Food Chemistry 129 (2011) 1080–1087

Contents lists available at ScienceDirect

Food Chemistry journal homepage: www.elsevier.com/locate/foodchem

Sucrose enhances the accumulation of anthocyanins and glucosinolates in broccoli sprouts Rongfang Guo a, Gaofeng Yuan a, Qiaomei Wang a,b,⇑ a b

Department of Horticulture, Zhejiang University, Hangzhou 310058, China Key Laboratory of Horticultural Plant Growth, Development and Quality Improvement, Ministry of Agriculture, Hangzhou 310029, China

a r t i c l e

i n f o

Article history: Received 4 February 2011 Received in revised form 23 March 2011 Accepted 18 May 2011 Available online 26 May 2011 Keywords: Anthocyanins Sucrose Sprouts Brassica oleracea var. italica Glucosinolates

a b s t r a c t The germination rate, fresh weight, as well as the contents of anthocyanins and glucosinolates in broccoli sprouts treated with different kinds of sugars, including sucrose, glucose, fructose, mannitol, and fructose/glucose (1:1), were investigated. The results showed that all the sugars induced the accumulation of anthocyanins and glucosinolates with sucrose being the most effective one. In accordance with the accumulation of anthocyanins and glucosinolates, the antioxidant level increased while treated with sucrose. The effect of sucrose on expression of genes related to anthocyanin and glucosinolate biosynthesis were also investigated. The genes involved in the biosynthesis and transcriptional regulation of anthocyanin as well as glucosinolate biosynthetic gene Bo-Elong were all up-regulated by sucrose within 12 h after the sucrose treatment. The application of sucrose improved the nutrition value of broccoli sprouts by enhancing the biosynthesis of anthocyanin and glucosinolate at the level of transcription. Ó 2011 Elsevier Ltd. All rights reserved.

1. Introduction Broccoli (Brassica oleracea var. italica) sprouts are a rich source of glucosinolates, especially 4-methylsulphinylbutyl glucosinolate. In addition to glucosinolates, anthocyanins are a group of healthpromoting secondary metabolites in broccoli sprouts. Their presence can be easily neglected because the anthocyanin levels usually decrease as broccoli sprouts grow. However, the purple stem of broccoli sprouts indicates the presence of anthocyanins. Anthocyanins are water-soluble pigments which are widely distributed in higher plants. They, as secondary metabolites, are not only a colour-maker, conferring blue, purple, red and orange colours, but also protect plants against various biotic and abiotic stresses (Harborne & Williams, 2000). Glucosinolates are also secondary metabolites containing nitrogen and sulphur element. They are relevant to the plant interaction with pathogens and insect herbivores (Barth & Jander, 2006). From a human perspective, glucosinolates metabolites influence human health and the potential utility of plants (Yan & Chen, 2007). It has been proven that the degradation products of glucoraphanin contribute to the prevention of carcinogenic and prostate cancers (Keck & Finley, 2004). The beneficial health roles of anthocyanins and glucosinolates have also been most frequently associated with their high antioxidant ⇑ Corresponding author at: Department of Horticulture, Zhejiang University, 388 Yuhangtang Road, Hangzhou 310058, Zhejiang, China. Tel.: +86 571 8590 9333; fax: +86 571 8742 0554. E-mail address: [email protected] (Q. Wang). 0308-8146/$ - see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.foodchem.2011.05.078

activity (Steyn, Wand, Holcroft, & Jacobs, 2002; Williamson, Faulkner, & Plumb, 1998). Therefore, a complete understanding of the regulation of anthocyanin and glucosinolate biosynthesis is important to develop anthocyanin–glucosinolate-rich foods to meet the increasing demand for health-promoting components in our diet. The main pathway and relevant structural genes, as well as several transcription factors involved in anthocyanins biosynthesis and regulation, have been identified (Broun, 2005). The enhancement of anthocyanins accumulation in plants is closely related to the increased expression of all or some of the structural genes. R2R3 MYB and bHLH (basic helix-loop-helix) transcription factors represent the two major families of anthocyanins regulatory proteins (Yuan, Chiu, & Li, 2009), and they respond differently in regulating the expression of anthocyanins biosynthetic genes in different species, such as Arabidopsis thaliana (Gonzalez, Zhao, Leavitt, & Lloyd, 2008) and maize (Zea mays L.) (Grotewold, Drummond, Bowen, & Peterson, 1994). As for glucosinolates, the composition and content in plants are determined partly by genetic fluctuations (Yan & Chen, 2007). Although the main pathway and genes involved in glucosinolate have been characterised in A. thaliana, less work has been carried out in Brassicas crops (Gao, Li, Yang, McCombie, & Quiros, 2004). In addition, environmental conditions could affect the profiles of secondary metabolites. Growth conditions, such as sulphate supply (Pérez-Balibrea, Moreno, & García-Viguera, 2010) and light conditions (Pérez-Balibrea, Moreno, & García-Viguera, 2008) have been reported to exert a significant influence on glucosinolate content.

