1). Sequences were aligned by the CLUSTAL X procedure (Thompson et al., 1997). DnaSP v5.0 (Librado & Rozas, 2009) was used to define the variable sites. Nucleotide composition was calculated using MEGA5.0 (Tamura et al., 2011). Sequence divergence among genera was calculated using the Tamura & Nei (TN93, 1993) model in MEGA 5.0. Only the genera containing at least two species were selected for calculating intrageneric values. Pairwise transition and transversion estimates and distribution of variable nucleotide positions were calculated in MEGA5.0 (Tamura et al., 2011). The relative variability of the domains was tested by calculating the proportion of the variable nucleotides in each domain and using Student’s t test for proportions to test whether they are significantly different. The boundary of domains I, II and III was defined according to Randi and Lucchini (1998). The conserved sequence boxes found were compared with the previously published Alectoris boxes (Randi & Lucchini, 1998).
2
Z. Huang & D. Ke
Mitochondrial DNA, Early Online: 1–5
Table 1. Species examined and source of sequence data in the present study.
Species
Code
Length of the control region
Accession Number
Sources
Tetraophasis obscurus Tetraophasis szechenyii Alectoris chukar Francolinus pintadeanus Perdix dauurica Coturnix chinensis Coturnix japonica Arborophila rufipectus Arborophila brunneopectus Arborophila ardens Arborophila rufogularis Arborophila gingica Bambusicola thoracica Bambusicola fytchii Ithaginis cruentus Tragopan caboti Tragopan temminckii Pucrasia macrolopha Lophophorus lhuysii Lophophorus sclateri Gallus gallus Lophura ignita Lophura nycthemera Crossoptilon crossoptilon Crossoptilon auritum Syrmaticus ellioti Syrmaticus humiae Syrmaticus reevesii Syrmaticus soemmerringi Phasianus colchicus Phasianus versicolor Chrysolophus pictus Chrysolophus amherstiae Polyplectron bicalcaratum Pavo muticus
Tob Tsz Ach Fpi Pda Cch Cja Aru Abr Aar Arr Agi Bth Bfy Icr Tca Tte Pma Lih Lsc Gga Lig Lny Ccr Cau Sel Shu Sre Sso Pco Pve Cpi Cam Pbi Pmu
1167 1168 1154 1169 1153 1150 1555 1176 1174 1178 1178 1176 1146 1174 1148 1177 1178 1154 1167 1167 1232 1147 1148 1146 1146 1153 1153 1150 1152 1144 1150 1148 1148 1170 1156
NC018034 NC020613 NC020585 EU165707 NC020588 NC004575 NC003408 NC012453 NC022684 NC022683 NC020584 FJ752425 EU165706 NC020583 NC018033 NC013619 NC020586 NC020587 NC013979 NC020589 AP003323 NC010781 NC012895 NC016679 NC015897 NC010771 NC010774 NC010770 NC010767 NC015526 NC010778 NC014576 NC020590 NC012900 NC012897
Ma & Ran, 2012, unpublished Shen et al., 2010 Shen et al., 2010 Shen et al., 2010 Shen et al., 2010 Nishibori et al., 2002 Nishibori et al., 2001 He et al., 2009 Yan et al., 2013, unpublished Yan et al., 2013, unpublished Shen et al., 2010 Shen et al., 2010 Shen et al., 2010 Shen et al., 2010 Zeng et al., 2013 Kan et al., 2010 Shen et al., 2010 Shen et al., 2010 Ma et al., 2010 Shen et al., 2010 Nishibori et al., 2005 Kato et al., 2009, unpublished Shen et al., 2010 Zhao & Zou, 2012, unpublished Li & Kan, 2011, unpublished Kato et al., 2009, unpublished Kato et al., 2009, unpublished Kato et al., 2009, unpublished Kato et al., 2009, unpublished Li et al., 2013 Kato et al., 2009, unpublished Qin & Shi, 2010, unpublished Shen et al., 2010 Shen et al., 2010 Shen et al., 2010
Genus Tetraophasis Alectoris Francolinus Perdix Coturnix Arborophila
Bambusicola
Mitochondrial DNA Downloaded from informahealthcare.com by Cornell University on 05/31/14 For personal use only.
Ithaginis Tragopan Pucrasia Lophophorus Gallus Lophura Crossoptilon Syrmaticus
Phasianus Chrysolophus Polyplectron Pavo
Results and discussion
Table 2. Average base composition (%) of Phasianidae control region.
Alignments
Region
The control region spans the region between the genes for tRNAGlu and tRNAPhe in the Phasiandiae species. The alignment of control region of Phasianidae was straightforward. The length of the control region is relatively conserved, about 1150 bp, but that of Coturnix japonica is up to 1555 bp (Table 1). According to the existing research, the length of control region in animal varied from 120 bp (Strongylocentrotus purpuratus, Valverde et al., 1994) to 4707 bp (Mantella madagascariensis, Kurabayashi et al., 2006). Large-scale variation of tandemly repeated sequences might cause the control region size variation (Rand, 1993). All the Phasiandiae species had only one control region. Most of animal species have only one control region, however some species have duplicate control regions, including thrips (Shao & Barker, 2003), ticks (Black & Roehrdanz, 1998; Campbell & Barker, 1998, 1999), sea cucumbers (Arndt & Smith, 1998), fish (Lee et al., 2001), parrots (Eberhard et al., 2001), snakes (Kumazawa et al., 1996, 1998), and birds (Mindell et al., 1998).
Domain I Domain II Domain III Whole control region
Base composition and genetic distance The average nucleotide composition of Phasianidae control region sequences was: 26.59%A, 32.75 ± 0.16%T, 14.21 ± 0.46%G, 26.75 ± 0.67%C, with a bias against G (Table 2). The amount of A+T was more than that of G+C among whole control region, especially in domain III, same as reported in other avian control region (Baker & Marshall, 1997; Ruokonen & Kvist, 2002).
