World J Microbiol Biotechnol DOI 10.1007/s11274-014-1676-2

ORIGINAL PAPER

Sulfone derivatives reduce growth, adhesion and aspartic protease SAP2 gene expression Małgorzata Bondaryk • Zbigniew Ochal Monika Staniszewska

•

Received: 28 February 2014 / Accepted: 21 May 2014 Ó Springer Science+Business Media Dordrecht 2014

Abstract Fungal virulence factors represent a strategy for the design of new compounds with effective activities against Candida spp. Dichloromethyl-4-chloro-3-nitrophenylsulfone (named Compound 1) and chlorodibromomethyl-4-hydrazino-3-nitrophenylsulfone (Compound 2) versus Candida albicans virulence factors (SAP2 expression and adhesion to Caco-2 cell line) were investigated. Candida albicans SC5314 and its mutants: Dsap9, Dsap10, Dsap9/10 were used. MICs of the Compounds (concentrated at 0.0313–16 lg/ml) were determined using M27-A3. Percentage of cell inhibition was assessed spectrophotometrically (OD405) after 48 h at 35 °C. The SAP2 expression was analyzed with the use of RT-PCR; relative quantification was normalized against ACT1 in cells grown in YEPD and on Caco-2. Adherence assay of C. albicans to Caco-2 was performed in a 24-well-plate. Compound 1 showed higher activity (% = 100 at 4 lg/ml) than Compound 2 (MIC90 = 16 lg/ml). Dichloromethyl at the para position of the phenyl ring exerted anti-Candidal potential. Under Compound 1, SAP2 was down-regulated in all the strains (P B 0.05). Conversely, SAP2 was over-expressed in Dsap9-10 (untreated cells) compared with the wild-type. The Compounds significantly affected adherence to epithelium (P B 0.05). The tested sulfones interfered with the adhesion of C. albicans cells to the epithelial tissues without affecting their viability after 90-min of incubation. M. Bondaryk  M. Staniszewska (&) Independent Laboratory of Streptomyces and Fungi Imperfecti, National Institute of Public Health, National Institute of Hygiene, Chocimska 24, 00-791 Warsaw, Poland e-mail: [email protected] Z. Ochal Faculty of Chemistry, Warsaw University of Technology, Noakowskiego 3, 00-664 Warsaw, Poland

The Compounds’ mode of action was attributed to the reduced adhesiveness and the lower SAP2 expression. Saps9-10 play a role in C. albicans adhesion and they can be involved in the sulfone resistance mechanisms. Keywords Candida albicans  SAP2  Adhesion  Sulfone derivatives  Virulence

Introduction The expanding population with immunocompromise has been a decisive factor for the emergence of fungi as a major etiological factor of opportunistic human infections (Pfaller and Diekema 2007). A recent epidemiology survey (Zarb et al. 2012) indicated that between 2008 and 2009, 44.5 % of the hospital-acquired infections required antifungals. Candida albicans is a leading opportunistic fungal pathogen causing infections in human, ranging from superficial mucosal lesions to disseminated or bloodstream candidiasis (Pfaller and Diekema 2007). Candida albicans infections are difficult to treat and they have been occurring with a rising frequency. The capacity of C. albicans to rapidly acquire resistance to antifungal drugs, such as amphotericin B, flucytosine, and series of azoles (Pfaller and Diekema 2007; Pappas et al. 2009), means that further studies are urgently needed to examine the effect of new compounds on the virulence factors of C. albicans. The virulence factors, such as adhesion of the fungus to host cells and hydrolytic enzyme productions (Sardi et al. 2013) have been suggested as attractive antifungal targets. Secreted aspartyl proteases (Saps) contribute to the colonization of host surfaces; enhance adhesion by degrading host surface molecules; allow penetration into deeper host tissues by digesting host cell membranes or evasion of host

123

World J Microbiol Biotechnol

defense mechanism by digesting cell and molecules of the host immune system (Hube and Naglik 2001). The aspartic protease Sap2 is the dominant secreted aspartyl protease in vitro and has been extensively studied for its properties (Hube et al. 1994). This isoenzyme degrades extracellular matrix and host surface proteins, such as keratin, collagen, vimentin, and mucin, but also several host defense proteins such as secretory IgA and salivary lactoferrin (Chaffin 2008). Sap inhibition/up-regulation assays after exposure to antifungal agents are based on the in vitro Sap2 activity (Kathwate and Karuppayil 2013; Wu et al. 2000). Since the SAP expression has been correlated with infections and with HIV-protease, inhibitors acting directly over Saps have been described (Braga-Silva et al. 2009; Cassone et al. 1999; De Bernardis et al. 1999; Korting et al. 1999; Naglik et al. 2003) and the interest in developing synthetic inhibitors of Sap and adhesion factors has increased considerably. The aspartyl protease PIs inhibitors (ritonavir, saquinavir, indinavir, nelfinavir, and amprenavir) used in HIV chemotherapy act directly over Saps1-3, also inhibiting growth and adhesion to mammalian cells (Cassone et al. 1999; Korting et al. 1999; Naglik et al. 2003; Borgvon Zepelin 1999; Braga-Silva et al. 2010). Thus the repressing of Saps represents a promising strategy for the design of anti-virulence drugs, especially in view of the alarming rise in life-threatening systemic fungal infections (Cadicamo et al. 2013). The blockage of C. albicans Saps should inactivate the pathogen, hence attenuate the infection (Braga-Silva and Santos 2011). Therefore, potent Sap inhibitors have been proposed as a novel antimycotic agents for the treatment of candidiasis (Calugi et al. 2012). As adhesion and aspartic proteases are crucial for biofilm formation, but difficult to eradicate with conventional antifungal therapy, it is fundamental to develop a new approach to managing the factors (SAP2, as well as SAP910) associated with adhesion. Rapidly growing resistance of fungal pathogens to commonly used antifungal agents (fluconazole) remains a concern for modern medicine (Zarb et al. 2012). The broad use of antimycotics has caused a directional selection among targeted pathogenic population favouring those with effective resistance mechanisms (Cannon et al. 2009), thus resulting in an increased mortality rate and requiring search for bioactive compounds with fungicidal or fungistatic activity. In this context, sulfone derivatives represent a new opportunity in a quest for novel antimicotics. The sulfone group constitutes an important core found in numerous biologically active compounds with a wide range of biological activity, including anti-tumor and antiinflammatory properties (Xu et al. 2011). Among these derivatives many aromatic compounds bearing halogenomethylsulfonyl groups exhibit herbicidal as well as fungicidal activities (Ochal and Kamin´ski 2005).

123

In the present study, the potential antifungal activity of two sulfone derivatives against the pathogenic C. albicans planktonic cells was evaluated. However, the effects of antifungal agents often go beyond the inhibition of fungal growth and the expression of virulence factors (Copping et al. 2005; Hube and Naglik 2001; Watts et al. 1998). Therefore, the next goal was to assess whether sulfones alter in their activity against chosen virulence attributes of C. albicans i.e., the secreted aspartyl proteinase SAP2 gene expression and adhesion.