1081

R. Guo et al. / Food Chemistry 129 (2011) 1080–1087

Anthocyanins were reported to be regulated by light (Cominelli et al., 2007), stress (Lea, Slimestad, Smedvig, & Lillo, 2007) and sugar (Hara, Oki, Hoshino, & Kuboi, 2004). Sugars act as primary messengers in signal transduction processes that regulate many important processes in all phases of the plant life cycle (Rolland, Moore, & Sheen, 2002). In sucrose-specific pathways, the effect of sucrose can be substituted by the sucrose breakdown products glucose and fructose, or by other sugars (Nishikawa et al., 2005). Moreover, it has been previously reported that sugars enhanced the accumulation of anthocyanins in several plant species. Anthocyanin biosynthesis was induced by sugars in radish (Raphanus sativus) hypocotyls (Hara et al., 2004). In addition, different sugars have distinct effects on the change of anthocyanins in blood orange (Citrus sinensis) juice (Cao et al., 2009). Several former surveys had reported the effects of elicitors such as fertilizer (Pérez-Balibrea et al., 2010), light (Pérez-Balibrea et al., 2008) and sugar (Guo, Yuan, & Wang, 2011) on glucosinolates in broccoli sprouts, but little information was available on the effects of different conditions on the accumulation of anthocyanins in broccoli sprouts. It will be interesting to investigate the role of sugar treatments in accumulation of healthy promotion compounds such as glucosinolates and anthocyanins in broccoli sprouts. The aim of the present study was to investigate the effect of different sugar treatments on the accumulation of anthocyanins, glucosinolates and antioxidant level in broccoli sprouts. As sucrose was most effective in enhancement of anthocyanin and glucosinolate accumulation, the induction mechanism of these two secondary metabolites by sucrose was further elucidated by investigating the effect of sucrose on expression of genes involved in biosynthesis and regulation of anthocyanin and glucosinolate. Since glucosinolate contents in broccoli sprouts are determined by the balance between synthesis and degradation, the activities of myrosinase, the hydrolysis enzyme were also analysed in our study.

were counted. The sprouts were then frozen in liquid nitrogen immediately and kept in polyethylene bags at 80 °C for analysis of anthocyanins and glucosinolates. For each treatment, three replicates were taken for analysis. 2.2. Glucosinolate assay

2. Material and methods

Glucosinolates were extracted and analysed as previously described with minor modifications (Yuan, Wang, Guo, & Wang, 2010). Samples (500 mg) were boiled in 3 ml water for 10 min. After transferring the supernatant to a new tube, the residues were washed with water (3 ml), and the combined aqueous extract was applied to a DEAE-Sephadex A-25 (30 mg) column (pyridine acetate form) (GE Healthcare, Piscataway, NJ). The column was washed three times with 20 mM pyridine acetate and twice with water. The glucosinolates were converted into their desulpho analogues by overnight treatment with 100 ll of 0.1% (1.4 units) aryl sulphatase (Sigma, St. Louis, MO, USA) added into the column, and the desulphoglucosinolates were collected by eluting with 2  0.5 ml water. HPLC analysis was performed using an HPLC system consisting of a Waters 2695 separations module and a Waters 2996 photodiode array detector (Waters Corp., Milford, MA, USA). The HPLC system was connected to a computer with Empower Pro software. A Hypersil C18 column (5 lm particle size, 4.6 mm  250 mm; Elite Analytical Instruments Co., Ltd., Dalian, China) was used with a mobile phase of acetonitrile and water at a flow rate of 1.0 ml/min. The procedure employed isocratic elution with 1.5% acetonitrile for the first 5 min; a linear gradient to 20% acetonitrile over the next 15 min followed by isocratic elution with 20% acetonitrile for the final 10 min. A 40-ll sample was injected into the column by an autosampler. Absorbance was detected at 226 nm. Sinigrin (Sigma, St. Louis, MO, USA) was used as an internal standard for HPLC analysis. Desulphoglucosinolates were identified by comparison of retention time and quantified by peak area. The glucosinolate concentration was expressed as lmol/g fresh weight (fw) of broccoli sprouts.

2.1. Plant material and cultivation conditions

2.3. Anthocyanin determination

Seeds of broccoli (B. oleracea var. italica cv. Youxiu) were ordered from Sakata Seed Corporation (Japan). The seeds were immersed in 0.07% sodium hypochlorite for 30 min, then drained and washed with distilled water until they reached neutral pH. They were then placed in distilled water and soaked overnight. The Broccoli seeds were sowed in a culture flask with agar containing 146 mM Suc (sucrose), Glu (glucose), Fru (fructose), Man (mannitol) or F/G (fructose/glucose 1:1). In the research of 2011 by Guo et al., we found that 176 mM sucrose could enhance the accumulation of glucosinolates, and the stem of broccoli sprouts exhibits a dark colour under treatment of 88 mM sucrose which is speculated as the accumulation of anthocyanins. So we chose 146 mM sucrose in the hope of an enhancement of both anthocyanins and glucosinolate accumulation in broccoli sprouts. For real time PCR analysis, the broccoli sprouts were grown in petri dishes with wet filter papers. The treatment sprouts were watered with different sugar at the same concentration respectively after 5 days, and the control sprouts were watered with distilled water. The sugar solution was not sterilized. It was added into the petri dishes with 20 ml sugar solution, and then extracted out. This was repeated three times in order to make sure the concentration of sugar solution was not diluted. At last 20 ml sugar solution was added again for treatment. All of the sprouts were grown under a 16-h light and 8-h dark photoperiod and a constant 23 °C temperature in a culture room. Finally, 7-day-old sprouts were collected for measurements. Sprout samples were rapidly and gently collected from the surface of the filter paper. At the same time the germinated broccoli seeds

Total anthocyanins were measured using a spectrophotometric differential pH method following the procedure of Yuan et al. (2009). Frozen samples (100 mg) were crushed into powder and extracted separately with 2 ml of pH 1.0 buffer containing 50 mM KCl and 150 mM HCl, as well as 2 ml of pH 4.5 buffer containing 400 mM sodium acetate and 240 mM HCl. The mixtures were centrifuged at 12,000g for 15 min at 4 °C. Supernatants were collected and diluted for direct measurement of absorbance at 510 nm. Total anthocyanin content was calculated using the following equation:

Amountðmg g1 fwÞ ¼ ðA510 at pH 1:0  A510 at pH 4:5Þ  484:8=24:825  dilution factor: The number 484.8 is the molecular mass of cyanidin-3-glucoside chloride and 24.825 is its molar absorptivity (e) at 510 nm. Each sample was analysed in triplicate and the results were expressed as the average of the three measurements. 2.4. RNA extraction and real-time PCR analysis Total RNA was isolated from broccoli sprouts three times for two biological repeats using Trizol reagent according to manufacturer’s instruction (Takara, Japan). RNA samples were reversetranscripted into cDNA. The synthesized cDNAs were diluted 10 times in H2O and their concentrations were normalised based on

1082

R. Guo et al. / Food Chemistry 129 (2011) 1080–1087

values were calculated from FeSO47H2O standard curves and expressed as mmol per 100 g fw.

the amplification of BoAct. The qRT-PCR was performed with a total volume of 25 ll which contained 1 ll of diluted cDNA, 0.5 ll of ROX reference dye, 1 ll of each 5 lM forward primer and reverse primer, 9 ll ddH2O and 12.5 ll SYBR Green PCR Master Mix (Takara) on an iCycler (Bio-Rad Inc.). PCR amplification was performed using three-step cycling conditions of 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, and 58 °C for 1 min. Primers used are listed in Table 1 (Yuan et al., 2009). The primers designed for Bo-Elong were exon 3 (50 -AAGCGATCAAAGCGGGTG-30 ) and exon 4 (50 -CTTCAAGCGGTGCATTCC-30 ), cloned by Li and Quiros (2002).

2.7. Statistical analyses Statistical analysis was performed using the SPSS package program version 11.5 (SPSS Inc., Chicago, IL, USA). Data was analysed by one-way ANOVA, followed by Tukey’s HSD multiple comparison test. The values are reported as means with their standard error for all results. Differences were considered significant at p < 0.05. 3. Results

2.5. Determination of myrosinase activity

3.1. Effect of sugars on the germination rate and fresh weight of broccoli sprouts

Myrosinase activity was determined as described previously by Yuan et al. (2010). Broccoli sprouts (0.3 g) were homogenised with 1.8 ml of 50 mM MES buffer (pH 6.0) in an ice bath, incubated at room temperature for 5 min, and centrifuged at 10,000g and 4 °C for 10 min. The supernatants were collected and used for measurements. The assays were conducted with 1 mM sinigrin and 20 ll of supernatants in a total volume of 100 ll. After incubation at 37 °C for 15 min, the reaction was stopped by boiling (100 °C for 5 min). The amount of glucose formed by myrosinase was measured using a Glucose GOD/PAP Kit (Shanghai Rongsheng Biotech Inc., Shanghai, China). The myrosinase activity was expressed as nmol glucose formed per minute and mg total protein.

The application of sugars had little effect on the germination of broccoli seeds except glucose and F/G (Fig. 1a). However, all the sugar treatments except sucrose decreased the fresh weight of broccoli sprouts, and the treatment of mannitol led to the most serious fresh weight reduction in broccoli sprouts (Fig. 1b). 3.2. Effect of sugars on anthocyanin accumulation in broccoli sprouts A significant increase in the level of anthocyanin was observed in all sugar treatment in broccoli sprouts compared with the control. Of all the sugars tested, sucrose and fructose treatments produced the highest level of anthocyanin, followed by glucose, mannitol and fructose/glucose treatment (Fig. 2).

2.6. Ferric Reducing Ability Power (FRAP) value determination

3.3. Effect of sugars on glucosinolates in broccoli sprouts

FRAP assay was determined according to the method of Benzie and Strain (1996). The working FRAP reagent was prepared daily by mixing 300 mM acetate buffer (pH 3.6), 20 mM ferric chloride, and 10 mM 2,4,6-tripyridyl-S-triazine in 40 mM HCl in the ratio of 10:1:1 (v/v/v). The extracted samples (20 ll) were added to 2.8 ml of the FRAP working solution incubated at 37 °C and vortexed. The absorbance was then recorded at 593 nm using a UV– Vis spectrophotometer (UV-2500, Shimadzu Corp., Kyoto, Japan) after the mixture had been incubated in at 37 °C for 10 min. FRAP

The total glucosinolate content as well as the individual glucosinolate content was quantitatively determined in broccoli sprouts (Table 2). Seven glucosinolates including three aliphatic glucosinolates and four indole glucosinolates were detected in broccoli sprouts in our study (Table 1). 4-Methylsulphinylbutyl GS (glucoraphanin) was the most predominant glucosinolate in broccoli sprouts, accounting for 51.4% of the total glucosinolate content.