T
C
A
G
A+T
29.17 33.13 34.47 32.51
28.81 30.03 21.05 26.75
29.95 16.25 36.18 26.53
12.06 20.59 8.30 14.21
59.12 49.38 70.65 59.04
The lack of guanines is evident in each domain. Thymines and adenines are most prevalent in the first domain, thymines and cytosines in the second, and a thymines and cytosines in the third (Table 2). Nucleotide frequencies were not significantly different among species, and thus the Tamura and Nei (TN93, 1993) model is an appropriate estimator of genetic distance (Randi & Lucchini, 1998). Phasianidae control region sequences were alignable with certainty within genus. Genetic distances between species ranged from 1.96% (between Chrysolophus pictus and Chrysolophus amherstiae) to 20.67% (between Perdix dauurica and Alectoris chukar), showing a wide range of divergences. The average genetic distances among the species within the genera varied from 1.96% (Chrysolophus) to 12.05% (Coturnix) (Table 3). The average genetic distances showed significantly negative correlation with ts/tv (r ¼ 0.662, p50.05). Distribution of variable sites in the control region Control region are usually considered to be the most variable parts of mtDNA (Randi & Lucchini, 1998). However, position
Phasianidae mitochondrial control region
DOI: 10.3109/19401736.2014.895987
mutability is not distributed randomly across the whole region, but affects particular hyper-variable positions and domains (Lyrholm et al., 1996; Yang, 1996). The distribution of the variation in the control region seems to be the same in all the species within genera. Nucleotide substitutions occur more frequently in peripheral domains. Average substitution rate for the three domains were 0.50: 0.19: 0.31, corresponding to relative proportions of 5:2:3, respectively. In most genera (except Coturnix) of Phasianidae, domain I is the most variable of the three domains (Figure 1), with average 50.29% variable positions. Significant difference was observed among five genera (Student’s t test for proportions: Bambusicola, t ¼ 2.21, p50.05; Lophura, t ¼ 2.70, p50.05; Crossoptilon, t ¼ 2.46, p50.05;
Mitochondrial DNA Downloaded from informahealthcare.com by Cornell University on 05/31/14 For personal use only.
Table 3. Average percentage divergence and transition/transversion ratios in pairwise comparisons of the species within each genus. Genus
N
%divergence
ts/tv
Tetraophasis Coturnix Arborophila Bambusicola Tragopan Lophophorus Lophura Crossoptilon Syrmaticus Phasianus Chrysolophus
2 2 5 2 2 2 2 2 4 2 2
4.11 12.05 4.66 6.63 4.62 5.28 6.25 3.54 8.45 2.96 1.96
4.11 0.95 1.73 2.13 9.40 2.11 2.58 5.50 1.63 4.50 10.00
N, number of species.
3
Phasianus, t ¼ 2.46, p50.05; Chrysolophus, t ¼ 2.62, p50.05). However, the distribution of the variable positions within domain I of Phasianidae was markedly non-random. The first 150 nucleotides, adjacent to the tRNAGlu, apparently evolved at unusually low rates among genera (with only 7.48% variable positions), while the second part of this domain was hypervariable (with 42.34% variable positions). Marshall & Baker (1997) believed mutational hotspots might occur in domain I, whereas more variation was expected in domain III for deeper divergences. Ruokonen & Kvist (2002) found that variation of three genera was greatest in domain III. Our results support this. Coturnix is the most divergent genus, with genetic distance 12.05% among the species pairs. In Coturnix, variation is greatest in domain III, accounting for 41.01%. Average substitution rate for the first and second parts of domain I, central domain II, and domain III were 0.08, 0.42, 0.20 and 0.30, respectively. The presence of a conserved part within domain I, which evolves slow rate than that of the conserved central block, suggests a special organization of control region of Phasianidae. Conserved sequence Previous comparisons of control region sequences have identified conserved sequence elements based on greater similarity of the sequence elements compared to that of the flanking areas (Ruokonen & Kvist, 2002). We aligned the sequences of the central conserved domain II of every species. Four conserved sequence boxes in the domain II of Phasianidae sequences were localized (Table 4) and identified as boxes F, E, D and C. These foxes were also identified by Randi & Lucchini (1998)
Figure 1. Distribution of the variable sites in the control region. The number of variable sites within genera has been plotted in 50-bp intervals.
4
Z. Huang & D. Ke
Mitochondrial DNA, Early Online: 1–5
Table 4. F-, E-, D- and C-boxes and CSB-1 sequences for the Phasianidae species. Species
F-box
Cch, Tsz, Lih, Lsc, Lig, Lny, Cpi, Cam, Ccr, Cau, Sre, Sso, Pma, Icr, Aar, Bth, Bfy, Fpi, Pmu Cja, Ach, Tob, Pco, Pve, Sel, Shu Tca, Tte Pbi, Pda Arr, Agi, Aru, Abr Gga
GTACACCTCACGAGAGATCAGCAACCCC
Mitochondrial DNA Downloaded from informahealthcare.com by Cornell University on 05/31/14 For personal use only.
Cch, Ach, Tob, Tsz, Lih, Lsc, Lig, Lny, Cpi, Cam, Pco, Pve, Ccr, Cau, Pma, Icr, Tca, Tte, Pbi, Arr, Agi, Aru, Abr, Aar, Pmu, Pda, Cja Sel, Shu, Sso Sre, Bth, Bfy Gga, Fpi. Cch, Cja, Ach, Tob, Tsz, Bth, Bfy, Gga, Fpi, Pmu Lih, Lsc, Lny, Cpi, Cam, Pco, Pve, Ccr, Cau, Sel, Shu, Sre, Sso, Pma, Icr, Tca, Tte, Pbi, Pda Lig Aar, Agi, Aru, Abr, Aar Cch, Ach, Tob, Tsz, Lih, Lsc, Lig, Lny, Cpi, Cam, Pco, Pve, Ccr, Cau, Sel, Shu, Sre, Sso, Pma, Icr, Tca, Tte, Pbi, Arr, Agi, Aru, Abr Aar, Gga, Fpi, Pmu, Pda Cja Bth Bfy Cch Cja, Ach, Cpi, Cam, Tte Tob, Tsz, Lih, Lsc, Lig, Lny, Pco, Pve, Ccr, Cau, Sel, Shu, Sre, Pma, Icr, Pbi, Arr, Agi, Aru, Bth, Bfy, Gga, Pmu, Pda Sso Aar Tca Abr Fpi
. . . . . . . . . . . . . . . . . . . .C. . . . . . . . . . . . . . . . . . . . . . . .C. . . . . . . . . . .G. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .T. .T . .C. . . . . . . . . . . . . . . . . . . . . . . . . E-box ATGACTAGCTTCAGGCCCAT G. . . . . . . . . . . . . . . . . . . G. . . .C. .TC. . . . . . . . . . . . . . . . . .TC. . . . . . . . . . . . . . .C. .TC. . . . . . . . . . D-box CCTCTGGTTCCTCGGTCAGGCACAT . . . . . . . . . . . . . . . . . . . .A. . . . . . . . . . . .G. . . . . . . . . . .A. . . . . . . . . . . . . . . . . . . . . . . .GC. . . C-box CTCACTTTTCACGAAGTCATCTGTG . .T. . . . . .T. . . . . . . . . . . . . . . . . . . . . . .CA. . . .G.C. . . . . . . . . . . . .AC.CA. . . .G.C. . . . . . . . CSB-1 TATATGGTGAATGCTTGTCGGACATA . . . . .A.G. . . . . . . . .C. . . . . . . . . . . . .A. . . . . . . . . . . . . . . . . . . . . . .T.A. . . . . . . . . . . . . . . . . . . . . . .T.A. . . . . . . . .C. . . . . . . . . . . . .T.A. . . . . . . . . . . . . . .G. . . . . . .G.A. . . . . . . . . . . . . . . . . . . . . . .T. . . . . . . . . . . . . . . . . . . . . . . . .T.A. . . . . . . . . . .C. . . . . . . .