Materials and methods Strains and media Strains used in the study are listed in Table 1 (Gillum et al. 1984; Schild et al. 2011). All strains were stored on Microbank cryovial beads (Prolab Diagnostics, Canada) at -70 °C. Prior to the performed examination, routine culturing of the strains for growth was conducted at 30 °C for 18 h in yeast extract-peptone-dextroseYEPD agar (Sherman 2002). Potential antifungal agents In this study the antifungal activity of dichloromethyl-4-chloro3-nitrophenylsulfone (named Compound 1) and chlorodibromomethyl-4-hydrazino-3-nitrophenylsulfone (named Compound 2) was evaluated (Table 2). Compounds 1 and 2 were synthesized as described in (Ochal and Kamin´ski 2005; Ochal and Wo´jcicki 2007; Borys et al. 2012). Antifungal activity evaluation The minimum inhibitory concentration (MIC) is the lowest concentration of an antimicrobial agent that inhibits the visible growth of a microorganism. Susceptibility of C. albicans to the tested Compounds was analyzed using the standard CLSI microdilution protocol M27-A3 following CLSI recommendations (CLSI 2008). The inoculum of 1–8 9 103 yeast cells/ml density diluted in PBS was incubated in increasing concentrations of each Compound (from 0.0313 to 16 lg/ml) diluted in RPMI (Life technologies). Initially, the tested Compounds were prepared with the stock solution of the Compounds (1,600 lg/ml) dissolved in water with dimethylsulfoxide (DMSO) at 9 % (v/v). Then the fungal blastoconidial suspension and the antifungal agent (final dilution 1:100) were dispensed into 96-well microplates (Sarstedt, Germany). The plates were incubated for 48 h at 35 °C with agitation. The reading was performed after 18 and 48 h of incubation respectively. The MIC was determined spectrophotometrically (optical density OD405) with the Infinite M200 PRO

World J Microbiol Biotechnol Table 1 Candida albicans strains used in this study Strain

Parent

Relevant characteristicsa or genotype

References

SC5314

None

Prototrophic wild-type strain

Gillum et al. (1984)

Dsap9 ? pCIp10

CAI4

Dsap9::hisG/Dsap9::hisG ? pCIp10 (integration)

Schild et al. (2011)

Dsap10 ? pCIp10

CAI4

Dsap10::hisG/Dsap10::hisG ? pCIp10 (integration)

Schild et al. (2011)

Dsap9/10 ? pCIp10

CAI4

Dsap10::hisG/Dsap10::hisG Dsap9::his/Dsap9::hisG ? pCIp10 (integration)

Schild et al. (2011)

a

Apart from indicated features, all strains are identical to their parental strain

Table 2 Compounds used in current study Compound

Abbreviation

Dichloromethyl-4-chloro-3-nitrophenylsulfone

Compound 1

Ochal and Kamin´ski (2005)

Chlorodibromomethyl-4-hydrazino-3-nitrophenylsulfone

Compound 2

Borys et al. (2012)

NANOQuant microplate reader (Tecan Group Ltd., Austria) after 48 h. The end point was calculated as a 100 % reduction in OD405 as compared to the growth in the control well. Growth reduction for each Compound concentration was calculated as follows: % of inhibition: 100 - (OD405 CTW - OD405 SCW)/(OD405 GCW - OD405 SCW) (Garibotto et al. 2010). The latter standing for as follows: CTW: Compound test well containing the inoculum and the tested Compound; SCW: sterility control well containing the Compound, medium and sterile water instead of the inoculum; and GCW: growth control well containing the medium, inoculum, and the same amount of the solvent as in CTW, but Compound-free. The DMSO concentration was maintained at 0.09 % (v/v) in all the experiments, including the control ones. At this concentration, DMSO was unable to inhibit the growth of C. albicans. In order to validate our experiments, the MIC value of 1 lg/ml was obtained for amphotericin B (SigmaAldrich, USA). The amphotericin B was diluted in DMSO (1,600 lg/ml) to be subsequently used in the assay as a reference antifungal at the concentration of 1 lg/ml (100 % inhibition). The tests were performed in triplicate and repeated in three independent assays.

Formula

References

Cultivation and infection of Caco-2 cell line (ATCC HTB27, LGC, Poland) According to the supplier’s guidelines, monolayers of the colon-adenocarcinoma-derived cell line were maintained in a humidified incubator at 37 °C in 5 % CO2. For the sake of the experiment, 1.2 9 105 of Caco-2 cells/ml were seeded into 24-well-plates (Corning, USA) and cultured in the EMEM medium (10 % FCS, 1 mM pyruvic acid, without antibiotics or antifungal agents) up to 18 h. Next, after 18-h post seeding the Caco-2 monolayers were inoculated with 105 log phase yeast cells of the C. albicans wild-type and mutants. After 18 h of incubation Caco-2 was lysed by adding sterile water, in the result of which the C. albicans cells were recovered (Staniszewska et al. 2014). Pre-treatment of C. albicans cells with sulfone derivatives Yeast cells of C. albicans from an overnight culture grown on YEPD at 30 °C were suspended in PBS (of final density 105 cells/ml) and pre-incubated with the tested Compounds

123

World J Microbiol Biotechnol Table 3 Primers used in current study Gene

Forward (50 –30 )

Reverse (50 –30 )

SAP2

TCCTGATGTTAATGTTGATTGTCAAG

TGGATCATATGTCCCCTTTTGTT

ACT1

GACAATTTCTCTTTCAGCACTAGTAGTGA

GCTGGTAGAGACTTGACCAACCA

at the concentrations of 16 and 8 lg/ml for 6 and 18 h respectively. Afterwards the cells were washed with PBS and used for tissue infection and adhesion assays (Staniszewska et al. 2014). RT-PCR analysis to assess the effect of dichloromethyl4-chloro-3-nitrophenylsulfone on the SAP2 gene expression In the case of the untreated blastoconidia, RNA was isolated from the cells after 18 h growth in YEPD at 30 °C. Additionally, the cells after having been grown in the YEPD medium were washed with water and following which 200 ll of the suspension were added to 1,800 ll of the RPMI medium (the final density of 104 cfu/ml) and inoculated onto the Caco-2 monolayer. Incubation was conducted for 6 and 18 h at 37 °C until the RNA extraction. For the cells pre-treated with Compound 1, blastoconidia grown in YEPD (as above), having been washed with water, were suspended in the YEPD medium containing 16 lg/ml of Compound 1. Then, after 6 and 18 h incubation with Compound 1, the cells were washed with water and resuspended in 2,000 ll of RPMI, in order to be afterwards inoculated onto the Caco-2 monolayer for 18 h at 37 °C. The total RNA was isolated as previously described (Amberg et al. 2005) and stored at -70 °C. The first-strand cDNA synthesis was performed using the Enhanced Avian HS RT-PCR kit (Sigma-Aldrich, USA) according to the manufacturer’s instructions. One ll of the total RNA, and 1 ll of oligo (dT)23 (3.5 lM), and 1 ll of dNTP mix (500 lM each dNTP) were added to each tube to obtain 10 ll volume. Priming at 50 °C was carried out for 10 min. Subsequently, 1 ll of Enhanced Avian AMV-RT (1U/ll) and 1 ll of 109 buffer for AMV-RT were added to each tube to obtain 20 ll volume. The RT reaction was carried out at 50 °C for 50 min. The primer sets were designed based on the unique SAP2 and ACT1 sequences in the C. albicans genome as previously described (Naglik et al. 2008). ACT1 was used as a housekeeping control gene for normalization. The primer pairs are presented in Table 3. The FastStart Essential DNA Green Master (Roche, Germany) was used for detection according to the manufacturer’s instructions. The RT-PCR was performed as previously described (Naglik et al. 2008) using Light Cycler 96 (Roche, Germany). After the initial denaturation at 95 °C for 15 min, for the next 45 cycles thermal cycling