Table 1 Oligonucleotide primers used for qRT-PCR analysis.a Genes

Forward primer (50 –30 , top), reverse primer (50 –30 , bottom)

PCR size (bp)

Accession

Arabidopsis blastN AGI

Expect valuea

BoACTIN

CTGTGACAATGGTACCGGAATG ACAGCCCTGGGAGCATCA CAGAGCAACACAACCAAGACGTGAA TCTCCTCCAAGTGTCGTAGATCGATG GCGCATGTGCGACAAGTCGAC CCTGTCGAGCGTCGAGAGAAGGA TCAAGTTGATTCCGTTACTTTTCCA ATGACGGTGAAGATCACAAACTTTC GTCATCTTCAGGGAGAGTCTGTTCA TCGCTGTACTCCTCCGTCACTT TTCCGTACCTTCAGGCGGTTATCAA CTTTGGGGATATGATAGCCGTTGATC GCTCTCTCCTATCACTCGTAACGA GTCGCATCGTGAGAGGAACAAA GTGGACAGCTTGAGTGGGAAGATTAC GTACTCACTCGTAGCTTCAATGTAATCAG CTTGTAGCCATTTGGTCAA GAGACTTGCCCAAAAGGTTCGT GGAAACAGGTGGTCTTTAATTGCT AGCTCAAATTTATCATCATCTTTGTTACATGTGATTA GTCCAAACGGTTGAGAAAAGGTGCATAT CCAGCTCTTAAAGGAACTTGGTGCCATTTCCC CCAATAGTTTAGATACACACATGGACATG TCTTTGACATTCTCAACTCTCCACGATAT

62

AF044573

AtACTIN2/AT3G18780

6E17

311

BH716217

AtPAL1/AT2G37040

4E31

115

EF408921

AtCHS/AT5G13930

1E22

126

EU402417

AtCHI/AT3G55120

3E12

136

DQ288239

AtF3H/AT3G51238

8E23

PAL CHS CHI F3H 0

F3 H DFR LDOX GST BoMYB2 BoMYB3 BoTT8 a

Yuan et al. (2009).

0

116

BH675335

AtF3 H/At5g07990

1E58

128

AY228487

AtDFR/AT5G42800

9E46

116

AY228485

AtLDOX/AT4G22880

3E31

119

BH738469

AtGSTF12/AT5G17220

2E52

331

N/A

AtPAP1/At1g56650

6E34

110

N/A

AtMYB114/At1g66380

4E36

159

BH450920

AtTT8/At4g09820

2E52

R. Guo et al. / Food Chemistry 129 (2011) 1080–1087

Germination percentage (%)

120 100

a

ab b

ab

a

a

80

c

40 20

b

a a

Fresh weight (mg)

25

b

20

b

b b

15

Anthocyanins and glucosinolates were proved to have a function in maintaining the antioxidant level of plants (Steyn et al., 2002; Williamson et al., 1998). Ferric reduction power assay (FRAP) was used to evaluate the total antioxidant capacity in broccoli sprouts by FRAP value (Fig. 3). All sugar treatments increased the FRAP value and the levels of antioxidant activity in broccoli sprouts compared with the control. In accordance with the induction of highest anthocyanin and glucosinolate level by sucrose, the highest FRAP value and antioxidant activity was also observed under sucrose treatment, followed by fructose and the mannitol treatment, and fructose/glucose treatment the least. 3.5. Effect of sucrose on expression of genes related to anthocyanin biosynthesis and regulation

10 5 0 Control

Suc

Glu

Fru

Man

F/G

Fig. 1. Germination percentage (a) and fresh weight (b) of broccoli seed under different sugar treatments (Suc, Glu, Fru, Man and F/G). Each data point is the mean of three replicates per treatment and time point (mean ± standard error). Values not sharing a common letter are significantly different at p < 0.05.

a

1.6

Total Anthocyans (mg/100g fw)

in glucosinolate contents was observed in fructose/glucose and sucrose treatment, followed by fructose, mannitol and glucose treatment. All individual glucosinolates in broccoli sprouts were elevated by fructose/glucose and sucrose treatment. 3.4. Effect of sugars on FRAP value in broccoli sprouts

60

30

1083

a b 1.2

0.8

c d

0.4

d 0.0 Control

Suc

Glu

Fru

Man

F/G

Fig. 2. Total anthocyanins content of broccoli sprouts under different sugar treatments (Suc, Glu, Fru, Man and F/G). Each data point is the mean of three replicates per treatment and time point (mean ± standard error). Values not sharing a common letter are significantly different at p < 0.05.

4-Methylthiobutyl GS (glucoerucin) and 5-methylsulphinylpentyl GS (glucoalysin) were the other two aliphatic glucosinolates. Indole glucosinolates, including 4-hydroxyindol-3-ylmethyl GS (4-hrdroxyglucobrassicin), Indol-3-ylmethyl GS (glucobrassicin), 4-methoxyindol-3-ylmethyl GS (4-methoxy glucobrassicin) and 1-methoxyindol-3-ylmethyl GS (neoglucobrassicin) were also detected in broccoli sprouts, with 4-methoxyindol-3-ylmethyl GS being the most abundant one. All the sugars tested enhanced the level of total glucosinolates and glucoraphanin, the predominant glucosinolate in broccoli sprouts, compared with the control. The most significant increase