For F-, E-, D- and C-boxes and CSB-1 the corresponding sequences from Alectoris (Randi & Lucchini, 1998) is shown. The species codes were shown in Table 1.
in Alectoris sequences. We did not find high similarity in the B-box that Ruokonen & Kvist (2002) identified in some avian sequences. Recently, six central conserved sequence boxes (F to A) were detected in fishes (Gao et al., 2013; Zhang et al., 2011). In F-box, 22 of 28 nucleotide positions were fully conserved among the Phasianidae sequences; and in C-box, 18 of 25 nucleotide positions were fixed. While, there were four nucleotide positions were variable in E-box and D-box (Table 4). Domain III was always defined to begin with the conserved sequence blocks 1 (CSB-1) (Walberg & Clayton, 1981). The alignment of the Phasianidae CSB-1 sequences showed considerable sequence variation (Table 4). Six nucleotide positions were variable. These variable positions were detected both interspecific species and intergeneric species. However, CSB-2 and 3 were not found in the Phasianidae, as shown for fishes (Xu et al., 2011; Zhang et al., 2011, 2013), avian (Baker & Marshall, 1997), and mammalian species (Walberg & Clayton, 1981).
Declaration of interest The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper. This work was supported by the National Natural Science Foundation of China (30960051, 31260088), Jiangxi Province Talent Project 555, Jiangxi Province Major Disciplines Academic Leaders, and the Natural Science Foundation of Jiangxi Province (20132BAB204022).
References Arndt A, Smith MJ. (1998). Mitochondrial gene rearrangement in the sea cucumber genus Cucumaria. Mol Biol Evol 15:1009–16. Baker AJ, Marshall HD. (1997). Mitochondrial control region sequences as tools for understanding evolution. In: Mindell DP, editor. Avian molecular evolution and systematics. San Diego: Academic Press. p 51–82. Bensch S, Ha¨rlid A. (2000). Mitochondrial genomic rearrangements in songbirds. Mol Biol Evol 17:107–13. Black WC, Roehrdanz RL. (1998). Mitochondrial gene order is not conserved in arthropods: Prostriate and metastriate tick mitochondrial genomes. Mol Biol Evol 15:1772–85. Campbell NJH, Barker SC. (1998). An unprecedented major rearrangement in an arthropod mitochondrial genome. Mol Biol Evol 15: 1786–7. Campbell NJH, Barker SC. (1999). The novel mitochondrial gene arrangement of the cattle tick, Boophilus microplus: Fivefold tandem repetition of a coding region. Mol Biol Evol 16: 732–40. Eberhard JR, Wright TF, Bermingham E. (2001). Duplication and concerted evolution of the mitochondrial control region in the parrot genus Amazona. Mol Biol Evol 18:1330–42. Gao TX, Li N, Zhang YP, Shi P. (2013). The complete mitochondrial genome of Japanese sandeel Ammodytes personatus (Perciformes, Ammodytidae): Rare structure in control region compared. Mitochondrial DNA 24:320–2. He L, Dai B, Zeng B, Zhang X, Chen B, Yue B, Li J. (2009). The complete mitochondrial genome of the Sichuan Hill Partridge (Arborophila rufipectus) and a phylogenetic analysis with related species. Gene 435:23–8.
Mitochondrial DNA Downloaded from informahealthcare.com by Cornell University on 05/31/14 For personal use only.
DOI: 10.3109/19401736.2014.895987
Huang ZH, Liao XJ. (2011). Structure of the mitochondrial DNA control region and genetic variation of Chrylosophus pictus. Life Sci Res 15: 223–8. Huang ZH, Liu NF, Xiao YA, Chen YL, Mei WF, Wen LY, Zhang LX, Yu XP. (2009). Phylogenetic relationships of four endemic genera of the Phasianidae in China based on mitochondrial DNA control region genes. Mol Phylogenet Evol 52:378–83. Kan XZ, Li XF, Lei ZP, Wang M, Chen L, Gao H, Yang ZY. (2010). Complete mitochondrial genome of Cabot’s tragopan, Tragopan caboti (Galliformes: Phasianidae). Genet Mol Res 9:1204–16. Kumazawa Y, Ota H, Nishida M, Ozawa T. (1996). Gene rearrangements in snake mitochondrial genomes: Highly concerted evolution of control-region-like sequences duplicated and inserted into a tRNA gene cluster. Mol Biol Evol 13:1242–54. Kumazawa Y, Ota H, Nishida M, Ozawa T. (1998). The complete nucleotide sequence of a snake (Dinodon Semicarinatus) mitochondrial genome with two identical control regions. Genetics 150:313–29. Kurabayashi A, Usuki C, Mikami N, Fujiii T, Yonekawa H, Sumida M, Hasegawa M. (2006). Complete nucleotide sequence of the mitochondrial genome of a Malagasy poison frog Mantella madagascariensis: Evolutionary implications on mitochondrial genomes of higher anuran groups. Mol Phylogenet Evol 39:223–36. Lee JS, Miya M, Lee YS, Kim CG, Park EH, Aoki Y, Nishida M. (2001). The complete DNA sequence of the mitochondrial genome of the selffertilizing fish Rivulus marmoratus (Cyprinodontiformes, Rivulidae) and the first description of duplication of a control region in fish. Gene 280:1–7. Li X, Ren Q, Kan X, Qian C, Li X, Qian M. (2013). Complete mitochondrial genome of the ring-necked pheasant, Phasianus colchicus (Galliformes: Phasianidae). Mitochondrial DNA 24:89–90. Librado P, Rozas J. (2009). DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25:1451–2. Lyrholm T, Leimar O, Gyllensten U. (1996). Low diversity and biased substitution patterns in the mitochondrial DNA control region of sperm whales: Implications for the estimates of time since common ancestry. Mol Biol Evol 13:1318–26. Ma LL, Zhang XY, Yue BS, Ran JH. (2010). Complete mitochondrial genome of the Chinese Monal pheasant Lophophorus lhuysii, with phylogenetic implication in Phasianidae. Mitochondrial DNA 21:5–7. Marshall HD, Baker AJ. (1997). Structural conservation and variation in the mitochondrial control region of fringilline finches (Fringilla spp.) and the greenfinch (Carduelis chloris). Mol Biol Evol 14:173–84. Mindell DP, Sorenson MD, Dimcheff DE. (1998). Multiple independent origins of mitochondrial gene order in birds. Proc Natl Acad Sci USA 95:10693–7. Nishibori M, Hayashi T, Tsudzuki M, Yamamoto Y, Yasue H. (2001). Complete sequence of the Japanese quail (Coturnix japonica) mitochondrial genome and its genetic relationship with related species. Anim Genet 32:380–5. Nishibori M, Shimogiri T, Hayashi T, Yasue H. (2005). Molecular evidence for hybridization of species in the genus Gallus except for Gallus varius. Anim Genet 36:367–75. Nishibori M, Tsudzuki M, Hayashi T, Yamamoto Y, Yasue H. (2002). Complete nucleotide sequence of the Coturnix chinensis (blue-breasted quail) mitochondrial genome and a phylogenetic analysis with related species. J Hered 93:439–44. Quinn TW, Wilson AC. (1993). Sequence evolution in and around the mitochondrial control region in birds. J Mol Evol 37:417–25.