123

conditions during the experiments were subsequently: 94 °C for 15 s, followed by 1 min at 60 °C. In each run negative (water) and positive (DNA of C. albicans SC5314) controls were included. The CT values were provided from RT-PCR instrumentation and were imported into a Microsoft Excel 2010 spreadsheet. The relative quantification was calculated using the 2-DDCT method (Livak and Schmittgen 2001), where DCT = Avg. SAP2 CT - Avg. ACT1 CT; and DDCT = DCTsample-DCTcalibra-DDCT was calculated. P values of B0.05 were tor. Finally, 2 considered statistically significant. The Wilcoxon signedrank matched-pair test was performed to evaluate the statistically significant differences in the SAP2 expression in the cells grown in YEPD or during the Caco-2 invasion; as well as the differences between the compound-treated strains and the drug free controls. P values of B0.05 were considered statistically significant. Adhesion assay Adherence of C. albicans to the Caco-2 cell line (ATCC HTB-37TM) was performed as described previously (Hashash et al. 2011). Briefly, the Caco-2 cell line was cultivated in EMEM at 37 °C at 5 % (v/v) CO2. After trypsinisation with the use of 0.25 % trypsin (BiomedLublin, Lublin, Poland) the cells were incubated at 1–1.2 9 105 cells/ml for at least 16 h on a 24-well plate (Costar, Corning, NY, USA) to generate a confluent layer. Subsequently, the blastoconidia were grown overnight in the YEPD medium at 30 °C. Prior to the adhesion assay, the yeast cells from the overnight culture were pre-incubated for 90 min with the tested Compounds at two concentrations (8 and 16 lg/ml). Afterwards, the cells were washed twice with PBS and resuspended in 2,000 ll of the fresh RPMI medium. Simultaneously, the effect of sulfone derivatives on cell viability was determined. Briefly, serial 10-fold dilutions (l0-2, 10-3) of each of the cell suspensions untreated and pre-treated with the Compounds were prepared in PBS in triplicate. Then a 1,000 ll volume of 10-2 dilution was spread over the surface of each of YEPD agar plates. The plates were incubated at 30 °C for 18 h and the number of colonies of C. albicans was counted. The adherent endothelial Caco-2 cells on the 24-well plate were washed twice with PBS and then incubated with the blastoconidial suspension (pre-treated with the tested Compounds and untreated controls) for 90 min at 37 °C at 5 % (v/v) CO2 (adhesion phase). Next, the non-adherent

nt stands for not tested

Amphotericin B at the concentration of 1 lg/ml was used as a control (% inhibition = 100)

Antifungal activity

b

98.63 ± 0.15 98.82 ± 0.15

Results

a

100

100 98.48 ± 0.10

99.22 ± 0.13

cells were removed by rinsing with PBS. Then Caco-2 was lysed by adding sterile water resulting in the C. albicans cells recovery. After 18-h growth on Sabouraud dextrose agar plates at 30 °C, the number of adherent cells was determined by colony counting and compared with the control. Adherence was expressed as a percentage of the total number of the cells added. Adherence of the strains pre-treated with the antifungal agents was determined by comparison with CFU counts of the untreated control for each strain. P values of B0.05 were considered statistically significant. The Wilcoxon signed-rank matched-pair test was performed to evaluate the statistically significant influence of the tested Compounds on C. albicans adhesion.

98.57 ± 0.21

99.30 ± 0.10 99.32 ± 0.10 99.36 ± 0.15 99.48 ± 0.12 99.52 ± 0.06

99.75 ± 0.11 99.81 ± 0.15

99.68 ± 0.10

99.89 ± 0.11 100 ± 0.16

1 Dsap9/10

2

99.70 ± 0.12

99.66 ± 0.12

99.58 ± 0.10

98.99 ± 0.22

99.28 ± 0.09

100

100 98.10 ± 0.16

98.08 ± 0.14 98.13 ± 0.12

98.60 ± 0.11

98.23 ± 0.07

98.96 ± 0.10

98.47 ± 0.12

99.10 ± 0.14

98.68 ± 0.14

99.57 ± 0.18

98.78 ± 0.11

99.77 ± 0.12 99.79 ± 0.08

98.98 ± 0.14 99.13 ± 0.12

100 ± 0.05

99.91 ± 0.10

99.27 ± 0.10

99.93 ± 0.12

99.77 ± 0.07 1 Dsap10

99.71 ± 0.06 99.06 ± 0.15 100 ± 0.15 99.25 ± 0.15 1 2 Dsap9

2

100 100 nt 96.90 ± 0.14 ntb 97.10 ± 0.23 96.47 ± 0.10 96.72 ± 0.10 96.44 ± 4.06 95.90 ± 4.06 95.46 ± 2.24 94.55 ± 0.22 99.05 ± 0.22 98.28 ± 0.11 98.20 ± 0.18 97.95 ± 0.51 97.72 ± 2.11 97.17 ± 0.33

100

100 95.11 ± 0.15

94.33 ± 0.15

96.99 ± 0.03 97.10 ± 0.10

95.43 ± 0.14

97.40 ± 0.11

96.11 ± 0.15

97.99 ± 0.03

96.42 ± 0.23 98.43 ± 0.14 99.53 ± 0.14

98.68 ± 0.12

100 ± 0.04

98.97 ± 0.07

100 ± 0.09 1 SC5314

2

99.09 ± 0.11

98.88 ± 0.12

100 ± 0.20

98.10 ± 0.09

98.01 ± 0.12

1a 0.0625

0.0313 0.125 0.25 0.5 1 2 4 8 16

MICs (lg/ml) Compound

Candida albicans

Table 4 Percentage of Candida albicans cell inhibition (Mean ± SD) with dichloromethyl-4-chloro-3-nitrophenylsulfone (named Compound 1) and chlorodibromomethyl-4-hydrazino-3nitrophenylsulfone (Compound 2) after 48 h