Genes encoding enzymes for anthocyanins biosynthesis had been identified in A. thaliana (Winkel-Shirley, 2001). In plants, the phenylalanine was converted into 4-coumaroyl CoA by a series of enzymes, including phenylalanine ammonialyase (PAL). Three malonyl CoAs were then added to become naringenin chalcone by the catalysis of chalcone synthase (CHS), which was isomerized immediately by its isomerases (CHI) to form naringenin. Flavonone 3-hydroxylase (F3H) and flavonoid 30 -hydroxylase (F30 H) catalysed the formation of dihydroflavonols. Dihydroflavonols reductase (DFR) acted as a reducer to produce leucoanthocyanidins, which were substrates of anthocyanidin synthase (LDOX). Finally, anthocyanins were produced under the catalysis of glutathione-S-transferase (GST) (Fig. 4a) (Sharma & Dixon, 2005; Winkel-Shirley, 2001). To investigate the regulatory control of anthocyanin biosynthesis in broccoli sprouts, the transcripts of anthocyanin structural and regulatory genes were examined in the sucrose- and mannitol-treated broccoli sprouts. The expression of anthocyanin upstream pathway gene, PAL, and anthocyanin biosynthesis genes, CHS, CHI, F3H, F3’H, DFR, LDOX and GST were shown in Fig. 4b. Sucrose and mannitol influenced the expression of anthocyanin biosynthetic genes in different manners. All the genes tested except GST in broccoli sprouts were up-regulated within 12 h after sucrose treatment and even higher transcription levels of anthocyanin biosynthetic genes including GST, were found later between 24 and 48 h, while the extensive enhancement of these genes was only observed at 48 h in mannitol-treated broccoli sprouts. Furthermore, the transcription level of PAL treated by sucrose was much higher than the one treated by mannitol for 48 h after treatment. The similar trend was also found in the transcription level of CHI, LDOX and GST in broccoli sprouts treated by sucrose and mannitol. However, the expression of F3H and F30 H was relatively higher under mannitol treatment compared with the sucrose treatment between 24 and 48 h. To test whether the regulatory genes were also involved in sucrose-regulated anthocyanin accumulation, the expression of some flavonoid regulatory orthologous genes of Arabidopsis, BoMYB2, BoTT8 and BoMYB3, was examined, which were also three transcription factors exhibiting a different expression pattern through growth stages in red cabbage ( B. oleracea var. capitata) (Gonzalez et al., 2008; Yuan et al., 2009). As shown in Fig. 5, BoMYB2, BoTT8 and BoMYB3 were all induced by sucrose, while BoMYB2 and BoTT8 were suppressed by mannitol treatment at the time point of 12 h. However, all three genes were up-regulated

1084

R. Guo et al. / Food Chemistry 129 (2011) 1080–1087

Table 2 The total and individual glucosinolate contents (lmol/g fresh weight) in broccoli sprouts under different sugar treatments. GLS

Control

Suc

Glu

Fru

Man

F/G

GRA GL GER Aliphatic GLS 4-OHIM IM 4-IM 1-IM Indole GLS Total GLS

5.66 ± 0.49d 0.06 ± 0.04c 3.79 ± 0.69b 9.51 ± 0.85d 0.10 ± 0.04d 0.11 ± 0.01c 1.12 ± 0.21a 0.18 ± 0.06b 1.51 ± 0.20d 11.02 ± 0.93c

15.09 ± 1.22ab 0.15 ± 0.05ad 8.07 ± 1.59a 23.30 ± 2.00ab 2.33 ± 0.60ab 2.32 ± 0.98a 2.07 ± 0.59a 0.54 ± 0.28a 7.26 ± 0.59ac 30.57 ± 1.96a

8.52 ± 1.73 cd 0.10 ± 0.04 cd 6.85 ± 1.26a 15.47 ± 2.15c 1.47 ± 0.60bc 1.17 ± 0.28b 2.17 ± 1.01a 0.26 ± 0.10ab 5.07 ± 1.28bc 20.54 ± 2.49b

11.92 ± 1.73bc 0.08 ± 0.03bc 9.08 ± 1.14a 21.08 ± 1.45bc 2.90 ± 0.86a 2.11 ± 0.76a 1.86 ± 0.56a 0.71 ± 0.30a 7.57 ± 1.38a 28.65 ± 1.70ab

11.21 ± 0.66c 0.13 ± 0.03abd 7.51 ± 0.72a 18.85 ± 0.78bc 1.35 ± 0.32c 0.99 ± 0.07b 1.25 ± 0.10a 0.51 ± 0.20ab 4.10 ± 0.28b 22.89 ± 0.79b

16.48 ± 1.82a 0.16 ± 0.04a 8.52 ± 1.24a 25.16 ± 2.20a 2.74 ± 0.70a 1.03 ± 0.13a 2.24 ± 1.39a 0.56 ± 0.12a 6.57 ± 1.45ac 31.72 ± 2.55a

Each piece of data is the mean of three replicates per treatment and time point (mean ± standard error). Values not sharing a common letter are significantly different at p < 0.05. GLS: glucosinolates; GRA: glucoraphanin; GER: glucoerucin; GL: glucoalysin; IM: glucobrassicin; 4-OHIM: 4-hydroxy glucobrassicin; 1IM: neoglucobrassicin; 4IM: 4-methoxy glucobrassicin.

a 16

ab

FRAP (mmolFe2+/g fw)

ab bc c

12

8

d

4

0 Control

Suc

Glu

Fru

Man

F/G

Fig. 3. Ferric reducing antioxidant power (FRAP) value of broccoli sprouts under different sugar treatments (Suc, Glu, Fru, Man and F/G). Each data point is the mean of three replicates per treatment and time point (mean ± standard error). Values not sharing a common letter are significantly different at p < 0.05.

by sucrose or mannitol 48 h after treatment, even though the enhancement caused by mannitol was less strong than that caused by sucrose. Our results indicated sucrose enhanced the anthocyanin accumulation by promoting both the anthocyanin biosynthetic and regulatory genes in broccoli sprouts. 3.6. Effect of sucrose on expression of Bo-Elong and myrosinase activity in broccoli sprouts Bo-Elong was a major gene involved in the aliphatic glucosinolate pathway of Brassica species (Li & Quiros, 2002). As shown in Fig. 6, the expression of Bo-Elong was strongly induced by sucrose after treated for 12 h and reached a peak at the time point of 48 h in broccoli sprouts. The expression of Bo-Elong was also elevated by mannitol 48 h after treatment compared with the control, although the enhancement induced by sucrose was three times stronger than that of mannitol. The activity of myrosinase in broccoli sprouts was affected by different kinds of sugars. Of all the sugars tested, fructose/glucose and glucose treatment significantly decreased the activity of myrosinase in broccoli sprouts. However, the sucrose, fructose and mannitol maintained the activity of myrosinase in broccoli sprouts (Fig. 7). 4. Discussion Sugars were reported to regulate the metabolism of ascorbic acid in broccoli ( B. oleracea L. var. italica) florets (Nishikawa