Phasianidae mitochondrial control region
5
Rand DM. (1993). Endotherms, ectotherms, and mitochondrial genome size variation. J Mol Evol 37:281–95. Randi E, Lucchini V. (1998). Organization and evolution of the mitochondrial DNA control region in the avian genus Alectoris. J Mol Evol 47:449–62. Ruokonen M, Kvist L. (2002). Structure and evolution of the avian mitochondrial control region. Mol Phylogenet Evol 23:422–32. Shao R, Barker SC. (2003). The highly rearranged mitochondrial genome of the plague thrips, Thrips imaginis (Insecta: Thysanoptera): Convergence of two novel gene boundaries and an extraordinary arrangement of rRNA genes. Mol Biol Evol 20:362–70. Shen YY, Liang L, Sun YB, Yue BS, Yang XJ, Murphy RW, Zhang YP. (2010). A mitogenomic perspective on the ancient, rapid radiation in the Galliformes with an emphasis on the Phasianidae. BMC Evol Biol 10:132. Tamura K, Nei M. (1993). Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol 10:512–26. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. (2011). MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Mol Biol Evol 28:2731–9. Thompson JD, Gibson TJ, Plewniak F. (1997). The Clustal X windows interface flexible strategies for multiple sequence alignment aided by quality analysis tool. Nucleic Acid Res 24:4876–82. Valverde JR, Marco R, Garesse R. (1994). A conserved heptamer motif for ribosomal RNA transcription termination in animal mitochondria. Proc Natl Acad Sci USA 91:5368–71. Walberg MW, Clayton DA. (1981). Sequence and properties of the human KB cell and mouse L cell D-loop regions of mitochondrial DNA. Nucleic Acids Res 9:5411–21. Xiao YS, Song N, Li J, Xiao ZZ, Gao TX. (2013). Significant population genetic structure detected in the small yellow croaker Larimichthys polyactis inferred from mitochondrial control region. Mitochondrial DNA 24:1–11. Xu TJ, Cheng YZ, Sun YN, Shi G, Wang RX. (2011). The complete mitochondrial genome of bighead croaker, Collichthys niveatus (Perciformes, Sciaenidae): Structure of control region and phylogeneic considerations. Mol Biol Rep 38:4673–85. Yang Z. (1996). Among-site rate variation and its impact on phylogenetic analyses. Trends Ecol Evol 11:367–72. Zeng T, Tu F, Ma L, Yan C, Yang N, Zhang X, Yue B, Ran J. (2013). Complete mitochondrial genome of blood pheasant (Ithaginis cruentus). Mitochondrial DNA 24:484–6. Zhang H, Zhang Y, Zhang XM, Song N, Gao TX. (2013). Special structure of mitochondrial DNA control region and phylogenetic relationship among individuals of the black rockfish, Sebastes schlegelii. Mitochondrial DNA 24:151–7. Zhang Y, Zhang H, Gao TX, Miao ZQ. (2011). Structure of mitochondrial DNA control region and molcular phylogenetic relationship among three flounders of genus Pleuronectes. Bioch Syst Ecol 39:627–34. Zhong LQ, Song C, Wang MH, Chen YM, Qin Q, Pan JL, Chen XH. (2013). Genetic diversity and population structure of yellow catfish Pelteobagrus fulvidraco from five lakes in the middle and lower reaches of the Yangtze River, China, based on mitochondrial DNA control region. Mitochondrial DNA 24:552–8.
ORIGINAL ARTICLE
Structure and evolution of the Phasianidae mitochondrial DNA control region Zuhao Huang and Dianhua Ke
Mitochondrial DNA Downloaded from informahealthcare.com by Cornell University on 05/31/14 For personal use only.
School of Life Sciences, Jinggangshan University, Ji’an, Jiangxi Province, China
Abstract
Keywords
The mitochondrial DNA control region is an area of the mitochondrial genome which is non-coding DNA. To infer the structural and evolutionary characteristics of Phasianidae mitochondrial DNA control region, the entire control region sequences of 34 species were analyzed. The length of the control region sequences ranged from 1144 bp (Phasianus colchicus) to 1555 bp (Coturnix japonica) and can be separated into three domains. The average genetic distances among the species within the genera varied from 1.96% (Chrysolophus) to 12.05% (Coturnix). The average genetic distances showed significantly negative correlation with ts/tv. In most genera (except Coturnix), domain I is the most variable among the three domains. However, the first 150 nucleotides apparently evolved at unusually low rates. Four conserved sequence boxes in the domain II of Phasianidae sequences were identified. The alignment of the Phasianidae four boxes and CSB-1 sequences showed considerable sequence variation.