World J Microbiol Biotechnol

At each concentration tested the % of inhibition displayed by the Compounds was determined (Table 4). Compound 1 containing dichloromethyl, at the para position of the phenyl ring attached to C-1, C-2 and C-4 chlorine, nitro, and sulfone moiety respectively was the most effective against the wildtype (wt) SC5314 strain. Compound 1 displayed 100 % of cell growth inhibition at concentrations ranging: 4–16 lg/ ml. To be precise, Compound 1 exerted 100 % of cell inhibition against Dsap9 at four-fold higher concentration (MIC = 16 lg/ml) than wt. Contrariwise, it displayed moderate activity (without clear end point) against the mutants: Dsap10 and Dsap9/10 at the maximum concentration of 16 lg/ml. Thus MIC90 = 16 lg/ml was assessed as a supra-MIC concentration (the highest concentration with incomplete killing) against the latter strains. Compound 2 in its turn with hydrazine substituent at the C-1 position of the phenyl ring attached to C-2 and C-4 of the nitro and chlorodibromomethylsulfonyl substituents exerted a greater potential against the mutants: Dsap10 and Dsap9/ 10. Thus as shown in Table 4, 100 % of cell inhibition was observed at 16 lg/ml. Compound 2 was less active against the null Dsap9 mutant, achieving MIC90 = 16 lg/ml as a supra-MIC concentration. Moreover, MIC90 = 16 lg/ml (supra-MIC) was displayed for SC5314. Compound 2 revealed decreasing activity in proportion to decreased concentration (concentration-dependent manner, Table 4). RT-PCR to detect gene expression changes in aspartic protease production in response to dichloromethyl-4chloro-3-nitrophenylsulfone Compound 1 was more effective against wt and therefore was chosen for the gene expression study. The C. albicans

123

World J Microbiol Biotechnol Table 5 SAP2 expression in C. albicans during growth on Caco-2 a,

Mean mRNA transcript level of SAP2 * Strains

conditions/time

Mean DCT

2-DCT

2-DDCT

SD**

SC5314

YEPDc

-1.12

2.17

1.00b

±0.04

d

-1.67

3.17

1.00b

±0.12

Caco-2e

-1.27

2.41

1.00b

±0.30

Caco-2 Dsap9

YEPD

c

-2.03

4.08

1.88

±0.11

Caco-2d

-2.33

5.03

1.58

±0.33

Caco-2e

-2.32

5.00

2.08

±0.21

Dsap10

YEPDc Caco-2d

-1.97 -2.07

3.93 4.18

1.81 1.32

±0.17 ±0.32

Dsap9/10

YEPDc

-2.00

4.00

1.85

±0.15

Caco-2d

-2.10

4.28

1.35

±0.08

Caco-2e

-1.92

3.78

1.57

±0.50

Expression levels were shown as a delta threshold (DCT) and values were normalized according to the 2-DDCT method * The P value B0.05: the strains: Dsap9, Dsap10 and Dsap9/10 were calibrated to SC5314 (Wilcoxon signed-rank matched-pair test) ** ± Standard Deviation (SD) a

Mean SAP2 mRNA transcript levels based on up to five biological replicates (at least three). Normalized to ACT1

b

Study Calibrator

Until RNA extraction cells were grown for: 18 h in YEPDc, 6 h on Caco-2d or 18 h on Caco-2e

Table 6 Influence of dichloromethyl-4-chloro-3-nitrophenylsulfone (Compound 1) on the SAP2 expression in C. albicans during growth on Caco-2 Mean mRNA transcript level of SAP2a, * Strains SC5314

MIC 16 lg/ ml

Dsap9 Dsap10 Dsap9/ 10

8 lg/ ml

Time (h) 6

Mean DCT

2-

2-

DCT

DDCT

-2.52

5.72

1.80

SD**

Rb

±0.63

Ic

18

-0.40

1.32

0.55

±0.46

45.00 %

6

-1.76

3.39

0.67

±1.03

57.59 %

18

-2.03

4.07

0.81

±0.26

61.06 %

6

-1.41

2.65

0.63

±0.22

47.73 %

18

-1.92

3.78

0.90

±0.03

31.82 %

6

-1.80

3.48

0.81

±0.09

48.41 %

18

0.32

0.80

0.21

±0.24

86.62 %

Expression levels were shown as a delta threshold (DCT) and values were normalized according to the 2-DDCT method * The P value B0.05: the compound-treated strains were compared to non-treated controls (Wilcoxon signed-rank matched-pair test) ** ± Standard Deviation (SD) a

Mean SAP2 mRNA transcript levels based on up to five biological replicates (at least three). Normalized to ACT1 b

R stands for SAP2 expression reduction %

c

I stands for increased SAP2 expression

123

SC5314 reference strain, and the mutants: Dsap9, Dsap10 and Dsap9/10 were tested for the SAP2 expression in the absence (Table 5) and presence (Table 6) of Compound 1 at the concentration of 16 lg/ml. The SAP2 expression was detected in YEPD as well as during the Caco-2 infection for all the strains tested. The SAP2 mRNA production in SC5314 was slightly induced during the invasion of epithelial cells in comparison to YEPD (1.1–1.46-fold) with the peak of the mRNA transcript at 6 h. However, SAP2 was over-expressed in the mutants: Dsap9, Dsap10, and Dsap9/10 in comparison with SC5314 both in YEPD (1.81–1.88-fold) and on Caco-2 (1.32–1.58-fold at 6 h and 1.57–2.08-fold at 18 h respectively), due to the compensation event. The exposure of C. albicans to Compound 1 significantly altered the SAP2 expression (P B 0.05). The 6-h incubation period of SC5314 with the tested Compound resulted in up-regulation of the SAP2 mRNA production (1.8-fold compared to the non-treated control). Contrariwise, the 6-h exposure of the Dsap mutant strains to Compound 1 down-regulated the SAP2 mRNA production (2.36-, 2.09-, and 1.67-fold in Dsap9, Dsap10 and Dsap9/ 10 respectively) in comparison with their non-treated counterparts. Moreover, 18-h incubation resulted in the SAP2 down-regulation in SC5313 (0.55-fold), Dsap9 (2.57fold), Dsap10 (1.47-fold), and in Dsap9/10 (7.47-fold lower compared with the non-treated cells).

Impact of sulfone derivatives on C. albicans adhesion properties The contribution of individual Sap izoenzymes to adhesion after C. albicans exposure to sulfone derivatives was investigated with a panel of the SAP null mutant strains: Dsap9, Dsap10, and Dsap9/10. The Compounds’ effects on fungal viability after 90-min pre-incubation were assessed quantitatively by determining the number of CFU of the remaining cells in the samples. As shown in Table 7, the presence of the Compounds during the incubations at 37 °C did not decrease the viability of the exposed cells of the each strain. The poor decreasing effect was present for Compound 1 at concentrations of 16 lg/ml (for the strain ATCC SC5314), as shown in Table 7. On the other hand, the impact of the Compounds on increasing fungal viability was observed in the remaining samples. A comparison of the untreated cells and the cells pre-treated with the Compounds using the Wilcoxon test showed no significant difference (P C 0.05). The acquired data showed that the deletion of either SAP9 or SAP10 or both genes, significantly modified the adhesion properties (P B 0.05) by increasing the percentage of adhered cells in comparison with the wild type strain (Table 8). Moreover, it was

World J Microbiol Biotechnol Table 7 Effects of the Compounds on growth and viability of the C. albicans strains after 90-min pre-incubation Strains

Control samples Mean 9106 ± SDa

Compound

Concentration (lg/ml)