Fig. 4. (a) Biosynthesis pathway of anthocyanins in A. thaliana. Expression of the genes marked with ⁄ have been analysed in this study. PAL, phenylalanine ammonialyase; CHS, chalcone synthase; CHI, chalcone isomerases; F3H, flavonone 3-hydroxylase; F3’H, flavonoid 30 -hydroxylase; DFR, dihydroflavonol reductase; LDOX, anthocyanidin synthase; GST, glutathione-S-transferase. (b) Quantitative real-time PCR analysis of transcript levels of anthocyanin biosynthetic genes at different times in broccoli sprouts under different sugars treatments (Suc and Man). Each data point is the mean of three replicates per treatment and time point (mean ± standard error). Values not sharing a common letter are significantly different at p < 0.05.

et al., 2005) and biosynthesis of anthocyanins in A. thaliana (Teng, Keurentjes, Bentsink, Koornneef, & Smeekens, 2005). In our study, sugars including sucrose, glucose and fructose promoted the biosynthesis of glucosinolates and anthocyanins in broccoli sprouts, and sucrose was the most powerful and efficient one in inducing the accumulation of the secondary metabolites. These data were consistent with those of Teng et al. (2005) in A. thaliana. The levels of both anthocyanins and glucosinolates could be enhanced by

1085

30

r

control suc man

20

control suc man

m

3

a

15 2

10

l

s m

5

s

o a

b

1

b

b t

b

0 3 r

l r

15

control suc man

control suc man

12

m

2

s

m

9 a

6

lm

s

l

1

lm t

3

a b

b

t

b

c

0 40

0 12 control suc man

9

r

l

l

control suc man

r

30 m m

20

6 m

a

r s

3

n a

b

c

b

c

10

s

t

0

0

Relative Expression of LDOX

4

r

Relative Expression of F3H

Relative Expression of CHIR

lm

25

0 18

Relative Expression of F3'H

5

l r

r

control suc man

1.2

l

r

0.8

3.2

s

m a

l

control suc man

2.4 n s

m

m

0.4 b

t

0.8

a

c

1.6

t

a

a

Relative Expression of GST Relative Expression of DFR

Relative Expression of PAL

(b)

Relative Expression of CHS

R. Guo et al. / Food Chemistry 129 (2011) 1080–1087

0.0

0.0 0h

12h

48h

0h

12h

24h

48h

Fig. 4 (continued)

stress, e.g. nutrition deficiency (Lea et al., 2007), salt stress (Yuan et al., 2010). When the control of osmotic stress (mannitol treatment) was used to test whether the contents of anthocyanins and glucosinolates was increased by osmotic stress or not, we found that the mannitol treatment could also enhance the accumulation of anthocyanins and glucosinolates at a later time. However, the effect was not as strong as that caused by sucrose treatment. The different extents in promoting glucosinolates and anthocyanins accumulation under sucrose and mannitol treatment suggested different mechanisms exist in the enhancement of anthocyanins and glucosinolates induced by sucrose and mannitol in broccoli sprouts. The results indicated that sucrose might function as a signal in inducing the accumulation of anthocyanins and glucosinolates in broccoli sprouts. Similarly, it has been testified that sucrose acted like a signal in regulating many important processes in all phases of the plant life cycle (Rolland et al., 2002). The fact that the breakdown products of sucrose, glucose and fructose, could substitute the role of sucrose has been revealed in

the synthesis of ascorbic acid (Nishikawa et al., 2005). To test whether the role of sucrose in inducing the accumulation of secondary compounds was the same as the combination of fructose and glucose, a mixture of fructose and glucose at the ratio of 1:1 was used in our experiment. Although no significant difference in the content of total glucosinolates was observed between fructose/glucose and sucrose treatment (Table 2), different effects in fresh weight (Fig. 1) and the activity of myrosinase (Fig. 7) were found between these two treatments, indicating that sucrose and fructose/ glucose played different roles in regulating the glucosinolate– myrosinase system. Combined with the observation of less content of anthocyanins in fructose/glucose-treated sprouts (Fig. 2), it was speculated that the sucrose might function as a signal in inducing secondary metabolites in broccoli sprouts. It has been reported that the accumulation of anthocyanins in red radish (Raphanus sativus) sprouts (Hara et al., 2004) and red cabbage (B. oleracea var. capitata) (Yuan et al., 2009) was accompanied with the rise of transcription level of anthocyanin biosynthetic

1086

R. Guo et al. / Food Chemistry 129 (2011) 1080–1087

600

r control suc man

4 l s m

2 n

t b

a

Relative Expression of BoElong

Relative Expression of BoMYB2

6

300

s 150

c

b

0

a

l

m

lm

t

b

r

0h 15

control suc man

10 s

12h

24h

48h

Fig. 6. Quantitative real-time RT- PCR analysis of transcript levels of glucosinolates biosynthetic gene at different time in broccoli sprouts under different sugar treatments (Suc and Man). Each data point is the mean of three replicates per treatment and time point (mean ± standard error). Values not sharing a common letter are significantly different at p < 0.05.