Control region, mitochondrial dna, phasianidae, structure
Introduction The mitochondrial DNA (mtDNA) control region is an area of the mitochondrial genome which is non-coding DNA. In most species, control region is the most variable part of the vertebrate mtDNA genome, presumably because of the lack of coding constrains (Baker & Marshall, 1997). Because the mutation rates were relatively higher than other mtDNA genes and nuclear genes, the control region sequences were used frequently to estimate phylogenetic relationships (Huang et al., 2009) and population genetics (Xiao et al., 2013; Zhong et al., 2013) in animals. The control region is flanked by the genes for tRNAGlu and tRNAPhe in most of the avian species, but by tRNAThr and tRNAPro in some species of Picidae, Passeriformes, Falconiformes, and Cuculidae (Bensch & Ha¨rlid, 2000; Mindell et al., 1998). The mitochondrial DNA control region of animal is divided into three domains: the tRNAGlu -adjacent domain I, the central conserved domain II, the tRNAPhe -adjacent domain III (Randi & Lucchini, 1998). The three domains of the control region evolve at high different rates (Randi & Lucchini, 1998). Most of the variability within the control region is concentrated in the domains I and III (Baker & Marshall, 1997). Randi & Lucchini (1998) described the comparative structural organization of the mitochondrial DNA control region in the Alectoris of Phasianidae. The structure and evolution of avian control region have been analyzed (Baker & Marshall, 1997; Quinn & Wilson, 1993; Ruokonen & Kvist, 2002). But only limited number of avian species control region have been studied. Rates and patterns of molecular evolution of Phasianidae control region are not known, with except of a few studies (Huang & Correspondence: Zuhao Huang, School of Life Sciences, Jinggangshan University, Ji’an, Jiangxi Province 343009, China. Tel: +86 7968106363. Fax: +86 7968100493. E-mail: [email protected]
History Received 17 December 2013 Revised 10 February 2014 Accepted 16 February 2014 Published online 11 March 2014
Liao, 2011; Randi & Lucchini, 1998). The avian family Phasianidae is one of the most important groups of birds. In recent years, mitochondrial complete genome of many Phasianidae species was sequenced and available in GenBank. In the present study, we examined the structure of the control region of Phasianidae species based on the complete mitochondrial genome retrieved from GenBank. The aim of this paper is to characterize the structural features and patterns of sequence evolution of the Phasianidae mitochondrial DNA control region.
Materials and methods All the sequences were fetched from the GenBank (species and accession numbers in Table 1). To ensure the entire mitochondrial DNA control region, only mitochondrial complete genome were selected. A total of 34 species from 18 genera belonging to the Phasianidae family were analyzed (Table 1). Sequences were aligned by the CLUSTAL X procedure (Thompson et al., 1997). DnaSP v5.0 (Librado & Rozas, 2009) was used to define the variable sites. Nucleotide composition was calculated using MEGA5.0 (Tamura et al., 2011). Sequence divergence among genera was calculated using the Tamura & Nei (TN93, 1993) model in MEGA 5.0. Only the genera containing at least two species were selected for calculating intrageneric values. Pairwise transition and transversion estimates and distribution of variable nucleotide positions were calculated in MEGA5.0 (Tamura et al., 2011). The relative variability of the domains was tested by calculating the proportion of the variable nucleotides in each domain and using Student’s t test for proportions to test whether they are significantly different. The boundary of domains I, II and III was defined according to Randi and Lucchini (1998). The conserved sequence boxes found were compared with the previously published Alectoris boxes (Randi & Lucchini, 1998).
2
Z. Huang & D. Ke
Mitochondrial DNA, Early Online: 1–5
Table 1. Species examined and source of sequence data in the present study.
Species
Code
Length of the control region
Accession Number
Sources
Tetraophasis obscurus Tetraophasis szechenyii Alectoris chukar Francolinus pintadeanus Perdix dauurica Coturnix chinensis Coturnix japonica Arborophila rufipectus Arborophila brunneopectus Arborophila ardens Arborophila rufogularis Arborophila gingica Bambusicola thoracica Bambusicola fytchii Ithaginis cruentus Tragopan caboti Tragopan temminckii Pucrasia macrolopha Lophophorus lhuysii Lophophorus sclateri Gallus gallus Lophura ignita Lophura nycthemera Crossoptilon crossoptilon Crossoptilon auritum Syrmaticus ellioti Syrmaticus humiae Syrmaticus reevesii Syrmaticus soemmerringi Phasianus colchicus Phasianus versicolor Chrysolophus pictus Chrysolophus amherstiae Polyplectron bicalcaratum Pavo muticus
Tob Tsz Ach Fpi Pda Cch Cja Aru Abr Aar Arr Agi Bth Bfy Icr Tca Tte Pma Lih Lsc Gga Lig Lny Ccr Cau Sel Shu Sre Sso Pco Pve Cpi Cam Pbi Pmu
1167 1168 1154 1169 1153 1150 1555 1176 1174 1178 1178 1176 1146 1174 1148 1177 1178 1154 1167 1167 1232 1147 1148 1146 1146 1153 1153 1150 1152 1144 1150 1148 1148 1170 1156
NC018034 NC020613 NC020585 EU165707 NC020588 NC004575 NC003408 NC012453 NC022684 NC022683 NC020584 FJ752425 EU165706 NC020583 NC018033 NC013619 NC020586 NC020587 NC013979 NC020589 AP003323 NC010781 NC012895 NC016679 NC015897 NC010771 NC010774 NC010770 NC010767 NC015526 NC010778 NC014576 NC020590 NC012900 NC012897
Ma & Ran, 2012, unpublished Shen et al., 2010 Shen et al., 2010 Shen et al., 2010 Shen et al., 2010 Nishibori et al., 2002 Nishibori et al., 2001 He et al., 2009 Yan et al., 2013, unpublished Yan et al., 2013, unpublished Shen et al., 2010 Shen et al., 2010 Shen et al., 2010 Shen et al., 2010 Zeng et al., 2013 Kan et al., 2010 Shen et al., 2010 Shen et al., 2010 Ma et al., 2010 Shen et al., 2010 Nishibori et al., 2005 Kato et al., 2009, unpublished Shen et al., 2010 Zhao & Zou, 2012, unpublished Li & Kan, 2011, unpublished Kato et al., 2009, unpublished Kato et al., 2009, unpublished Kato et al., 2009, unpublished Kato et al., 2009, unpublished Li et al., 2013 Kato et al., 2009, unpublished Qin & Shi, 2010, unpublished Shen et al., 2010 Shen et al., 2010 Shen et al., 2010
Genus Tetraophasis Alectoris Francolinus Perdix Coturnix Arborophila
Bambusicola
Mitochondrial DNA Downloaded from informahealthcare.com by Cornell University on 05/31/14 For personal use only.
Ithaginis Tragopan Pucrasia Lophophorus Gallus Lophura Crossoptilon Syrmaticus
Phasianus Chrysolophus Polyplectron Pavo
Results and discussion
Table 2. Average base composition (%) of Phasianidae control region.