CFU remaining Mean 9106 ± SDb

SC5314

42.5 ± 9.19

1

16

37.00 ± 7.07

8

43.50 ± 0.71

2

16

70.00 ± 16.70

8

55.67 ± 11.72

Dsap9

Dsap10

Dsap9/10

26.5 ± 20.51

1

51 ± 11.31

20.5 ± 0.71

16

32.33 ± 7.51

8

65.33 ± 26.58

2

16 8

44.33 ± 6.66 44.33 ± 4.73

1

16

65.33 ± 18.58

8

69.00 ± 3.61

2

16

83.67 ± 14.47

8

85.67 ± 15.82

1

16

57.00 ± 18.38

8

53.33 ± 15.04

2 a

16

35.67 ± 3.51

8

42.67 ± 8.74

Numer of untreated cells (cfu/ml)

b

Number of treated cells (cfu/ml); Data are expressed as the mean ± SD of three independent experiments; Values indicate insignificant influence of the Compounds on the cells viabilities compared to non-treated counterparts (P C 0.05)

Table 8 Adherence of Candida albicans morphologies in an in vitro model of intestinal candidiasis (monolayer of Caco-2 cell line ATCC) Strains (106 cells/ml saline)

Percentage of cell adhesion* 4.85 ± 0.045a

SC5314 Dsap9

14.30 – 0.154

Dsap10

10.11 – 0.101

Dsap9/10

10.09 – 0.163

Data are expressed as the mean ± SD of three independent experiments * Significant induction of adhesive properties (P B 0.05) in bold (compared to the wild type strain SC5314) a

Study calibrator

observed that the exposure to sulfone derivatives inhibited the adherence capacity of C. albicans (Table 9). The pre-treatment of fungal cells with Compound 1 significantly altered (P B 0.05) the adherence properties in the concentration-dependent manner. Adhesion of the wt was 10.8-fold and 5.2-fold lower at the concentrations ranging: 8–16 lg/ml respectively in comparison with the non-treated controls. In the case of the Dsap mutants the same phenomenon was noted, but the adhesion inhibition was more severe. Post-treatment adhesion of the mutants at the concentration of 16 lg/ml was reduced as follows: 79.4-fold (Dsap9), 44.0-fold (Dsap10), and 112.1-fold (Dsap9/10) in comparison with the compound-free control.

Table 9 Percentage of adhesion of Candida albicans cells to Caco-2 cell line after pre-treatment with dichloromethyl-4-chloro-3-nitrophenylsulfone (named Compound 1) and chlorodibromomethyl-4-hydrazino-3-nitrophenylsulfone (Compound 2) CCompound 1oncentration of compounds (lg/ml)

Dsap9

SC5314

Dsap10

Dsap9/10

Adherent cells

Ra

Adherent cells

R

Adherent cells

R

Adherent cells

R

16

0.45 ± 0.005

90.72

0.18 ± 0.001

98.74

0.23 ± 0.002

97.73

0.09 ± 0.001

99.11

8 Compound 2

0.93 ± 0.006

80.82

1.00 ± 0.001

93.01

1.69 ± 0.001

83.28

0.44 ± 0.005

95.64

Compound 1

16

2.16 ± 0.023

55.46

0.67 ± 0.003

95.31

0.31 ± 0.001

96.93

0.14 ± 0.001

98.61

8

0.73 ± 0.004

84.95

1.00 ± 0.001

93.01

0.10 ± 0.001

99.01

0.13 ± 0.001

98.71

Adhesion data calculated for cells grown on Sabouraud agar in 24-well-plate. Adherence was expressed as a percentage of the total number of cells added (control cells non-treated). Data are expressed as the mean ± SD of three independent experiments a

R stands for adherent cells’ reduction %; A significant reduction of adhesive properties (P B 0.05) (compared to non-treated control cells)

123

World J Microbiol Biotechnol

Whereas, at the concentration of 8 lg/ml the reduction of adhesion was observed as follows: 14.3-fold (Dsap9), 6.0fold (Dsap10), and 22.9-fold (Dsap9/10). Pre-treating the fungal cells with chlorodibromomethyl4-hydrazino-3-nitrophenylsulfone (Compound 2) significantly reduced (P B 0.05) their adherence properties. Adherence reduction in the concentration-dependent manner was observed only for Dsap9 (21.3- and 14.3-fold lower adhesion at 16 and 8 lg/ml respectively). Interestingly, in wt and the remaining mutants adhesion properties were reduced after pre-treatment with two-fold lower concentration (8 lg/ml) in comparison with 16 lg/ml and the non-treated controls. SC5314 exhibited 6.6- and 2.2fold lower adherence at 8 and 16 lg/ml relative to the nontreated control respectively. The similar trend was observed for the remaining mutants. At the concentration of 8 lg/ml, adherence reduction was 101.1- and 77.6-fold for Dsap10 and Dsap9/10 in comparison with the nontreated cells respectively. Moreover, the strains: Dsap10 and Dsap9/10 showed reduced adhesion from 32.6- to 72.1fold at 16 lg/ml relative to the non-treated counterparts.

Discussion Although the majority of the Sap enzymes are secreted by fungi, Sap9 and Sap10 are glycosylphosphatidylinositol (GPI)-anchored yapsin-like aspartic proteases that target proteins of fungal origin necessary for the cell surface integrity (Albrecht et al. 2006; Meiler et al. 2009). Both SAP9 and SAP10 play a role in C. albicans resistance to hydromycin (Albrecht et al. 2006). Thus by studying the mutants lacking those Saps we tested whether these factors could have an impact on C. albicans resistance to the tested sulfones. Our results showed that both of the tested synthetic sulfone derivatives exhibited good antifungal potential against C. albicans, with dichloromethyl-4-chloro-3-nitrophenylsulfone (Compound 1) clearly standing out in its activity against the wild-type SC5314 strain (wt). Performed tests indicated that the ability of Compounds 1 and 2 to inhibit C. albicans’ growth depends on their functional groups, in particular the presence or absence of 4-hydrazine moiety and bromine atoms. Interestingly, the loss of SAP9 contributed to altered sensitivity of Dsap9 to Compound 1, whereas the loss of SAP10 resulted in further alterations and no clear end point (100 % cell inhibition). On the other hand, Compound 2 containing hydrazine moiety at C-4 and chlorine, as well as two bromine atoms in sulfonyl moiety exhibited greater antifungal activity against the strains with SAP10 deficiency (Dsap10 and Dsap9/10), however not against wt and Dsap9. Thus Compound 2 influenced the cell wall decomposition. Moreover, the results harmonize