l

5

t

a b

40

lm

m

a

a

0 12

30

r

control suc man

8

a

b

Myrosinase activity nmol/min/mg protein

Relative Expression of BoMYB3

control suc man

450

0

Relative Expression of BoTT8

r

a

b 20

b 10

4 l b

a

m

s

n

0

t

c

Control

Suc

Glu

Fru

Man

F/G

0 0h

12h

24h

48h

Fig. 5. Quantitative real-time PCR analysis of transcript levels of anthocyanins transcriptional genes at different times in broccoli sprouts under different sugars treatments (Suc and Man). Each data point is the mean of three replicates per treatment and time point (mean ± standard error). Values not sharing a common letter are significantly different at p < 0.05.

genes. A similar situation was observed in sucrose-treated broccoli sprouts in our current study. All the biosynthetic genes were enhanced by sucrose within 12 h after treatment in broccoli sprouts. Activation of MYB transcriptional factors has been found to induce anthocyanin accumulation in many anthocyaninsaccumulating plants, e.g. A. thaliana (Gonzalez et al., 2008) and maize ( Z. mays L.) (Grotewold et al., 1994). In broccoli sprouts, MYB factors (BoMYB2 and BoMYB3) and bHLH (BoTT8) gene were up-regulated within 12 h after treated with sucrose, but it was until 48 h that the expression of these genes were enhanced by mannitol treatment (Fig. 5). The results suggested sucrose acted as a signal rather than a stress factor in inducing the accumulation of anthocyanins in broccoli sprouts. In the sucrose-treated sprouts, both structural genes and transcriptional regulators participated in the regulation of anthocyanins. For example, BoMYB3 may play a major role in the accumulation of anthocyanins. Currently, no information is available to predict whether the anthocyanin accumulation in broccoli sprouts is under the control of single or multiple pathways.

Fig. 7. Myrosinase activity of broccoli sprouts under different sugar treatments (Suc, Glu, Fru, Man and F/G). Each data point is the mean of three replicates per treatment and time point (mean ± standard error). Values not sharing a common letter are significantly different at p < 0.05.

Future studies through genetic analysis and candidate gene approach will help clarify whether MYB factors and/or BoTT8 are responsible for the constitutive increase in anthocyanin levels in broccoli sprouts. The level of glucosinolate was considered to be a reflection of two opposite processes, i.e., induction of glucosinolate biosynthesis by inducers and hydrolysis by myrosinase (Mithen, Dekker, Verkerk, Rabot, & Johnson, 2000). Here in our study, Bo-Elong, an important gene in aliphatic glucosinolate biosynthesis (Li & Quiros, 2002), and the hydrolysis enzyme of glucosinolate, myrosinase were analysed. The results showed that Bo-Elong was significantly up-regulated (Fig. 6) and the myrosinase activity was not changed (Fig. 7) after sucrose treatment. HAG1/MYB28, a transcription factor regulating aliphatic glucosinolate biosynthesis, was previously reported to be significantly induced by glucose and the biosynthesis of glucosinolates was enhanced by glucose in A. thaliana (Gigolashvili, Yatusevich, Berger, Müller, & Flügge, 2007). It is possible that the regulation of glucosinolate by sucrose in broccoli sprout is also at the level of transcription. The increased contents of anthocyanins and glucosinolates induced by sucrose contributed to the higher

R. Guo et al. / Food Chemistry 129 (2011) 1080–1087

antioxidant ability of broccoli sprouts, which is indicated by the value of FRAP. This is consistent with the former surveys on antioxidant ability of anthocyanins and glucosinolates (Steyn et al., 2002; Williamson et al., 1998). In conclusion, all the sugars tested could induce the accumulation of glucosinolates and anthocyanins, and sucrose was the most effective one. In accordance with the accumulation of anthocyanins and glucosinolates, the antioxidant level increased after sucrose treatment. The accumulation of anthocyanin induced by sucrose is due to the up-regulation of the structural genes (CHI, LDOX, GST, F3H, and F30 H) and regulatory genes (BoMYB2, BoMYB3, and Bo-TT) involved in biosynthesis and regulation of anthocyanin. Bo-Elong, the major gene involved in aliphatic glucosinolate biosynthesis was also up-regulated by sucrose. Sucrose may act as a signal in inducing the accumulation of anthocyanins and glucosinolates in broccoli sprouts. Acknowledgements We are thankful to the 985-Institute of Agrobiology and Environmental Sciences of Zhejiang University for providing convenience in using the experimental equipments. We also thank Dr. Sixue Chen (University of Florida, Gainesville) for critical reading of the manuscript. This work was supported by National High-tech R&D Program of China (863 program 2008AA10Z111), China Postdoctoral Science Foundation funded project, National Natural Science Foundation of China (30320974) and Fok Ying Tong Education Foundation (104034). References Barth, C., & Jander, G. (2006). Arabidopsis myrosinases TGG1 and TGG2 have redundant function in glucosinolate breakdown and insect defense. Plant Journal, 46, 549–562. Benzie, I. F., & Strain, J. J. (1996). The ferric reducing ability of plasma (FRAP) as a measure of ‘‘antioxidant power’’: The FRAP assay. Analytical Biochemistry, 239(1), 70–76. Broun, P. (2005). Transcriptional control of flavonoid biosynthesis: A complex network of conserved regulators involved in multiple aspects of differentiation in Arabidopsis. Current Opinion in Plant Biology, 8, 272. Cao, S., Liu, L., Lu, Q., Xu, Y., Pan, S., & Wang, K. (2009). Integrated effects of ascorbic acid, flavonoids and sugars on thermal degradation of anthocyanins in blood orange juice. European Food Research Technology, 228, 975–983. Cominelli, E., Gusmaroli, G., Allegra, D., Galbiati, M., Wade, H. K., Jenkins, G. I., et al. (2007). Expression analysis of anthocyanin regulatory genes in response to different light qualities in Arabidopsis thaliana. Journal of Plant Physiology, 165, 886–894. Gao, M., Li, G., Yang, B., McCombie, W. R., & Quiros, C. F. (2004). Comparative analysis of a Brassica BAC clone containing several major aliphatic glucosinolate genes with its corresponding Arabidopsis sequence. Genome, 47, 666–679. Gigolashvili, T., Yatusevich, R., Berger, B., Müller, C., & Flügge, U. (2007). The R2R3MYB transcription factor HAG1/MYB28 is a regulator of methionine-derived