Alignments
Region
The control region spans the region between the genes for tRNAGlu and tRNAPhe in the Phasiandiae species. The alignment of control region of Phasianidae was straightforward. The length of the control region is relatively conserved, about 1150 bp, but that of Coturnix japonica is up to 1555 bp (Table 1). According to the existing research, the length of control region in animal varied from 120 bp (Strongylocentrotus purpuratus, Valverde et al., 1994) to 4707 bp (Mantella madagascariensis, Kurabayashi et al., 2006). Large-scale variation of tandemly repeated sequences might cause the control region size variation (Rand, 1993). All the Phasiandiae species had only one control region. Most of animal species have only one control region, however some species have duplicate control regions, including thrips (Shao & Barker, 2003), ticks (Black & Roehrdanz, 1998; Campbell & Barker, 1998, 1999), sea cucumbers (Arndt & Smith, 1998), fish (Lee et al., 2001), parrots (Eberhard et al., 2001), snakes (Kumazawa et al., 1996, 1998), and birds (Mindell et al., 1998).
Domain I Domain II Domain III Whole control region
Base composition and genetic distance The average nucleotide composition of Phasianidae control region sequences was: 26.59%A, 32.75 ± 0.16%T, 14.21 ± 0.46%G, 26.75 ± 0.67%C, with a bias against G (Table 2). The amount of A+T was more than that of G+C among whole control region, especially in domain III, same as reported in other avian control region (Baker & Marshall, 1997; Ruokonen & Kvist, 2002).
T
C
A
G
A+T
29.17 33.13 34.47 32.51
28.81 30.03 21.05 26.75
29.95 16.25 36.18 26.53
12.06 20.59 8.30 14.21
59.12 49.38 70.65 59.04
The lack of guanines is evident in each domain. Thymines and adenines are most prevalent in the first domain, thymines and cytosines in the second, and a thymines and cytosines in the third (Table 2). Nucleotide frequencies were not significantly different among species, and thus the Tamura and Nei (TN93, 1993) model is an appropriate estimator of genetic distance (Randi & Lucchini, 1998). Phasianidae control region sequences were alignable with certainty within genus. Genetic distances between species ranged from 1.96% (between Chrysolophus pictus and Chrysolophus amherstiae) to 20.67% (between Perdix dauurica and Alectoris chukar), showing a wide range of divergences. The average genetic distances among the species within the genera varied from 1.96% (Chrysolophus) to 12.05% (Coturnix) (Table 3). The average genetic distances showed significantly negative correlation with ts/tv (r ¼ 0.662, p50.05). Distribution of variable sites in the control region Control region are usually considered to be the most variable parts of mtDNA (Randi & Lucchini, 1998). However, position
Phasianidae mitochondrial control region
DOI: 10.3109/19401736.2014.895987
mutability is not distributed randomly across the whole region, but affects particular hyper-variable positions and domains (Lyrholm et al., 1996; Yang, 1996). The distribution of the variation in the control region seems to be the same in all the species within genera. Nucleotide substitutions occur more frequently in peripheral domains. Average substitution rate for the three domains were 0.50: 0.19: 0.31, corresponding to relative proportions of 5:2:3, respectively. In most genera (except Coturnix) of Phasianidae, domain I is the most variable of the three domains (Figure 1), with average 50.29% variable positions. Significant difference was observed among five genera (Student’s t test for proportions: Bambusicola, t ¼ 2.21, p50.05; Lophura, t ¼ 2.70, p50.05; Crossoptilon, t ¼ 2.46, p50.05;
Mitochondrial DNA Downloaded from informahealthcare.com by Cornell University on 05/31/14 For personal use only.
Table 3. Average percentage divergence and transition/transversion ratios in pairwise comparisons of the species within each genus. Genus
N
%divergence
ts/tv
Tetraophasis Coturnix Arborophila Bambusicola Tragopan Lophophorus Lophura Crossoptilon Syrmaticus Phasianus Chrysolophus
2 2 5 2 2 2 2 2 4 2 2
4.11 12.05 4.66 6.63 4.62 5.28 6.25 3.54 8.45 2.96 1.96
4.11 0.95 1.73 2.13 9.40 2.11 2.58 5.50 1.63 4.50 10.00
N, number of species.
3
Phasianus, t ¼ 2.46, p50.05; Chrysolophus, t ¼ 2.62, p50.05). However, the distribution of the variable positions within domain I of Phasianidae was markedly non-random. The first 150 nucleotides, adjacent to the tRNAGlu, apparently evolved at unusually low rates among genera (with only 7.48% variable positions), while the second part of this domain was hypervariable (with 42.34% variable positions). Marshall & Baker (1997) believed mutational hotspots might occur in domain I, whereas more variation was expected in domain III for deeper divergences. Ruokonen & Kvist (2002) found that variation of three genera was greatest in domain III. Our results support this. Coturnix is the most divergent genus, with genetic distance 12.05% among the species pairs. In Coturnix, variation is greatest in domain III, accounting for 41.01%. Average substitution rate for the first and second parts of domain I, central domain II, and domain III were 0.08, 0.42, 0.20 and 0.30, respectively. The presence of a conserved part within domain I, which evolves slow rate than that of the conserved central block, suggests a special organization of control region of Phasianidae. Conserved sequence Previous comparisons of control region sequences have identified conserved sequence elements based on greater similarity of the sequence elements compared to that of the flanking areas (Ruokonen & Kvist, 2002). We aligned the sequences of the central conserved domain II of every species. Four conserved sequence boxes in the domain II of Phasianidae sequences were localized (Table 4) and identified as boxes F, E, D and C. These foxes were also identified by Randi & Lucchini (1998)
Figure 1. Distribution of the variable sites in the control region. The number of variable sites within genera has been plotted in 50-bp intervals.
4
Z. Huang & D. Ke
Mitochondrial DNA, Early Online: 1–5
Table 4. F-, E-, D- and C-boxes and CSB-1 sequences for the Phasianidae species. Species
F-box
Cch, Tsz, Lih, Lsc, Lig, Lny, Cpi, Cam, Ccr, Cau, Sre, Sso, Pma, Icr, Aar, Bth, Bfy, Fpi, Pmu Cja, Ach, Tob, Pco, Pve, Sel, Shu Tca, Tte Pbi, Pda Arr, Agi, Aru, Abr Gga
GTACACCTCACGAGAGATCAGCAACCCC
Mitochondrial DNA Downloaded from informahealthcare.com by Cornell University on 05/31/14 For personal use only.