123

with the ones (Albrecht et al.2006) showing that Sap10 localized in the cell wall is associated with its integrity and its lack can influence the antifungal activity of sulfone derivatives. Although processing of Sap2 can occur independently of Sap9 and Sap10 (Albrecht et al. 2006), our study pointed to the compensatory SAP2 expression in the mutant strains cultured in YEPD. However, it was demonstrated that the Kex2 processing pathway is also involved in the expression of SAP2, as the production of the latter is altered in the null Dkex2 mutants (Newport and Agabian 1997). The KEX2 compensative over-expression in the strains lacking both SAP9 and/or SAP10 can therefore result in the SAP2 upregulation. In our study, the compensatory over-expression of SAP2 can occur in Dsap9, Dsap10 and Dsap9/10 during the Caco-2 invasion. Thus the latter indicates that Kex2 overlaps (or at least partially) the function of Sap9 and Sap10 (Schild et al. 2011), as the loss of one processing protease gene induces up-regulation of the other genes (Albrecht et al. 2006). Furthermore, our analysis showed a link between the SAP2 expression and C. albicans’ cells exposure to Compound 1. Compound 2 proved to be a successful Sap2 inhibitor. In general, the exposure of C. albicans cells to antimycotics represents a form of environmental stress that stimulates a mitigate response to negative effects of antifungal agents and enables further growth (Cannon et al. 2007). Previously Wu et al. (2000) noted a decreased extracellular Sap activity in the susceptible C. albicans strains after an exposure to antifungal agents and increased activity in the resistant isolates, which indicates that Sap plays a role in antifungal resistance. Therefore, in our study the increase in the SAP2 mRNA transcript level observed in wt under Compound 1 (after 6-h exposure period) can represent an induction of the stress-response network in C. albicans. Contrariwise, no observable up-regulation of SAP2 in Dsap9, Dsap9/10, and Dsap10 after exposure to Compound 1 (at each incubation period) indicated an attenuation of the stress response. However, the mutants: Dsap9, Dsap10, and Dsap9/10, used in the current study had been developed from CAI4 (Schild et al. 2011) with a technique that makes strains heterozygous for the URA3 gene. Although the URA Blaster technique is widely used in C. albicans’ manipulations, it was previously observed that the differences could be due to the effect of the ectopic URA3 insertion, but not necessarily to the distortion of the targeted genes (Correia et al. 2010). Moreover, it should be noted that the expression of URA3 at ectopic loci in genome can alter C. albicans virulence (Samaranayake and Hanes 2011) and can influence the stress response. As described Garcı´a et al. (2001), consideration must be given to the loss of virulence of CAI4 and other URA3 mutants of C. albicans. The latter authors (Garcı´a et al. 2001) showed that the CAI4 Dura3 strain lost

World J Microbiol Biotechnol

the 30 half of IRO1 gene as a consequence of the linkage of URA3 and IRO1. Although the authors (Garcı´a et al. 2001) pointed to differences in iron metabolism between CAI4 and the parental strain SC5314, these are not sufficient to assign any specific function of IRO1 (a putative transcriptional factor in iron assimilation). Hitherto, researchers have not paid attention to the sequence of the IRO1 gene, as it has not been regarded as a critical one, especially in vitro. Garcı´a et al. (2001) indicated that CAI4 demonstrates a better behaviour than the wild type strain SC5314 in extreme iron-deficient conditions. Furthermore, Chibana et al. (2005) showed that iron depletion affects the heterozygous mutant of IRO1 (with intact allele of IRO1), but has no effect on the IRO1 null mutant. According to Chibana et al. (2005) the IRO1 reverted strains were similar to SC5314 as for the virulence of strains in mice (the role of IRO1). Thus in our study we used the virulence prototrophic SC5314 which is usually tested as a control strain possessing an intact IRO1, since the gene as such was not of interest to us. Moreover, as indicated Ahmad et al. (2008), CAI4 ought to be tested for the stability of its karyotype prior to its use, however such studies were beyond the scope of this paper. In our study it is important to note that we used SC5314 isolated from patients with disseminated candidiasis (Gillum et al. 1984) as the most virulent in comparison to the strains isolated from superficial mucosal infections (Ahmad et al. 2008). This view was supported by Walker et al. (2009), its validation performed with qRT-PCR showed that no significant gene regulation was observed for any of the strain derivatives from SC5314 in an in vivo virulence studies, in contrast to their strong regulation in SC5314. Thus in our virulence study we compared the SAP expression in C. albicans mutants’ cells (treated and untreated) with SC5314, and discussed the relation between the SAP genes’ regulations and essentiality with respect to the virulence of these strains during the endothelial cell adhesion. The host cells’ adhesion represents the first step in the establishment of the C. albicans colonization and infection (Wa¨chtler et al. 2011). It is known that the expression of SAP1-SAP3, as well as SAP4-SAP6 is involved in the adherence to host cells (Albrecht et al. 2006; Hube and Naglik 2001; Wa¨chtler et al. 2011). Previously, it was demonstrated that the null mutants: Dsap1, Dsap2 and Dsap3, were less adherent to the buccal epithelial cells than the parental strain, whereas the triple Dsap456 mutant displayed a significantly increased adherence (Watts et al. 1998). On the other hand, the expression of SAP9 and SAP10 is associated with adherence, the cell wall integrity, and cell separation during budding (Albrecht et al. 2006; Samaranayake et al. 2013; Wa¨chtler et al. 2011). It was proposed that Sap9 and Sap10 indirectly contribute to adhesion by targeting the covalently linked fungal cell wall

proteins such as Cht2, Ywp1, Als2, Rhd3, Rbt5, Ecm33, Pga4, and the glucan cross-linking protein Pir1 (Schild et al. 2011). However, according to the results of Wang et al. (2012), the cell surface components and their related proteins play central roles in cell adhesion. According to latter authors (Wang et al. 2012) it is difficult to determine if these genes/proteins mediate adherence directly or indirectly due to their complex function. In our study, by using the genetic alternations in SAP9 and SAP10 we tested whether these factors could have an impact on C. albicans adhesion under the antifungal potential of sulfones. We provided a comprehensive evaluation of the Dsap9-10 mutants as the determinants of the resistance to sulfones. Previously, we demonstrated that SAP10 was the most highly expressed gene at the very early stages of the Caco2 infection and became dominant at the later stages, whereas SAP9 was induced in both early and later stages of the intestinal cell invasion indicating a role of SAP9 in gastrointestinal infections (Bondaryk and Staniszewska 2013). Albrecht et al. (2006) described that the deletion of SAP9 and SAP10 modified adhesion properties of C. albicans. The latter authors (Albrecht et al. 2006), noted that the absence of SAP9 enhanced adhesion properties, yet the deletion of SAP10 or both genes resulted in attenuated adherence. Contrariwise, the results of our study indicated that the deletion of either SAP9 or SAP10 or both genes resulted in enhanced adhesion to epithelial cells indicating an indirect role of Sap9-10 in this process (Naglik et al. 2011). However, another possible explanation is that the up-regulation of other SAP genes in the tested mutants could be partially compensated by the loss of SAP9 and SAP10. In particular, the up-regulation of SAP2 in the strains: Dsap9, Dsap10 and Dsap9/10, could contribute to an enhanced adherence of these mutants (2.08–2.95-fold higher in comparison with SC5314). It was proposed that adherence may induce in fungi a resistance mechanism against environmental stress imposed by antimicrobial agents, as the C. albicans cells were found resistant to fluconazole immediately after adhesion (Shinde et al. 2012; Watamoto et al. 2010). Moreover, the fact that the targets of existing antimycotics are mainly located on the cell surface supports this hypothesis (Wang et al. 2012). The GPI-anchored Sap9 and Sap10 are antigenic determinants involved in C. albicans virulence and are considered a potential target for novel antifungal agents (Hashash et al. 2011). Therefore the mutants: Dsap9, Dsap10, and Dsap9/10, were included in the adhesion assay. The exposure of wt to the tested Compounds resulted in a significantly inhibited adhesion (P B 0.05) to epithelial cells, whereas the deletion of either SAP9 or SAP10 or both genes caused a further reduction of adherence properties (P B 0.05). Pre-treatment of yeast cells with Compound 1 abolished the compensative SAP2