1087

glucosinolate biosynthesis in Arabidopsis thaliana. The Plant Journal, 51, 247–261. Gonzalez, A., Zhao, M., Leavitt, J. M., & Lloyd, A. M. (2008). Regulation of the anthocyanin biosynthetic pathway by the TTG1/bHLH/Myb transcriptional complex in Arabidopsis seedlings. Plant Journal, 53, 814–827. Grotewold, E., Drummond, B. J., Bowen, B., & Peterson, T. (1994). The mybhomologous P gene controls phlobaphene pigmentation in maize floral organs by directly activating a flavonoid biosynthetic gene subset. Cell, 76, 543–553. Guo, R., Yuan, G., & Wang, Q. (2011). Effect of sucrose and mannitol on the accumulation of health-promoting compounds and the activity of metabolic enzymes in broccoli sprouts. Scientia Horticulturae, 128, 159–165. Hara, M., Oki, K., Hoshino, K., & Kuboi, T. (2004). Effects of sucrose on anthocyanin production in hypocotyl of two radish (Raphanus sativus) varieties. Plant Biotechnology, 21(5), 401–405. Harborne, J. B., & Williams, C. A. (2000). Advances in flavonoid research since 1992. Phytochemistry, 55, 481–504. Keck, A. S., & Finley, J. W. (2004). Cruciferous vegetables: Cancer protective mechanisms of glucosinolate hydrolysis products and selenium. Integrative Cancer Therapies, 3, 5–12. Lea, U. S., Slimestad, R., Smedvig, P., & Lillo, C. (2007). Nitrogen deficiency enhances expression of specific MYB and bHLH transcription factors and accumulation of end products in the flavonoid pathway. Planta, 225, 1245–1253. Li, G., & Quiros, C. F. (2002). Genetic analysis, expression and molecular characterization of BoGSL-Elong, a major gene involved in the aliphatic glucosinolate pathway of Brassica species. Genetics, 162, 1937–1943. Mithen, R. F., Dekker, M., Verkerk, R., Rabot, S., & Johnson, I. T. (2000). The nutritional significance, biosynthesis and bioavailability of glucosinolates in human foods. Journal of the Science of Food and Agriculture, 80, 967–984. Nishikawa, F., Kato, M., Hyodo, H., Ikoma, Y., Sugiura, M., & Yano, M. (2005). Effect of sucrose on ascorbate level and expression of genes involved in the ascorbate biosynthesis and recycling pathway in harvested broccoli florets. Journal of Experimental Botany, 56(409), 65–72. Pérez-Balibrea, S., Moreno, D. A., & García-Viguera, C. (2008). Influence of light on health-promoting phytochemicals of broccoli sprouts. Journal of the Science of Food and Agriculture, 88(5), 904–910. Pérez-Balibrea, S., Moreno, D. A., & García-Viguera, C. (2010). Glucosinolates in broccoli sprouts (Brassica oleracea var. italica) as conditioned by sulphate supply during germination. Journal of Food Science, 75(8), 673–677. Rolland, F., Moore, B., & Sheen, J. (2002). Sugar sensing and signaling in plants. Plant Cell, 14, S185–S205. Teng, S., Keurentjes, J., Bentsink, L., Koornneef, M., & Smeekens, S. (2005). Sucrosespecific induction of anthocyanin biosynthesis in Arabidopsis requires the MYB75/PAP1 gene. Plant Physiology, 139, 1840–1852. Sharma, S. B., & Dixon, R. A. (2005). Metabolic engineering of proanthocyanidins by ectopic expression of transcription factors in Arabidopsis thaliana. The Plant Journal, 44, 62–75. Steyn, W. J., Wand, S. J. E., Holcroft, D. M., & Jacobs, G. (2002). Anthocyanins in vegetative tissues: A proposed unified function in photoprotection. New Phytologist, 155, 349–361. Williamson, G., Faulkner, K., & Plumb, G. W. (1998). Glucosinolates and phenolics as antioxidants from plant foods. European Journal of Cancer Prevention, 7, 17–21. Winkel-Shirley, B. (2001). Flavonoid biosynthesis. A colourful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiology, 126, 485–493. Yan, X. F., & Chen, S. X. (2007). Regulation of plant glucosinolate metabolism. Planta, 226, 1343–1352. Yuan, G. F., Wang, X. P., Guo, R. F., & Wang, Q. M. (2010). Effect of salt stress on phenolic compounds, glucosinolates, myrosinase and antioxidant activity in radish sprouts. Food Chemistry, 121, 1014–1019. Yuan, Y. X., Chiu, L. W., & Li, L. (2009). Transcriptional regulation of anthocyanin biosynthesis in red cabbage. Planta, 230, 1141–1153.