Cch, Ach, Tob, Tsz, Lih, Lsc, Lig, Lny, Cpi, Cam, Pco, Pve, Ccr, Cau, Pma, Icr, Tca, Tte, Pbi, Arr, Agi, Aru, Abr, Aar, Pmu, Pda, Cja Sel, Shu, Sso Sre, Bth, Bfy Gga, Fpi. Cch, Cja, Ach, Tob, Tsz, Bth, Bfy, Gga, Fpi, Pmu Lih, Lsc, Lny, Cpi, Cam, Pco, Pve, Ccr, Cau, Sel, Shu, Sre, Sso, Pma, Icr, Tca, Tte, Pbi, Pda Lig Aar, Agi, Aru, Abr, Aar Cch, Ach, Tob, Tsz, Lih, Lsc, Lig, Lny, Cpi, Cam, Pco, Pve, Ccr, Cau, Sel, Shu, Sre, Sso, Pma, Icr, Tca, Tte, Pbi, Arr, Agi, Aru, Abr Aar, Gga, Fpi, Pmu, Pda Cja Bth Bfy Cch Cja, Ach, Cpi, Cam, Tte Tob, Tsz, Lih, Lsc, Lig, Lny, Pco, Pve, Ccr, Cau, Sel, Shu, Sre, Pma, Icr, Pbi, Arr, Agi, Aru, Bth, Bfy, Gga, Pmu, Pda Sso Aar Tca Abr Fpi
. . . . . . . . . . . . . . . . . . . .C. . . . . . . . . . . . . . . . . . . . . . . .C. . . . . . . . . . .G. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .T. .T . .C. . . . . . . . . . . . . . . . . . . . . . . . . E-box ATGACTAGCTTCAGGCCCAT G. . . . . . . . . . . . . . . . . . . G. . . .C. .TC. . . . . . . . . . . . . . . . . .TC. . . . . . . . . . . . . . .C. .TC. . . . . . . . . . D-box CCTCTGGTTCCTCGGTCAGGCACAT . . . . . . . . . . . . . . . . . . . .A. . . . . . . . . . . .G. . . . . . . . . . .A. . . . . . . . . . . . . . . . . . . . . . . .GC. . . C-box CTCACTTTTCACGAAGTCATCTGTG . .T. . . . . .T. . . . . . . . . . . . . . . . . . . . . . .CA. . . .G.C. . . . . . . . . . . . .AC.CA. . . .G.C. . . . . . . . CSB-1 TATATGGTGAATGCTTGTCGGACATA . . . . .A.G. . . . . . . . .C. . . . . . . . . . . . .A. . . . . . . . . . . . . . . . . . . . . . .T.A. . . . . . . . . . . . . . . . . . . . . . .T.A. . . . . . . . .C. . . . . . . . . . . . .T.A. . . . . . . . . . . . . . .G. . . . . . .G.A. . . . . . . . . . . . . . . . . . . . . . .T. . . . . . . . . . . . . . . . . . . . . . . . .T.A. . . . . . . . . . .C. . . . . . . .
For F-, E-, D- and C-boxes and CSB-1 the corresponding sequences from Alectoris (Randi & Lucchini, 1998) is shown. The species codes were shown in Table 1.
in Alectoris sequences. We did not find high similarity in the B-box that Ruokonen & Kvist (2002) identified in some avian sequences. Recently, six central conserved sequence boxes (F to A) were detected in fishes (Gao et al., 2013; Zhang et al., 2011). In F-box, 22 of 28 nucleotide positions were fully conserved among the Phasianidae sequences; and in C-box, 18 of 25 nucleotide positions were fixed. While, there were four nucleotide positions were variable in E-box and D-box (Table 4). Domain III was always defined to begin with the conserved sequence blocks 1 (CSB-1) (Walberg & Clayton, 1981). The alignment of the Phasianidae CSB-1 sequences showed considerable sequence variation (Table 4). Six nucleotide positions were variable. These variable positions were detected both interspecific species and intergeneric species. However, CSB-2 and 3 were not found in the Phasianidae, as shown for fishes (Xu et al., 2011; Zhang et al., 2011, 2013), avian (Baker & Marshall, 1997), and mammalian species (Walberg & Clayton, 1981).
Declaration of interest The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper. This work was supported by the National Natural Science Foundation of China (30960051, 31260088), Jiangxi Province Talent Project 555, Jiangxi Province Major Disciplines Academic Leaders, and the Natural Science Foundation of Jiangxi Province (20132BAB204022).
References Arndt A, Smith MJ. (1998). Mitochondrial gene rearrangement in the sea cucumber genus Cucumaria. Mol Biol Evol 15:1009–16. Baker AJ, Marshall HD. (1997). Mitochondrial control region sequences as tools for understanding evolution. In: Mindell DP, editor. Avian molecular evolution and systematics. San Diego: Academic Press. p 51–82. Bensch S, Ha¨rlid A. (2000). Mitochondrial genomic rearrangements in songbirds. Mol Biol Evol 17:107–13. Black WC, Roehrdanz RL. (1998). Mitochondrial gene order is not conserved in arthropods: Prostriate and metastriate tick mitochondrial genomes. Mol Biol Evol 15:1772–85. Campbell NJH, Barker SC. (1998). An unprecedented major rearrangement in an arthropod mitochondrial genome. Mol Biol Evol 15: 1786–7. Campbell NJH, Barker SC. (1999). The novel mitochondrial gene arrangement of the cattle tick, Boophilus microplus: Fivefold tandem repetition of a coding region. Mol Biol Evol 16: 732–40. Eberhard JR, Wright TF, Bermingham E. (2001). Duplication and concerted evolution of the mitochondrial control region in the parrot genus Amazona. Mol Biol Evol 18:1330–42. Gao TX, Li N, Zhang YP, Shi P. (2013). The complete mitochondrial genome of Japanese sandeel Ammodytes personatus (Perciformes, Ammodytidae): Rare structure in control region compared. Mitochondrial DNA 24:320–2. He L, Dai B, Zeng B, Zhang X, Chen B, Yue B, Li J. (2009). The complete mitochondrial genome of the Sichuan Hill Partridge (Arborophila rufipectus) and a phylogenetic analysis with related species. Gene 435:23–8.
Mitochondrial DNA Downloaded from informahealthcare.com by Cornell University on 05/31/14 For personal use only.