123

World J Microbiol Biotechnol

expression in the mutant strains as well as affected their adherence properties. Additionally, we measured the loss of cells’ viability following the 90-min treatment with the sulfones thereafter by plating them onto YEPD agar plate. The viable C. albicans cells were recovered after 90-min of treatment (the time pointed that was practical to measure the sulfone influence on adhesion), suggesting that the tested sulfones have no impact upon cells’ viability in the time tested. We showed that it was impossible for the high adhesion inhibition to result from the decrease in the cells’ viability (Table 7). Thus sulfones exhibited the direct action on the cell wall. To our knowledge, ours is the first study of the sulfone derivatives’ influence on virulence factors of C. albicans. Our data provide evidence that the sulfones’ mode of action is associated with a reduced pathogenic potential related to the expression of SAP2 gene and adhesion. Although Sap9-10 play an indirect role in C. albicans adhesion to the intestinal cell layers, they can be involved in anti-fungal sulfones’ resistance mechanisms. Acknowledgments The work was supported by the National Science Centre, project DEC-2011/03/D/NZ7/06198. Conflict of interest

None to declare.

References Ahmad A, Kabir MA, Kravets A, Andaluz E, Larriba G, Rutschenko E (2008) Chromosome instability and unusual features of some widely used strains of Candida albicans. Yeast 25:433–448 Albrecht A, Felk A, Pichova I, Naglik JR, Schaller M, de Groot P, MacCallum D, Odds FC, Scha¨fer W, Klis F, Monod M, Hube B (2006) Glycosylphosphatidylinositol-anchored proteases of Candida albicans target proteins necessary for both cellular processes and host-pathogen interactions. J Biol Chem 281:688–694 Amberg DC, Burke DJ, Strathern JN (2005) Yeast RNA isolations, Techniques and Protocols #6. In: Amberg DC, Burke DJ, Strathern JN (eds) Methods in yeast genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, p 127 Bondaryk M, Staniszewska M (2013) The in vitro expression of Candida albicans SAP1-10 genes in the intestinal candidiasis model. Poster presented at 31st annual meeting of the European society for pediatric infectious diseases (ESPID 2013), Milan, Italy, May 28-June 1, 2013. Abstract no. 896 Borg-von Zepelin M (1999) HIV-protease inhibitors reduce cell adherence of Candida albicans strains by inhibition of yeast secreted aspartic proteases. J Invest Dermatol 113:747–751 Borys KM, Korzyn´ski MD, Ochal Z (2012) A simple and efficient synthesis of trihalomethyl and dihalomethyl aryl sulfones. Tetrahedron Lett 53:6606–6610 Braga-Silva LA, Santos ALS (2011) Aspartic protease inhibitors as potential anti-Candida albicans drugs: impacts on fungal biology, virulence and pathogenesis. Curr Med Chem 18:2401–2419 Braga-Silva LA, MesMesquita DG, Ribeiro MD, Carvalho SM, Fracalanzza SE, Santos AL (2009) Trailing end-point phenotype antibiotic-sensitive strains of Candida albicans produce different amounts of aspartyl peptidases. Braz J Med Biol Res 42:765–770

123

Braga-Silva LA, Mogami SS, Valle RS, Silva-Neto ID, Santos AL (2010) Multiple effects of amprenavir against Candida albicans. FEMS Yeast Res 10:221–224 Cadicamo CD, Mortier J, Wolber G, Hell M, Heinrich IE, Michel D, Semlin L, Berger U, Korting HC, Ho¨ltje HD, Koksch B, Borelli C (2013) Design, synthesis, inhibition studies, and molecular modeling of pepstatin analogues addressing different secreted aspartic proteinases of Candida albicans. Biochem Pharmacol 85:881–887 Calugi C, Trabocchi A, De Bernardis F, Arancia S, Navarra P, Cauda R, Cassone A, Guarna A (2012) Bicyclic peptidomimetics targeting secreted aspartic protease 2 (SAP2) from Candida albicans reveal a constrained inhibitory chemotype. Bioorg Med Chem 20:2401–2419 Cannon RD, Lamping E, Holmes AR, Niimi K, Tanabe K, Niimi M, Monk BC (2007) Candida albicans drug resistance—another way to cope with stress. Microbiology 153:3211–3217 Cannon RD, Lamping E, Holmes AR, Niimi K, Baret PV, Keniya MV, Tanabe K, Niimi M, Goffeau A, Monk BC (2009) Effluxmediated antifungal drug resistance. Clin Microbiol Rev 22:291–321 Cassone A, De Bernardis F, Torosantucci A, Tacconelli E, Tumbarello M, Cauda R (1999) In vitro and in vivo anticandidal activity of human immunodeficiency virus protease inhibitors. J Infect Dis 180:448–453 Chaffin WL (2008) Candida albicans cell wall proteins. Microbiol Mol Biol Rev 72:495–544 Chibana H, Uno J, Cho T, Mikami Y (2005) Mutation in IRO1 tightly linked with URA3 gene reduces virulence of Candida albicans. Microbiol Immunol 49:937–939 CLSI (2008) Reference method for broth dilution antifungal susceptibility testing of yeasts; approved standard-third edition. In: Wayne PA (ed) CLSI document M27-A3. Clinical and Laboratory Standards Institute, Wayne Copping VMS, Barelle CJ, Hube B, Gow NA, Brown AJ, Odds FC (2005) Exposure of Candida albicans to antifungal agents affects expression of SAP2 and SAP9 secreted proteinase genes. J Antimicrob Chemother 55:645–654 Correia A, Lermann U, Teixeira L, Cerca F, Botelho S, da Costa RM, Sampaio P, Ga¨rtner F, Morschha¨user J, Vilanova M, Pais C (2010) Limited role of secreted aspartyl proteinases Sap1 to Sap6 in Candida albicans virulence and host immune response in murine hematogenously disseminated candidiasis. Infect Immun 78:4839–4849 De Bernardis F, Mondello F, San Mila´n R, Ponto`n J, Cassone A (1999) Biotyping virulence properties of skin isolates of Candida parapsilosis. J Clin Microbiol 37:3481–3486 Garcı´a MG, O’Connor JE, Garcı´a LL, Martı´nez SI, Herrero E, del Castillo Agudo L (2001) Isolation of a Candida albicans gene, tightly linked to URA3, coding for a putative transcription factor that suppresses a Saccharomyces cerevisiae aft1 mutation. Yeast 18:301–311 Garibotto FM, Garro AD, Masman MF, Rodrı´guez AM, Luiten PG, Raimondi M, Zacchino SA, Somlai C, Penke B, Enriz RD (2010) New small-size peptides possessing antifungal activity. Bioorg Med Chem 18:158–167 Gillum AM, Tsay EYH, Kirsch DR (1984) Isolation of the Candida albicans gene for orotidine-50 -phosphate decarboxylase by complementation of S. cerevisiae ura3 and E. coli pyrF mutations. Mol Gen Genet 198:179–182 Hashash R, Younes S, Bahnan W, El Koussa J, Maalouf K, Dimassi HI, Khalaf RA (2011) Characterization of Pga1, a putative Candida albicans cell wall protein necessary for proper adhesion and biofilm formation. Mycoses 54:491–500 Hube B, Naglik J (2001) Candida albicans proteinases: resolving the mystery of a gene family. Microbiology 147:1997–2005

World J Microbiol Biotechnol Hube B, Monod M, Schofield DA, Brown AJ, Gow NA (1994) Expression of seven members of the gene family encoding secretory aspartyl proteinases in Candida albicans. Mol Microbiol 14:87–99 Kathwate GH, Karuppayil SM (2013) Antifungal properties of the anti-hypersensitive drug: Aliskiren. Arch Oral Biol 58:1109–1115 Korting HC, Schaller M, Eder G, Hamm G, Bo¨hmer U, Hube B (1999) Effects of the human immunodeficiency virus (HIV) proteinase inhibitors saquinavir and indinavir on in vitro activities of secreted aspartyl proteinases of Candida albicans isolates from HIV-infected patients. Antimicrob Agents Chemother 43:2038–2042 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression delta using real-time quantitative PCR and the 2-DDCT method. Methods 25:402–408 Meiler TF, Hube B, Schild L, Shirtliff ME, Scheper MA, Winkler R, Ton A, Jabra-Rizk AM (2009) A novel immune evasion strategy of Candida albicans: proteolytic cleavage of a salivary antimicrobial peptide. PLoS One. doi:10.1371/journal.pone.0005039 Naglik JR, Challacombe SJ, Hube B (2003) Candida albicans secreted aspartyl proteinases in virulence and pathogenesis. Microbiol Mol Biol Rev 67:400–428 Naglik JR, Moyes D, Makwana J, Kanzaria P, Tsichlaki E, Weindl G, Tappuni AR, Rodgers CA, Woodman AJ, Challacombe SJ, Schaller M, Hube B (2008) Quantitative expression of the Candida albicans secreted aspartyl proteinase gene family in human oral and vaginal candidiasis. Microbiology 154:3266–3280 Naglik J, Moyes DL, Wa¨chtler B, Hube B (2011) Candida albicans interactions with epithelial cells and mucosal immunity. Microbes Infect 13:963–976 Newport G, Agabian N (1997) KEX2 influences Candida albicans proteinase secretion and hyphal formation. J Biol Chem 272:28954–28961 Ochal Z, Kamin´ski R (2005) Transformation of bromodichloromethyl-4-chlorophenyl sulfone into new compounds with potential pesticidal activity. Pol J Appl Chem 3:215–255 Ochal Z, Wo´jcicki J (2007) Transformations of chlorodibromomethyl-4-chlorophenyl sulfone into new compounds with potential pesticidal activity. Pol J Appl Chem 51:29–41 Pappas PG, Kauffman CA, Andes D, Benjamin DK Jr, Calandra TF, Edwards JE Jr, Filler SG, Kullberg BJ, Ostrosky-Zeichner L, Reboli AC, Rex JH, Walsh TJ, Sobel JD (2009) Clinical practice guidelines for the management of Candidiasis: 2009 update by the Infectious Diseases Society of America. Clin Infect Dis 48:503–535 Pfaller MA, Diekema DJ (2007) Epidemiology of invasive candidiasis: a persistent public health problem. Clin Microbiol Rev 20:133–163 Samaranayake DP, Hanes SD (2011) Milestones in Candida albicans gene manipulation. Fungal Genet Biol 48:858–865 Samaranayake YH, Cheung BPK, Yau JYY, Yeung SKW, Samaranayake LP (2013) Human serum promotes Candida albicans

biofilm growth and virulence gene expression on silicone biomaterial. PLoS One. doi:10.1371/journal.pone.0062902 Sardi JCO, Scorzoni L, Bernardi T, Fusco-Almeida AM, Mendes Giannini MJ (2013) Candida species: current epidemiology, pathogenicity, biofilm formation, natural antifungal products and new therapeutic options. J Med Microbiol 62:10–24 Schild L, Heyken A, de Groot PW, Hiller E, Mock M, de Koster C, Horn U, Rupp S, Hube B (2011) Proteolytic cleavage of covalently linked cell wall proteins by Candida albicans Sap9 and Sap10. Eukaryot Cell 10:98–109 Sherman F (2002) Getting started with yeast. Methods Enzymol 350:3–41 Shinde RB, Raut JS, Karuppayil MS (2012) Biofilm formation by Candida albicans on various prosthetic materials and its fluconazole sensitivity: a kinetic study. Mycoscience 53:220–226 Staniszewska M, Bondaryk M, Zielin´ska P, Urban´czyk-Lipkowska Z (2014) The in vitro effects of new D186 dendrimer on virulence factors of Candida albicans. J Antibiot. doi:10.1038/ja.2014.25 Wa¨chtler B, Wilson D, Hube B (2011) Candida albicans adhesion to and invasion and damage of vaginal epithelial cells: stagespecific inhibition by clotrimazole and bifonazole. Antimicrob Agents Chemother 55:4436–4439 Walker LA, MacCallum DM, Bertram G, Gow NA, Odds FC, Brown AJ (2009) Genome-wide analysis of Candida albicans gene expression patterns during infection of the mammalian kidney. Fungal Genet Biol 46:210–219 Wang YC, Huang SH, Lan CY, Chen BS (2012) Prediction of phenotype-associated genes via a cellular network approach: a Candida albicans infection case study. PLoS One. doi:10.1371/ journal.pone.0035339 Watamoto T, Samaranayake LP, Egusa H, Yatani H, Samaranayake YH, Seneviratne CJ (2010) Susceptibility of Candida albicans filamentation-defective mutants to clinical biocides. J Hosp Infect 74:189–191 Watts HJ, Cheah FSH, Hube B, Sanglard D, Gow NAR (1998) Altered adherence in strains of Candida albicans harbouring null mutations in secrete aspartic proteinase genes. FEMS Microbiol Lett 159:129–135 Wu T, Wright K, Hurst SF, Morrison CJ (2000) Enhanced extracellular production of aspartyl proteinase, a virulence factor, by Candida albicans isolates following growth in subinhibitory concentrations of fluconazole. Antimicrob Agents Chemother 44:1200–1208 Xu W, He J, He M, Han F, Chen X, Pan Z, Wang J, Tong M (2011) Synthesis and antifungal activity of novel sulfone derivatives containing 1,3,4-oxadiazole moieties. Molecules 16:9129–9141 Zarb P, Amadeo B, Muller A, Drapier N, Vankerckhoven V, Davey P, Goossens H, ESAC-3 hospital care subproject group (2012) Antifungal therapy in European hospitals: data from the ESACpoint prevalence surveys 2008 and 2009. Clin Microbiol Infect. doi:10.1111/j.1469-0691.2012.03973.x

123