DOI: 10.3109/19401736.2014.895987
Huang ZH, Liao XJ. (2011). Structure of the mitochondrial DNA control region and genetic variation of Chrylosophus pictus. Life Sci Res 15: 223–8. Huang ZH, Liu NF, Xiao YA, Chen YL, Mei WF, Wen LY, Zhang LX, Yu XP. (2009). Phylogenetic relationships of four endemic genera of the Phasianidae in China based on mitochondrial DNA control region genes. Mol Phylogenet Evol 52:378–83. Kan XZ, Li XF, Lei ZP, Wang M, Chen L, Gao H, Yang ZY. (2010). Complete mitochondrial genome of Cabot’s tragopan, Tragopan caboti (Galliformes: Phasianidae). Genet Mol Res 9:1204–16. Kumazawa Y, Ota H, Nishida M, Ozawa T. (1996). Gene rearrangements in snake mitochondrial genomes: Highly concerted evolution of control-region-like sequences duplicated and inserted into a tRNA gene cluster. Mol Biol Evol 13:1242–54. Kumazawa Y, Ota H, Nishida M, Ozawa T. (1998). The complete nucleotide sequence of a snake (Dinodon Semicarinatus) mitochondrial genome with two identical control regions. Genetics 150:313–29. Kurabayashi A, Usuki C, Mikami N, Fujiii T, Yonekawa H, Sumida M, Hasegawa M. (2006). Complete nucleotide sequence of the mitochondrial genome of a Malagasy poison frog Mantella madagascariensis: Evolutionary implications on mitochondrial genomes of higher anuran groups. Mol Phylogenet Evol 39:223–36. Lee JS, Miya M, Lee YS, Kim CG, Park EH, Aoki Y, Nishida M. (2001). The complete DNA sequence of the mitochondrial genome of the selffertilizing fish Rivulus marmoratus (Cyprinodontiformes, Rivulidae) and the first description of duplication of a control region in fish. Gene 280:1–7. Li X, Ren Q, Kan X, Qian C, Li X, Qian M. (2013). Complete mitochondrial genome of the ring-necked pheasant, Phasianus colchicus (Galliformes: Phasianidae). Mitochondrial DNA 24:89–90. Librado P, Rozas J. (2009). DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25:1451–2. Lyrholm T, Leimar O, Gyllensten U. (1996). Low diversity and biased substitution patterns in the mitochondrial DNA control region of sperm whales: Implications for the estimates of time since common ancestry. Mol Biol Evol 13:1318–26. Ma LL, Zhang XY, Yue BS, Ran JH. (2010). Complete mitochondrial genome of the Chinese Monal pheasant Lophophorus lhuysii, with phylogenetic implication in Phasianidae. Mitochondrial DNA 21:5–7. Marshall HD, Baker AJ. (1997). Structural conservation and variation in the mitochondrial control region of fringilline finches (Fringilla spp.) and the greenfinch (Carduelis chloris). Mol Biol Evol 14:173–84. Mindell DP, Sorenson MD, Dimcheff DE. (1998). Multiple independent origins of mitochondrial gene order in birds. Proc Natl Acad Sci USA 95:10693–7. Nishibori M, Hayashi T, Tsudzuki M, Yamamoto Y, Yasue H. (2001). Complete sequence of the Japanese quail (Coturnix japonica) mitochondrial genome and its genetic relationship with related species. Anim Genet 32:380–5. Nishibori M, Shimogiri T, Hayashi T, Yasue H. (2005). Molecular evidence for hybridization of species in the genus Gallus except for Gallus varius. Anim Genet 36:367–75. Nishibori M, Tsudzuki M, Hayashi T, Yamamoto Y, Yasue H. (2002). Complete nucleotide sequence of the Coturnix chinensis (blue-breasted quail) mitochondrial genome and a phylogenetic analysis with related species. J Hered 93:439–44. Quinn TW, Wilson AC. (1993). Sequence evolution in and around the mitochondrial control region in birds. J Mol Evol 37:417–25.
Phasianidae mitochondrial control region
5
Rand DM. (1993). Endotherms, ectotherms, and mitochondrial genome size variation. J Mol Evol 37:281–95. Randi E, Lucchini V. (1998). Organization and evolution of the mitochondrial DNA control region in the avian genus Alectoris. J Mol Evol 47:449–62. Ruokonen M, Kvist L. (2002). Structure and evolution of the avian mitochondrial control region. Mol Phylogenet Evol 23:422–32. Shao R, Barker SC. (2003). The highly rearranged mitochondrial genome of the plague thrips, Thrips imaginis (Insecta: Thysanoptera): Convergence of two novel gene boundaries and an extraordinary arrangement of rRNA genes. Mol Biol Evol 20:362–70. Shen YY, Liang L, Sun YB, Yue BS, Yang XJ, Murphy RW, Zhang YP. (2010). A mitogenomic perspective on the ancient, rapid radiation in the Galliformes with an emphasis on the Phasianidae. BMC Evol Biol 10:132. Tamura K, Nei M. (1993). Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol 10:512–26. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. (2011). MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Mol Biol Evol 28:2731–9. Thompson JD, Gibson TJ, Plewniak F. (1997). The Clustal X windows interface flexible strategies for multiple sequence alignment aided by quality analysis tool. Nucleic Acid Res 24:4876–82. Valverde JR, Marco R, Garesse R. (1994). A conserved heptamer motif for ribosomal RNA transcription termination in animal mitochondria. Proc Natl Acad Sci USA 91:5368–71. Walberg MW, Clayton DA. (1981). Sequence and properties of the human KB cell and mouse L cell D-loop regions of mitochondrial DNA. Nucleic Acids Res 9:5411–21. Xiao YS, Song N, Li J, Xiao ZZ, Gao TX. (2013). Significant population genetic structure detected in the small yellow croaker Larimichthys polyactis inferred from mitochondrial control region. Mitochondrial DNA 24:1–11. Xu TJ, Cheng YZ, Sun YN, Shi G, Wang RX. (2011). The complete mitochondrial genome of bighead croaker, Collichthys niveatus (Perciformes, Sciaenidae): Structure of control region and phylogeneic considerations. Mol Biol Rep 38:4673–85. Yang Z. (1996). Among-site rate variation and its impact on phylogenetic analyses. Trends Ecol Evol 11:367–72. Zeng T, Tu F, Ma L, Yan C, Yang N, Zhang X, Yue B, Ran J. (2013). Complete mitochondrial genome of blood pheasant (Ithaginis cruentus). Mitochondrial DNA 24:484–6. Zhang H, Zhang Y, Zhang XM, Song N, Gao TX. (2013). Special structure of mitochondrial DNA control region and phylogenetic relationship among individuals of the black rockfish, Sebastes schlegelii. Mitochondrial DNA 24:151–7. Zhang Y, Zhang H, Gao TX, Miao ZQ. (2011). Structure of mitochondrial DNA control region and molcular phylogenetic relationship among three flounders of genus Pleuronectes. Bioch Syst Ecol 39:627–34. Zhong LQ, Song C, Wang MH, Chen YM, Qin Q, Pan JL, Chen XH. (2013). Genetic diversity and population structure of yellow catfish Pelteobagrus fulvidraco from five lakes in the middle and lower reaches of the Yangtze River, China, based on mitochondrial DNA control region. Mitochondrial DNA 24:552–8.
